Post on 21-Jan-2021
www.sciencemag.org/content/354/6316/1170/suppl/DC1
Supplementary Materials for
Generation of influenza A viruses as live but replication-incompetent virus
vaccines
Longlong Si, Huan Xu, Xueying Zhou, Ziwei Zhang, Zhenyu Tian, Yan Wang, Yiming Wu, Bo Zhang, Zhenlan Niu, Chuanling Zhang, Ge Fu, Sulong Xiao, Qing Xia, Lihe Zhang,
Demin Zhou* *Corresponding author. Email: deminzhou@bjmu.edu.cn
Published 2 December 2016, Science 354, 1170 (2016)
DOI: 10.1126/science.aah5869
This PDF file includes: Materials and Methods
Figs. S1 to S15
Tables S1 and S2
References
Materials and Methods
Viruses and vaccines.
Influenza A/WSN/33 virus (H1N1) (WSN) was utilized as a study model. “WSN”
is the acronym for the influenza A/Wilson Smith/1933 (H1N1) Neurotropic variant,
which was deliberately selected by repeatedly passaging its parent virus, influenza
A/Wilson Smith/1933 (H1N1) virus (WS), in mouse brain (28,29). The WS virus was
isolated by Wilson Smith and his colleagues from human influenza by inoculating
ferrets in 1933 (30). The influenza A/reassortant/NYMC X-179A (pH1N1) and
influenza A/Aichi/2/68 (H3N2) viruses were kindly provided by Sinovac Biotech Ltd
(Beijing). Two marketed vaccines, an inactivated influenza vaccine (IIV) and a cold-
adapted live attenuated influenza vaccine (CAIV), which have been used clinically in
China and the USA, respectively, were provided by Sinovac Biotech Ltd (Beijing) and
BioVector NTCC Inc (China) and utilized as positive controls.
Plasmid construction.
The 12-plasmid influenza A/WSN/33 virus (H1N1) rescue system was kindly
provided by Professor George F. Gao and Professor Wenjun Liu from the Center for
Molecular Virology, CAS Key Laboratory of Pathogenic Microbiology and
Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China.
Mutant plasmids (pHH21-NP-TAG, pHH21-PB2-TAG, pHH21-PB1-TAG, pHH21-
PA-TAG, pHH21-M-TAG, pHH21-NS-TAG, pHH21-HA-TAG, and pHH21-NA-
TAG) containing amber codons within the open reading frame were obtained from the
wild-type plasmids (pHH21-NP, pHH21-PB2, pHH21-PB1, pHH21-PA, pHH21-M,
pHH21-NS, pHH21-HA, pHH21-NA) via site-directed mutagenesis (Agilent
Technologies) and confirmed by gene sequencing (BGI Beijing).
The methanosarcina barkeri MS pyrrolysyl tRNA synthetase/tRNACUA pair
(MbpylRS/tRNACUA) for site-specific incorporation of the unnatural amino acid (UAA)
Nε-2-azidoethyloxycarbonyl-L-lysine (NAEK) was developed in-house as previously
reported (12, 13). NAEK is nontoxic, as shown in Fig. S15.
The pSD31 lentiviral vector and helper plasmids (pRSV, pMD2G-VSVG and
pRRE) were preserved in our lab (14). The pSD31-IRES-hygro plasmid was obtained
by replacing the SV40 promoter and pac gene, which confers puromycin resistance, in
the pSD31 lentivirus plasmid with the IRES (internal ribosome entry site) gene and hph
gene, which confers hygromycin resistance. The pSD31-IRES-puro plasmid was
obtained in the same way. The PylRS gene driven by a nonregulated CMV promoter
was cloned into the pSD31-IRES-puro plasmid to obtain the pSD31-pylRS plasmid.
The GFP gene with an amber codon engineered at residue position 39 was expressed
under a CMV promoter and cloned into the pSD31-IRES-hygro plasmid to obtain the
pSD31-GFP39TAG plasmid. The bjmu vector backbone was constructed by inserting a
fragment containing a polyA signal, f1 origin and SV40 origin within the KpnI and
EcoRI sites of the PUC19 vector. To obtain the bjmu-12t-zeo vector, the Sh ble gene,
which was used to confer resistance to Zeocin™, and an SV40 polyA signal were
cloned in after the SV40 promoter of the bjmu vector, then 12 copies of tRNA CUAPyl
genes driven by human 7sk, human H1, human U6 and mouse U6 respectively were
digested with BamHI/BglII restriction enzymes and cloned into the BamHI site of the
bjmu vector. All plasmids were confirmed by gene sequencing (BGI Beijing).
All plasmids used for transfection were amplified using a Maxiprep kit (Promega),
according to the manufacturer’s instructions.
Establishment of the transgenic cell line HEK293T-tRNA/pylRS/GFP39TAG.
HEK293T cells were used for lentiviral vector packaging and transduction. The
cells were cultured in DMEM medium (Macgene, without sodium pyruvate),
supplemented with 10% FBS (PAA), and 1 mM nonessential amid acids (Gibco).
Subconfluent HEK293T cells in 6-well plates were co-transfected with 0.72 µg of
pSD31 transfer plasmid, 0.64 µg of pRSV, 0.32 µg of pMD2G-VSVG and 0.32 µg of
pRRE using the transfection reagent Megatran1.0 (Origene). Then, 6 h later, the
transfection medium was replaced by DMEM medium supplemented with 3% FBS and
1 mM nonessential amid acids. Next, the lentivirus-containing supernatant was
harvested at 48 h post-infection and filtered through a 0.45 µm filter. The resultant dual
lentiviruses pSD31-pylRS and pSD31-GFP39TAG were used to integrate pylRS and the
GFP39TAG gene into the genome of HEK293T cells. Experiments for stable lentiviral
transduction were carried out as follows: HEK293T cells were seeded in a 6-well plate
and transduced 24 h later with lentiviral filtrates in the presence of 8 µg/mL polybrene.
Then, selection was performed under the pressure of 600 ng/mL puromycin and 200
µg/ml hygromycin until parental cells completely died. The resultant stably transduced
HEK293T-pylRS/GFP39TAG cells were transfected with linearized bjmu-12t-zeo
plasmid DNA and cultured under the pressure of 200 µg/ml Zeocin until parental cells
completely died. In presence of UAA, the stably transfected cells, HEK293T-
tRNA/pylRS/GFP39TAG, were then sorted by fluorescence-activated cell sorting (FACS)
according to the GFP phenotype and verified by their dependence on UAA for GFP
expression.
Generation of wild-type influenza viruses and replication-incompetent
influenza viruses harboring amber codon(s) in their genome.
For generation of wild-type influenza viruses, 2×105 cells per well from the
HEK293T-tRNA/pylRS/GFP39TAG cell line were seeded into 6-well plates in DMEM
supplemented with 10% FBS 24 h before transfection. Then a mixture of 0.1 µg each
of the 12 plasmids in the virus rescue system was transfected into the cells using
Megatran 1.0 reagent (Origene) according to the manufacturer’s instructions. Six hours
later, the medium containing the mixture of plasmids and Megatran 1.0 reagent was
replaced with DMEM supplemented with 1% FBS and 2 µg/ml L-1-tosylamide-2-
phenylethyl chloromethyl ketone (TPCK)-treated trypsin. The cells were further
incubated at 37℃ in 5% CO2 until >90% cytopathic effect (CPE) was observed, and
the supernatant containing the generated virus was harvested and centrifuged at 1000 ×
g for 10 min to remove contaminating cells (17, 31).
To generate replication-incompetent influenza viruses harboring amber codon(s)
in their genome, an almost identical procedure was carried out, with the following
changed: The plasmid(s) expressing wild-type viral RNA was replaced by the
corresponding mutant plasmid(s), and the medium was further supplemented with 1
mM UAA, e.g., Nε-2-azidoethyloxycarbonyl-L-lysine (NAEK). To identify the UAA-
dependent viral strains, a parallel packaging experiment was conducted, in which the
medium was not supplemented with UAA.
Plaque formation assay.
MDCK cells or transgenic HEK293T-tRNA/pylRS/GFP39TAG cells were grown in
a 12-well cell culture plate to produce a confluent monolayer. After the cells were
washed with PBS, they were inoculated with influenza virus and incubated at 37℃for
1 h for viral absorption. Unabsorbed virus was removed by washing the cells with PBS,
and then 1 ml of DMEM supplemented with 2 µg/ml TPCK-treated trypsin, 10 mM
NAEK, and 1.5 % agarose was then added to each well. After incubation for 4-16 days
at 37℃ in 5 % CO2, the cells were fixed with 4 % paraformaldehyde, then stained with
crystal violet (Sigma-Aldrich). Visible plaques were counted, and the virus titers were
determined (31).
Virus growth curve analysis.
To determine in vitro virus growth rates, triplicate wells of confluent transgenic
cells, HEK293T-tRNA/pylRS/GFP39TAG, (6-well plate format, 106 cells/well) were
infected at an MOI of 0.001(21,22). After 1 h of virus adsorption at 37℃, cells were
washed and overlaid with DMEM supplemented with 1% FBS, 2 µg/ml TPCK-treated
trypsin, and 1 mM NAEK. At the indicated times post-infection (1, 2, 3, 4, 5, 6, and 7
day), the cell supernatants were collected and viral titers were determined by the plaque
formation assay as described above.
Genetic stability evaluation of replication-incompetent viruses.
HEK293T-tRNA/pylRS/GFP39TAG cells at 104 cells per well in 24-well plates were
infected with replication-incompetent influenza virus strains at an MOI of 0.01 in
DMEM supplemented with 1% FBS, 2 µg/ml TPCK-treated trypsin and 1 mM NAEK.
When >90% CPE was observed, the supernatants were collected and used for infection
in the next round of investigation. The procedure was repeated more than 20 times. A
parallel experiment, in which the medium was not supplemented with NAEK, was
conducted to detect the viral UAA-dependency. After each passage, total RNA was
isolated from cells using TRIzol (Invitrogen, Carlsbad, CA, USA). Next, the first strand
of cDNA was synthesized by using AMV reverse transcriptase (Promega) with a
random primer and an oligo (dT) primer, according to manufacturer’s specifications.
PCR was carried out using the Phusion Hot Start Flex 2 × Master Mix (BioLab) with
30 µl of a reaction mixture containing primers specific for different influenza
A/WSN/33 (H1N1) gene segments. The PCR conditions were 1 cycle at 98℃ for 2
min, followed by 30 cycles at 98℃ for 15 s, 55℃ for 30 sec, 72℃ (30sec/kb), and
finally 1 cycle at 72℃ for 5 min. The resulting PCR products were gene sequenced to
investigate whether any mutation occurred during viral passages.
Escape assay.
The escape frequencies of PTC virus strains were obtained by measuring the ratio
of escape mutant plaque formation units (PFU) to total PFU. Briefly, the collected PTC
virus supernatant was serial diluted, and equal volumes of the supernatant were used to
infect transgenic cells. After 1 h at 37 ℃, unabsorbed virus was removed by washing
the cells with PBS. To obtain the total PFU, the cells were overlaid with DMEM
supplemented with 2 µg/ml TPCK-treated trypsin, 1.5 % agarose, and 10 mM UAA. To
obtain the escape mutant PFU, the cells were overlaid with DMEM supplemented with
2 µg/ml TPCK-treated trypsin and 1.5 % agarose. After incubation for 4-16 days at 37℃
in 5 % CO2, visible plaques in absence or presence of UAA were counted, and the
escape frequencies were calculated as the total number of escape mutant PFU observed
per total PFU. When escape mutants were not detected if the total PFU reached 1011,
the escape frequency was described to be below the limit of detection. Reported escape
frequencies are the means of three technical replicates where error bars represent ± s.d.
Escape mutant identity.
Six escape mutants per virus strain (HA-K57, PB2-Q13, PB2-T35, NS-F103, M2-
K49, and M2-K60) were isolated from the virus pools through plaque purification in
the absence of UAA. An escape mutant was designated by a number following the letter
‘E’ (for example, E1). The purified escape mutants were cultured in conventional 293T
cells, total RNA was isolated from cells using TRIzol. Then the first strand of cDNA
was synthesized using AMV reverse transcriptase (Promega, Madison, WI, USA) with
a random primer and an oligo (dT) primer, according to manufacturer’s specifications.
PCR was carried out using the Phusion Hot Start Flex 2 × Master Mix (New England
BioLab, UK) with 30 µl of a reaction mixture containing primers specific for different
influenza A/WSN/33 (H1N1) gene segments. The PCR conditions were 1 cycle at 98℃
for 2 min, followed by 30 cycles at 98℃ for 15 s, 55℃ for 30 sec, 72℃ (30sec/kb),
and finally 1 cycle at 72℃ for 5min. The resulting PCR products were gene sequenced
to investigate whether any mutation occurred in escape mutants.
Purification and morphological observation of wild-type and replication-
incompetent influenza virus particles.
Wild-type and replication-incompetent influenza viruses were prepared as
described above. The supernatant was harvested and clarified (1000 × g, 15 min, 4℃).
The clarified supernatant was concentrated by ultracentrifugation (105 × g, 2 h, 4℃, in
a Ti40 rotor). Then, the precipitated virus was resuspended in 0.5 ml of NTE buffer
(100 mM NaCl, 10 mM Tris-Cl (pH 7.4), 1 mM EDTA) and purified over a 20-60%
sucrose gradient (105 × g, 2 h, 4℃, in a SW40 rotor). The banded viruses were collected,
diluted with NTE buffer, pelleted (105 × g, 2 h, 4℃, in a SW40 rotor), and resuspended
in approximately 1 ml of PBS. The purified viruses were either used immediately or
flash frozen in aliquots and stored at -80℃ until use. The morphology of viruses was
observed under transmission electron microscope (TEM) by negative straining (18).
Preparation of formalin-inactivated virus.
The IIV was manufactured according to the Chinese Pharmacopoeia’s instructions
and provided by Sinovac Biotech Ltd (Beijing). Briefly, the influenza virus was
generated using plasmid-based reverse genetics as described above. The culture
supernatant containing the virus was treated with 0.1% formalin (final concentration)
(Sigma-Aldrich) at 4℃ for a week to inactivate infectivity (32). Inactivation of the
virus was confirmed by the absence of detectable infectious virus following inoculation
of formalin-treated virus into MDCK cells. After confirmation of inactivation of
infectivity, formalin-treated virus was purified by sucrose-gradient ultracentrifugation
at 105 × g for 2 h at 4℃ and stored at -80℃ until use. An ELISA assay was employed
to quantify the concentrations of HA antigen in the IIV and PTC virus vaccine. To
directly compare the immunogenicity and protective efficacy between does of PTC
virus and inactivated vaccine, the amount of HA antigen in inactivated vaccine used in
animal experiments was equal to that in the PTC virus vaccine.
Mouse studies.
Six-week-old female specific-pathogen-free BALB/c mice were used in this study.
First, wild-type A/WSN/33 (H1N1), PTC-4A, inactivated influenza A/WSN/33 (H1N1)
virus vaccine (IIV), and cold-adapted live attenuated influenza vaccine (CAIV) were
tested for their replicative capacity. Groups of fifteen mice were anesthetized with
pentobarbital sodium before being inoculated intranasally with either 50 µl of 105 PFU
of wild-type A/WSN/33 (H1N1), 105 PFU of IIV, 105 PFU of CAIV, 105, 107, or 109
PFU of PTC-4A, which were 10-fold, 103-fold, and 105-fold equivalent to the LD50 of
the wild-type A/WSN/33 (H1N1), respectively, or with PBS as a control. Five mice
from each group were sacrificed on day 3 post-inoculation (p.i.), and their organs were
harvested, homogenized, and titered by plaque formation assay. The remaining ten mice
were observed daily for body weight changes and death for 2 weeks (33). All animal
experiments were performed in accordance with the guidelines of the Institutional
Animal Care and Use Committee of the Peking University.
For immunogenicity and vaccine studies, groups of twenty mice were anesthetized
with pentobarbital sodium and intranasally inoculated with 106 PFU of either PTC-4A
or CAIV in 50 µl once or twice (three weeks apart), or with PBS as a control. In the IIV
groups, twenty mice were intramuscularly inoculated with the same dosage of IIV once
or twice (three weeks apart). Sera were collected from five animals in each group 3
weeks after each vaccination for hemagglutination inhibition (HI) assays, neutralization
(NT) antibody detection, and immunoglobulin G (IgG) antibody detection. Three weeks
after the second vaccination, lung tissue samples were harvested from five mice in each
group, suspended in 200 µl PBS, and kept at -80℃ until used for immunoglobulin A
(IgA) and virus-specific CD8+ T cell detection. Three weeks after vaccination, groups
of fifteen mice were intranasally challenged with 5 × 105 PFU of homologous wild-type
viruses. Five mice from each group were sacrificed on day 3 post-challenge (p.c.), and
their lung organs were collected for virus titration. The remaining ten mice were
observed for body weight changes and death for 2 weeks (33).
To evaluate the cross-reactive immunity of PTC-4A against
heterologous/heterosubtypic influenza viruses, groups of fifteen mice were
anesthetized with pentobarbital sodium and intranasally inoculated with 106 PFU of
either PTC-4A in 50 µl once or twice (three weeks apart), or with PBS as a control.
Three weeks after the second vaccination, the mice were challenged with either 50 µl
of 106 PFU of heterologous influenza A/reassortant/NYMC X-179A (pH1N1) or
heterosubtypic A/Aichi/2/68 (H3N2) viruses, which were kindly provided by Sinovac
Biotech Ltd (Beijing). Five mice from each group were sacrificed on day 3 post-
challenge (p.c.), and their organs were collected for virus titration. The remaining ten
mice were observed for body weight changes and death for 2 weeks (33).
Ferret studies.
Four-month-old female ferrets (Wuxi Cay Ferret Farm, Jiangsu, China) that were
sero-negative were used in this study. To evaluate the replication ability of wild-type
A/WSN/33 (H1N1), PTC-4A, IIV, and CAIV in this animal model, groups of ten ferrets
were inoculated with either 106 PFU of wild-type A/WSN/33 (H1N1), 106 PFU of IIV,
106 PFU of CAIV, 106, 107, and 109 PFU of PTC-4A, or with PBS as a control. Each
ferret was inoculated with test virus in a volume of 500 µl (250 µl per nostril). Five
ferrets from each group were sacrificed on day 3 post-inoculation (p.i.), and their organs
were harvested, homogenized, and titered by plaque formation assay. The remaining
five ferrets were observed daily for body weight changes and death for 2 weeks (33).
To evaluate the protective efficacy of PTC-4A, groups of ten 4-month-old female
ferrets were intranasally inoculated once or twice with 107 PFU of PTC-4A or CAIV in
500 µl (250 µl per nostril) (three weeks apart) or with PBS as a control. In the IIV group,
ten ferrets were intramuscularly inoculated with the same dosage of IIV once or twice
(three weeks apart). Sera were collected from five animals in each group 3 weeks after
each vaccination for hemagglutination inhibition (HI) assays, neutralization (NT)
antibody detection, and immunoglobulin G (IgG) antibody detection. Three weeks after
the second vaccination, lung tissue samples were harvested from three ferrets in each
group for immunoglobulin A (IgA) detection. The remaining seven ferrets were
intranasally challenged with 106 PFU of homologous wild-type viruses. Three ferrets
from each group were sacrificed on day 3 post-challenge (p.c.), and their organs were
collected for virus titration. The remaining four ferrets were observed for body weight
changes and death for 2 weeks (33).
Guinea pig studies.
Female guinea pigs (VITAL RIVER) weighing 250-280 g were used in this study.
To evaluate the replication ability of wild-type A/WSN/33 (H1N1), PTC-4A, IIV, and
CAIV in this animal model, groups of ten guinea pigs were inoculated with 106 PFU of
either wild-type A/WSN/33 (H1N1), IIV, CAIV, PTC-4A, or with PBS as a control.
Each guinea pig was inoculated with test virus in a volume of 300 µl (150 µl per nostril).
Five guinea pigs from each group were sacrificed on day 3 post-inoculation (p.i.), and
their organs were harvested, homogenized, and titered by plaque formation assay. The
remaining five guinea pigs were observed daily for body weight changes and death for
2 weeks (33).
To evaluate whether a natural route of transmission could occur between PTC
virus-inoculated and non-inoculated animals, five guinea pigs from the vehicle group
were put into the same cage that hosted five guinea pigs that had been inoculated with
106 PFU of wild-type A/WSN/33 (H1N1) or PTC-4A 24 h before. Nasal washes were
collected from all animals at 2-day intervals, beginning on day 0 post-contact and
continuing for 7 days, and then titrated by plaque formation assay. The ambient
conditions for these studies were set at 20-22 ℃ and 30%-40% relative humidity.
To evaluate the protective efficacy of PTC-4A, groups of ten female guinea pigs
were intranasally inoculated twice with 107 PFU of PTC-4A or CAIV in 300 µl (150 µl
per nostril) (three weeks apart) or with PBS as a control. In the IIV group, ten guinea
pigs were intramuscularly inoculated with the same dosage of IIV twice (three weeks
apart). Sera were collected from five animals in each group 3 weeks after each
vaccination for hemagglutination inhibition (HI) assays and neutralization (NT)
antibody detection. Three weeks after the second vaccination, the guinea pigs were
intranasally challenged with 106 PFU of homologous wild-type viruses. Five guinea
pigs from each group were sacrificed on day 3 post-challenge (p.c.), and their organs
were collected for virus titration. The remaining five guinea pigs were observed for
body weight changes and death for 2 weeks (33).
To evaluate whether a single dose of the PTC virus vaccine could prevent wild-
type influenza virus infection by a natural route of transmission, groups of five guinea
pigs were inoculated with either 107 PFU of PTC-4A in a volume of 300 µl (150 µl per
nostril) or with PBS as a control. Three weeks later, five animals from each group were
put into the same cage that hosted five guinea pigs that had been inoculated with 107
PFU of wild-type viruses 24 h before. Nasal washes were collected from all animals at
2-day intervals, beginning on day 0 post-contact and continuing for 7 days, and then
titrated by plaque formation assay. The ambient conditions for these studies were set at
20-22 ℃ and 30%-40% relative humidity.
Quantitative reverse transcription-polymerase chain reaction (qRT-PCR).
To detect the influenza virus vRNA levels in different tissues of mice infected with
wild-type or PTC-4A viruses, total RNA was isolated from tissue cells using TRIzol
(Invitrogen, Carlsbad, CA, USA). The first strand of cDNA was then synthesized using
AMV reverse transcriptase (Promega), according to manufacturer’s specifications, with
strand- and sense-specific oligonucleotides for vRNA (5’ AGCGAAAGCAGG 3’ and
5’ AGCAAAAGCAGG 3’). The GAPDH gene with a specific primer (5’
GAAGATGGTGATGGGATTTC 3’) was included as an internal control in the reverse
transcription reaction mixture for vRNA analysis. Quantitative real-time PCR was
carried out according to the GoTaq qPCR Master Mix (Promega) with 20 μl of a
reaction mixture containing primers specific for influenza A/WSN/33 M1 segment
(forward: 5’GACCAATCCTGTCACCTC 3’ and reverse: 5’
GATCTCCGTTCCCATTAAGAG 3’) or for GAPDH RNA (forward: 5’
GAAGGTGAAGGTCGGAGTC 3’ and reverse: 5’ GAAGATGGTGATGGGATTTC
3’). The PCR conditions were 1 cycle at 95℃ for 5 min, followed by 40 cycles at 95℃
for 15 s, 60℃ for 1 min, and 1 cycle at 95℃ for 15 s, 60℃ for 15 s, 95℃ for 15 s.
The results were calculated using the 2-△△CT (two delta delta CT) method according to
the GoTaq qPCR Master Mix (Promega) manufacturer’s specifications (34).
Enzyme-linked immunosorbent assay (ELISA).
Immunoglobulin G (IgG) antibody in sera and IgA antibody in lung wash fluid
from the immunized animals was measured using an enzyme-linked immunosorbent
assay (ELISA) (38). In this assay, 96-well ELISA plates (Thermo Fisher Scientific Inc.,
USA) were coated with recombinant proteins (HA, NA and NP) from homologous wild-
type viruses (0.2 µg/ml) (Sino Biological Inc., Beijing, China) or purified wild-type
viruses in 100 mM bicarbonate/carbonate buffer at pH 9.5 (100 µl/well, overnight at
4℃). Before and after each step, wells were washed with PBS. Wells were blocked with
2% bovine serum albumin (BSA; Sigma) in PBS-0.05% Tween 20 (blocking buffer)
(150 µl/well, 1 h at 37℃). Serum samples for viral protein-specific IgG detection, or
lung wash fluids for virus-specific IgA detection, were diluted in blocking buffer and
added to wells (100 µl/well, 1 h at 37℃). After washing, plates were blocked again with
blocking buffer (150 µl/well, 1 h at 37℃) and then HRP-conjugated anti-mouse/ferret
IgG antibody or HRP-conjugated anti-mouse/ferret IgA antibody (Zhongshan Golden
Bridge Biotechnology Inc., Beijing, China) diluted 1:5000 in blocking buffer was added
(100 µl/well, 1h at 37℃). Plates were detected with 3,3’,5,5’-tetramethyl benzidine
(TMB) substrate (Millipore, Billerica, MA, USA) and stopped after 15 min with 0.5 M
H2SO4. Plates were read at 450 nm using a plate reader (Tecan Infinite M2000 PRO;
Tecan Group Ltd., Mannedorf, Switzerland).
Detection of virus-specific CD8+ T lymphocytes.
A tetramer assay was used to detect virus-specific CD8+ T lymphocytes (35).
Immunized mice were anesthetized, and their lungs were perfused through the heart
with a total of 20 ml of PBS with heparin. Then, the lungs were dissected and cut into
small pieces using a sterile scalpel. The pieces of lung tissue were incubated with
1mg/ml collagenase D (Roche) for 3 hours at 37℃. After incubation, lung homogenates
were forced through cell strainers (BD Biosciences) and washed 3 times with DMEM
supplemented with 2% FBS. Finally, lymphocytes were isolated using lympholyte
density gradients (Sanbio) according to the manufacturer’s protocol and washed with
FACS buffer (1% BSA, 5 mM EDTA in PBS). Cells were then stained with anti-mouse
CD8a-APC antibody (BD Bioscience) and Phycoerythrin (PE)-conjugated H-2Kd
tetramer specific to the NP epitope (amino acid positions 147-155, TYQRTRALV)
(MBL). Samples were analyzed with a FACSCalibur flow cytometer (BD Biosciences).
Reassortment of PTC virus with wild-type virus in vitro and in vivo.
In our in vitro assay, MDCK cells were infected with a mixture of wild-type virus
(MOI=0.01) and PTC virus (MOI=1 or 0.1). The cell supernatants were collected at 12-
h intervals, beginning at 24 h post-infection and continuing for 72 hours, and then
titrated by plaque formation assay. CAIV was used as a control.
For our in vivo assay, groups of fifteen BALB/c mice were intranasally inoculated
with 2 × 104 PFU of wild-type virus or a mixture of 2 × 104 PFU of wild-type virus and
2 × 106 PFU of PTC-4A, IIV or CAIV. It is important to note that simultaneous infection
is more or less artificial. In reality, individuals vaccinated with PTC virus vaccine would
more likely be infected with wild-type virus shortly before or after vaccination. To
mimic this theoretical situation, a group of fifteen mice was intranasally inoculated with
2 × 106 PFU of PTC-4A 24 h post-infection with 2 × 104 PFU of wild-type virus. Five
mice from each group were sacrificed on day 3 post-inoculation (p.i.), and their organs
were harvested, homogenized, and titered by plaque formation assay. The titers of wild-
type viruses were obtained by plaque formation in the absence of UAA. The reassortant
clones were isolated from the virus pools through plaque purification in the presence of
UAA. The remaining ten mice were observed daily for body weight changes and death
for 2 weeks (33). All animal experiments were performed in accordance with the
guidelines of the Institutional Animal Care and Use Committee of the Peking University.
Hemagglutination inhibition (HAI) assay.
Sera samples were tested for the titer of HAI antibodies by standard methods
using 4 HA units of wild-type virus in V-bottom 96-well microtiter plates with 0.5%
chicken red blood cells (cRBC) (36). Briefly, sera were pre-treated with receptor-
destroying enzyme (RDE) (1 volume sera: 3 volume RDE) from Vibrio cholerae at
37℃ for 16 h prior to heat to inactivation for 30 min at 56℃. Sera were two-fold
serially diluted starting at 1:10 in PBS in V-bottom well microtiter plates, and an equal
volume of eight agglutinating doses (AD) of virus antigen as determined by titration
against 0.5% chicken red blood cell suspension in PBS was added, and then incubated
at room temperature for 1 h. An equal volume of 0.5% (v/v) chicken red blood cells
in PBS were added. The mixture was incubated for 30 min at room temperature before
HI titers were read.
Microneutralization (MN) assay.
The MN assay was adapted from the method recommended by the World Health
Organization (37). MDCK cells were grown in DMEM supplemented with 10% FBS,
2 mM L-glutamine, 100 µg/ml streptomycin, and 100 U/ml penicillin at 37℃ with
5% CO2. Sera were treated with destroying enzyme (RDE) as described by Kitikoon,
P. and Vincent, A.L. and stored at -20℃ until processing (37). MDCK cells were
subcultured into 96-well plates 2 or 3 days prior to conducting the assay to ensure
confluent monolayers when starting the neutralization assay. Two-fold serial dilutions
of RDE-treated sera starting at 1:10 in infection medium were incubated with 100×50%
tissue culture infective doses (TCID50) of virus for 1 h at 37℃. The sera/virus mixture
was then added to MDCK cells in infection medium with 2 μg/ml TPCK-treated
trypsin. The cells were incubated for 3 to 5 days at 37℃ with 5% CO2, and observed
for the presence of cytopathic effect. Neutralizing titer was defined as the reciprocal
of the highest dilution of sera that completely neutralized infectivity of 100×TCID50
of wild-type virus for MDCK cells. Infectivity was identified by the presence of CPE.
Statistical analysis.
The one-way ANOVA with Newman-Keuls multiple comparisons test was used
to analyze differences in mean values between groups. Differences were considered
significant when the P value was less than 0.05. ★, P < 0.05; ★★, P < 0.01; ★★★, P <
0.001; n.s., not significant. All results are expressed as means ± SDs of the means.
Error bars indicated N > 2.
Fig. S1. Schematic representative of the generation of a transgenic cell line,
HEK293T-tRNA/pylRS/GFP39TAG, which is compatible with orthogonal
translation machinery for constitutive expression of amber codon-containing
genes with such an integrated GFP gene as a reporter. (A) The pSD31-derived
lentiviral vectors (pSD31-pylRS-IRES-puro and pSD31-GFP39TAG-IRES-hygro) and
PUC19-derived vector bjmu-12t-zeo used for sequential integration of a CMV
promoter-driven pylRS gene cassette, an amber codon-containing green fluorescent
protein (GFP) gene cassette (GFP39TAG), and a cassette harboring 12 tandem tRNA-
expression sequences driven separately by four different pol III promoters (human 7sk,
U6, H1, and mouse U6) into the host genome of HEK293T. (B) Schematic
representative of the sequential transduction and stable transfection of HEK-293T cells
for generation of transgenic HEK293T-tRNA/pylRS/GFP39TAG cells compatible with
orthogonal translation machinery; an amber codon-containing GFP gene acting as a
reporter.
Fig. S2. Multicycle growth curve of the strain NP-D101, CAIV, and wild-type
viruses. Transgenic cells, HEK293T-tRNA/pylRS/GFP39TAG, or conventional 293T
cells were infected at an MOI of 0.001. After 1 h of virus adsorption at 37℃, cells were
washed and overlaid with DMEM supplemented with 1% FBS, 2 µg/ml TPCK-treated
trypsin, and 1 mM NAEK. At the indicated times post-infection (1, 2, 3, 4, 5, 6, and 7
day), the cell supernatants were collected and viral titers were determined by plaque
formation assay.
(A)
NP
PB1
NA
HA
NS
PB2
PA
M2
M1
(B)
Fig. S3. An evolutionary conservation analysis of the influenza viral proteins
according to ConSurf calculation (23). (A) The constitutive amino acid residues in
eight viral proteins together with their conservation levels were graded by color. (B)
Either 22 or 8 amino acid residues selected for replacement by UAA were labeled
within the tertiary structure of each viral protein. NP, PDB: 2IQH; PB1, PDB: 4WSB;
NA, PDB: 3TI6; HA, PDB: 1RVT; NS, PDB: 4OPH; PB2, PDB: 4WSB; PA, PDB:
4IUJ; M2, PDB: 2RLF; M1, PDB: 4PUS.
NP
PB1
NA
HA
NS
PB2
PA
M2
M1
Fig. S4. (A) Characterizations of the effect, by CPE assay, on generation of progeny
viruses upon replacement of the selected codon in a viral genome by an amber codon.
Transgenic HEK293T-tRNA/pylRS/GFP39TAG cells were cultured in the presence or
absence of UAA. (B) Verification of the genetic stability of progeny PTC viruses after
20 passages in the transgenic cells, as reflected by UAA-dependent or independent CPE
formation.
Fig. S5. Systematic exploration of the effect of the amber codon introduction on
PTC virus production at different test sites located in variable, average or
conserved domains, based on ConSurf analysis (23). The relative efficiency
represented a normalization of the days required for formation of ~100% CPE at each
test site to that of the wild-type WSN virus. * Indicates that the strains lost their
dependency on UAA after multiple passaging.
Fig. S6. Multicycle growth kinetics of different PTC viruses. Transgenic cells,
HEK293T-tRNA/pylRS/GFP39TAG, or conventional 293T cells were infected at an MOI
of 0.001. After 1 h of virus adsorption at 37℃, cells were washed and overlaid with
DMEM supplemented with 1% FBS, 2 µg/ml TPCK-treated trypsin, and 1 mM NAEK.
At the indicated times post-infection (1, 2, 3, 4, 5, 6, and 7 day), the cell supernatants
were collected and viral titers were determined by plaque formation assay.
Fig. S7. Schematic view of the influenza A virion structure. Influenza virions are
usually close to spherical, with diameters ranging from 100 – 200 nm. The outer lipid
layer of influenza viruses originates from the plasma membranes of the host in which
the virus was propagated (38). Outside of the lipid envelope, there are approximately
500 projections/virions in the form of spikes. Approximately 80% of these projections
resemble rods which are composed of hemagglutinin (HA). The remaining projections
are in the shape of mushrooms, and they are built from molecules of neuraminidase
(NA). The viral outer membrane also contains some copies of the small M2 protein that
form ion channels in the virion particles. The matrix protein M1, which is the most
abundant protein in virions, underlies the lipid layer and plays an important role in the
attachment of the ribonucleoprotein (RNP). The RNP core is a complex structure
composed mostly of the nucleoprotein NP, which wraps eight different RNA segments
of the influenza A genome. Additionally, RNPs contain approximately 50 copies per
virion of RNA-dependent RNA polymerase, which in case of influenza A virus is a
complex of three proteins: PB1, PB2 and PA (39,40).
The HA protein is critical for both binding to cellular receptors and fusion of the
viral and endosomal membranes. The viral M2 ion channel can be activated by the low
pH inside the endosomes to transport proton ions from the endosome into the virion,
resulting in a decrease in pH within the virus particle. As a result, the vRNPs become
dissociated from the M1 matrix protein (a process called uncoating) before they are
imported into the nucleus. Replication and transcription of viral RNAs (vRNAs) are
carried out by the three polymerase subunits PB2, PB1, and PA, as well as the
nucleoprotein NP. Newly synthesized viral ribonucleoprotein (vRNP) complexes are
exported from the nucleus to the cytoplasm by the nuclear export protein (NEP,
formerly called NS2) and the matrix protein M1, and are assembled into virions at the
plasma membrane. The NA protein facilitates virus release from infected cells by
removing sialic acids from cellular and viral HA and NA proteins (41). The NS1 protein
can facilitate viral replication as an interferon antagonist that blocks the activation of
transcription factors and IFN-β-stimulated gene products, and binds to double-stranded
RNA (dsRNA) to prevent the dsRNA-dependent activation of 2′-5′ oligo(A) synthetase
(OAS) and the subsequent activation of RNase L, a key player in the innate immune
response.
Fig. S8. (A) Verification of the genetic stability, as reflected by UAA-dependent CPE
formation, of the progeny PTC viruses, PCT-4A and PCT-4B after 1, 10 and 20 passages
in the transgenic HEK293T-tRNA/pylRS/GFP39TAG cells. Conventional HEK293T
cells infected by the 1st passage of viruses acted as a control. (B) Verification of genetic
stability by sequencing of PTC-4A and PTC-4B, after 1 and 20 passages in the
transgenic cells.
Fig. S9. Characterizations of in vivo safety of the PTC viruses. (A) The dose-
dependent death rate curves of mice upon infection of the wild-type WSN virus and
PTC viruses, PTC-4A and PTC-4B, for determination of their LD50. (B) Respiratory
droplet transmission of wild-type viruses, PTC-4A viruses, and CAIV between guinea
pigs (n = 5), as reflected by the viral titers in nasal washes. Data plotted for individual
mice and overlaid with mean ± SD. The dashed black line indicates the lower limit of
detection. (C) The effect of virus infection via intranasal administration on ferrets (n =
5) in terms of body weight at different dosages. (D) Detection of the viral titers in
different organs of ferrets and guinea pigs (n = 5) 3 days after infection with 107 PFU
of wild-type viruses, CAIV, or PTC-4A. ★, P < 0.05; ★★, P < 0.01; ★★★, P < 0.001.
Fig. S10. Vaccination with VSV could not protect BALB/c mice from challenge
with wild-type influenza viruses. Three weeks after inoculation with two doses of
VSVpp (20 µg P24/dose), we challenged the mice intranasally with 5 × 105 PFU of
wild-type influenza viruses. Detection of viral titers in lung 3 days post-infection
showed that the viral titers were almost equal to those in the vehicle group. All mice
from both vaccinated and unvaccinated groups experienced up to 25% body weight loss,
and died 9 days post-challenge. These results indicated that the protection observed in
our PTC virus vaccination experiments was primarily due to adaptive immunity rather
than lingering nonspecific inflammatory responses.
Fig S11. Characterizations of the protective efficacy and immunogenicity of the
PTC-4A in ferrets. (A) Antibody responses induced by PTC-4A, IIV, and CAIV in
ferrets. Ferrets were inoculated with one or two doses, with a 3-week interval, of 107
PFU of the PTC-4A, IIV, CAIV, or PBS. Three weeks after dose 1 or dose 2, sera were
collected to determine HI, NT, and NP-specific IgG antibody titers using the
homologous wild-type viruses (n = 5). Three weeks after dose 2, lungs were collected
to determine virus-specific IgA antibody titers (n = 3). (B) Protective efficacy of PTC-
4A. Ferrets were challenged with 106 PFU of wild-type viruses three weeks after being
inoculated with two doses of PTC-4A, IIV, CAIV, or PBS. Body weight changes were
observed for 14 days (n = 4). (C) Organs were collected for titration on day 4 post-
challenge (n = 3). ★, P < 0.05; ★★, P < 0.01; ★★★, P < 0.001.
Fig S12. Characterizations of the protective efficacy and immunogenicity of PTC-
4A in guinea pigs. (A) Antibody responses induced by PTC-4A, IIV, and CAIV in
guinea pigs. Guinea pigs were inoculated with one or two doses, at a 3-week interval,
of 107 PFU of PTC-4A, IIV, CAIV, or PBS. Three weeks after dose 1 or dose 2, sera
were collected to determine HI and NT antibody titers using the homologous wild-type
viruses (n = 5). (B) Protective efficacy of PTC-4A. Guinea pigs were challenged with
106 PFU wild-type viruses three weeks after being inoculated with two doses of PTC-
4A, IIV, CAIV, or PBS. Organs were collected for titration on day 4 post-challenge (n
= 5). (C) Respiratory droplet transmission of wild-type viruses. Groups of five guinea
pigs were inoculated with 107 PFU of PTC-4A or with PBS as a control. Three weeks
later, five animals from each group were put into the same cage that hosted five guinea
pigs inoculated with 107 PFU of wild-type viruses 24 h before. Nasal washes were
collected from all animals at 2-day intervals, beginning on day 0 post-contact and
continuing for 7 days, and then titrated by plaque formation assay. The dashed black
line indicates the lower limit of detection. ★, P < 0.05; ★★, P < 0.01; ★★★, P < 0.001.
Fig S13. Evaluation of the cross-reactive protection against A/reassortant/NYMC X-
179A (pH1N1) and A/Aichi/2/68 (H3N2) in terms of survival rates, body weight, and
virus titers after intranasally inoculation with one or two doses of PTC-4A. ★, P < 0.05;
★★, P < 0.01; ★★★, P < 0.001.
(D)
Fig S14. Reassortment between PTC and wild-type viruses reduced the infection
of wild-type viruses in vitro and in vivo. (A) and (B) Reassortment between PTC and
wild-type viruses reduced the titers of wild-type progeny viruses. MDCK cells were
infected with a mixture of wild-type virus (MOI=0.01 or 0.1) and PTC viruses (MOI=1).
The cell supernatants were collected at 12-hour intervals, beginning at 24 h post-
infection and continuing for 72 hours, and then titrated by plaque formation assay in
conventional or transgenic cells in the absence of UAA. The inhibitory effect of PTC
viruses on plaque titers of wild-type progeny viruses was dependent on the number of
stop codons; increasing the number of stop codons could increase the inhibitory effect.
IIV and CAIV were used as controls. (C) PTC virus-mediated attenuation of the
virulence of infectious viruses was confirmed in mouse models based on observations
of survival rates, changes in body weight, and viral titration (D) Generation of
reassortants of PTC-4A with wild-type viruses in BALB/c mice was verified by
sequencing. The codon in the dotted box is the amber codon TAG. ★, P < 0.05; ★★, P <
0.01; ★★★, P < 0.001.
Fig. S15. No acute toxicity of NAEK on BALB/c mice, upon consumption of a dose of
130 mg/kg/day (equal to 100 mM × 100 µl in vitro), was observed, according to both
survival rate and body weight, in a 2-week follow-up study (A). Furthermore,
immunohistochemical staining of mice organs indicated no toxic side effects (B).
Table S1. Summary of escape frequencies for PTC influenza viruses.
Name Protein(s) TAG
location(s)
Relative
packaging
efficiency (%)
Escape frequency
(Passage 1)
Escape frequency
(Passage 20)
NP-D101 NP D101 80 ± 3 2.00E-09 ± 1.20E-09 8.00E-09 ± 7.10E-09
NP-G102 NP G102 50 ± 5 8.90E-08 ± 5.89E-09 4.10E-07 ± 9.40E-08
NP-G126 NP G126 40 ± 5 3.21E-08 ± 6.50E-09 1.10E-07 ± 5.20E-08
NP-D128 NP D128 33 ± 4 4.16E-07 ± 2.13E-07 5.90E-07 ± 7.26E-08
NP-R150 NP R150 31 ± 4 data not collected data not collected
NP-M163 NP M163 67 ± 5 7.00E-10 ± 1.02E-10 2.00E-9 ± 8.90E-10
NP-G169 NP G169 25 ± 3 data not collected data not collected
PB1-K11 PB1 K11 25 ± 2 data not collected data not collected
PB1-Y30 PB1 Y30 25 ± 2 data not collected data not collected
PB1-R52 PB1 R52 67 ± 3 7.10E-07 ± 1.10E-07 1.21E-06 ± 4.42E-07
PB1-G65 PB1 G65 31 ± 5 data not collected data not collected
PB1-T105 PB1 T105 57 ± 5 6.24E-06 ± 3.12E-06 7.35E-05 ± 3.62E-05
PB1-R126 PB1 R126 25 ± 3 data not collected data not collected
PB1-M227 PB1 M227 31 ± 5 data not collected data not collected
PB1-K229 PB1 K229 25 ± 1 data not collected data not collected
PB1-D230 PB1 D230 25 ± 2 data not collected data not collected
PB1-S375 PB1 S375 57 ± 5 3.20E-07 ± 1.06E-07 5.10E-07 ± 4.25E-07
PB1-K736 PB1 K736 29 ± 4 data not collected data not collected
NA-N2 NA N2 33 ± 3 data not collected data not collected
NA-K6 NA K6 24 ± 2 data not collected data not collected
NA-I7 NA I7 25 ± 1 data not collected data not collected
NA-I8 NA I8 33 ± 3 data not collected data not collected
NA-G11 NA G11 36 ± 5 data not collected data not collected
NA-V16 NA V16 31 ± 2 data not collected data not collected
NA-N28 NA N28 50 ± 4 9.30E-05 ± 8.56E-06 1.21E-03 ± 2.12E-04
NA-I29 NA I29 40 ± 4 3.10E-06 ± 5.34E-07 6.10E-06 ± 1.11E-06
NA-C76 NA C76 25 ± 3 data not collected data not collected
NA-K244 NA K244 36 ± 2 data not collected data not collected
HA-K57 HA K57 57 ± 5 6.20E-04 ± 1.30E-05 1.80E-01 ± 1.50E-02
HA-G317 HA G317 25 ± 1 data not collected data not collected
HA-C319 HA C319 25 ± 3 data not collected data not collected
HA-G333 HA G333 25 ± 2 data not collected data not collected
HA-N336 HA N336 25 ± 3 data not collected data not collected
PB2-Q13 PB2 Q13 67 ± 5 5.80E-04 ± 2.20E-05 8.90E-01 ± 8.90E-02
PB2-T24 PB2 T24 50 ± 4 6.00E-06 ± 6.12E-07 1.30E-05 ± 1.10E-06
PB2-K33 PB2 K33 67 ± 5 3.00E-09 ± 1.12E-09 7.00E-09 ± 3.28E-09
PB2-T35 PB2 T35 67 ± 5 3.50E-04 ± 3.08E-04 9.20E-01 ± 4.25E-02
PB2-S320 PB2 S320 36 ± 3 data not collected data not collected
Name Protein(s) TAG
location(s)
Relat ive
packaging
efficiency (%)
Escape frequency
(Passage 1)
Escape frequency
(Passage 20)
NS-M1 NS M1 25 ± 1 data not collected data not collected
NS-D2 NS D2 25 ± 2 data not collected data not collected
NS-N4 NS N4 25 ± 1 data not collected data not collected
NS-V6 NS V6 25 ± 2 data not collected data not collected
NS-S7 NS S7 25 ± 1 data not collected data not collected
NS-S8 NS S8 33 ± 1 8.70E-07 ± 4.50E-07 5.10E-05 ± 8.55E-06
NS-R37 NS R37 67 ± 3 6.10E-07 ± 7.31E-08 1.20E-06 ± 1.17E-06
NS-K41 NS K41 67 ± 5 1.20E-06 ± 8.22E-07 7.20E-05 ± 3.96E-05
NS-L43 NS L43 67 ± 4 6.50E-07 ± 3.27E-07 2.13E-06 ± 7.24E-07
NS-S83 NS S83 100 ± 2 8.90E-06 ± 6.60E-07 6.89E-03 ± 1.27E-03
NS-A86 NS A86 100 ± 3 3.00E-06 ± 6.15E-07 2.30E-04 ± 8.29E-05
NS-H101 NS H101 67 ± 5 4.50E-06 ± 7.30E-07 6.10E-06 ± 1.08E-06
NS-F103 NS F103 67 ± 5 8.90E-03 ± 1.12E-03 9.10E-01 ± 3.30E-02
NS-K110 NS K110 67 ± 5 2.10E-06 ± 2.13E-06 5.98E-05 ± 1.02E-05
NS-A122 NS A122 44 ± 4 2.10E-07 ± 1.13E-08 9.20E-06 ± 2.54E-06
NS-K126 NS K126 67 ± 6 6.79E-05 ± 1.27E-05 8.21E-04 ± 8.56E-05
NS-K131 NS K131 50 ± 2 5.60E-07 ± 3.55E-07 7.68E-06 ± 6.05E-07
NS-A132 NS A132 25 ± 1 data not collected data not collected
PA-R266 PA R266 80 ± 6 1.00E-08 ± 1.10E-08 6.80E-08 ± 1.80E-08
PA-L270 PA L270 80 ± 5 6.70E-07 ± 1.09E-07 3.90E-06 ± 5.13E-07
PA-D272 PA D272 80 ± 3 9.30E-06 ± 1.00E-06 5.91E-04 ± 2.25E-04
PA-K289 PA K289 25 ± 1 data not collected data not collected
PA-K318 PA K318 33 ± 2 data not collected data not collected
PA-K328 PA K328 67 ± 4 1.12E-06 ± 2.45E-07 2.10E-05 ± 6.20E-06
M2-S23 M2 S23 25 ± 2 data not collected data not collected
M2-D24 M2 D24 25 ± 1 data not collected data not collected
M2-H37 M2 H37 50 ± 4 8.00E-06 ± 7.75E-07 1.10E-05 ± 3.21E-06
M2-W41 M2 W41 25 ± 2 data not collected data not collected
M2-K49 M2 K49 57 ± 5 7.90E-03 ± 1.11E-03 7.50E-01 ± 2.25E-02
M2-K60 M2 K60 57 ± 6 5.70E-03 ± 3.29E-03 6.30E-01 ± 2.13E-01
PTC-1
(PA-R266) PA R266 80 ± 6 1.00E-08 ± 1.10E-08 6.80E-08 ± 1.80E-08
PTC-2 PA R266
67 ± 5 1.20E-10 ± 4.46E-11 3.10E-10 ± 6.45E-11 PB2 K33
PTC-3
PA R266
67 ± 6 <1.00E-11 <1.00E-11 PB2 K33
PB1 R52
Name Protein(s) TAG
location(s)
Relat ive
packaging
efficiency (%)
Escape frequency
(Passage 1)
Escape frequency
(Passage 20)
PTC-4A
PA R266
67 ± 5 <1.00E-11 <1.00E-11 PB2 K33
PB1 R52
NP D101
PTC-4B
PA R266
57 ± 6 <1.00E-11 <1.00E-11 PB2 K33
PB1 S375
NP M163
PTC-5
PA R266
50 ± 3 <1.00E-11 <1.00E-11
PB2 K33
PB1 R52
NP D101
NS K131
PTC-6
PA R266
50 ± 2 <1.00E-11 <1.00E-11
PB2 K33
PB1 R52
NP D101
NS K131
M2 H37
PTC-7
PA R266
50 ± 3 <1.00E-11 <1.00E-11
PB2 K33
PB1 R52
NP D101
NS K131
M2 H37
NA N28
PTC-8
PA R266
50 ± 2 <1.00E-11 <1.00E-11
PB2 K33
PB1 R52
NP D101
NS K131
M2 H37
NA N28
HA K57
The detection limit of the escape frequency in this study is 1.00E-11. The escape
frequency data of the PTC virus strains with low packaging efficiency was not collected.
The data are mean ± SD. The experiments were independently performed three times (N = 3).
Table S2. TAG codon mutations were confirmed by gene sequencing in escape
strains HA-K57, PB2-Q13, PB2-T35, NS-F103, M2-K49 and M2-K60.
Escape
mutant Gene segment
TAG codon mutated
to UAA is replaced by
HA-K57 E1 HA CAG Q
HA-K57 E2 HA CAG Q
HA-K57 E3 HA CAG Q
HA-K57 E4 HA GAG E
HA-K57 E5 HA GAA E
HA-K57 E6 HA CAA Q
PB2-Q13 E1 PB2 CAG Q
PB2-Q13 E2 PB2 CAG Q
PB2-Q13 E3 PB2 CAG Q
PB2-Q13 E4 PB2 CAG Q
PB2-Q13 E5 PB2 CAG Q
PB2-Q13 E6 PB2 CAG Q
PB2-T35 E1 PB2 CAG Q
PB2-T35 E2 PB2 CAG Q
PB2-T35 E3 PB2 CAG Q
PB2-T35 E4 PB2 CAG Q
PB2-T35 E5 PB2 CAG Q
PB2-T35 E6 PB2 CAG Q
NS-F103 E1 NS CAG Q
NS-F103 E2 NS CAG Q
NS-F103 E3 NS CAG Q
NS-F103 E4 NS CAG Q
NS-F103 E5 NS CAG Q
NS-F103 E6 NS CAG Q
M2-K49 E1 M2 TGG W
M2-K49 E2 M2 TGG W
M2-K49 E3 M2 TGG W
M2-K49 E4 M2 TGG W
M2-K49 E5 M2 TCG S
M2-K49 E6 M2 TCG S
M2-K60 E1 M2 AAA K
M2-K60 E2 M2 AAA K
M2-K60 E3 M2 AAA K
M2-K60 E4 M2 AAA K
M2-K60 E5 M2 AAG K
M2-K60 E6 M2 AAG K
Six escape mutants per virus strain were isolated from the virus pool through plaque
purification in the absence of UAA. An escape mutant was designated by a number
following the letter “E” (for example, E1).
References
1. F. Krammer, P. Palese, Advances in the development of influenza virus vaccines. Nat. Rev. Drug Discov. 14, 167–182 (2015). doi:10.1038/nrd4529
2. A. Marzi, P. Halfmann, L. Hill-Batorski, F. Feldmann, W. L. Shupert, G. Neumann, H. Feldmann, Y. Kawaoka, An Ebola whole-virus vaccine is protective in nonhuman primates. Science 348, 439–442 (2015). doi:10.1126/science.aaa4919
3. J. B. Ulmer, U. Valley, R. Rappuoli, Vaccine manufacturing: Challenges and solutions. Nat. Biotechnol. 24, 1377–1383 (2006). doi:10.1038/nbt1261
4. S. A. Plotkin, Vaccines: Past, present and future. Nat. Med. 11, S5–S11 (2005). doi:10.1038/nm1209
5. Y. H. Jang, B. L. Seong, Principles underlying rational design of live attenuated influenza vaccines. Clin. Exp. Vaccine Res. 1, 35–49 (2012). doi:10.7774/cevr.2012.1.1.35
6. S. Tong, Y. Li, P. Rivailler, C. Conrardy, D. A. A. Castillo, L.-M. Chen, S. Recuenco, J. A. Ellison, C. T. Davis, I. A. York, A. S. Turmelle, D. Moran, S. Rogers, M. Shi, Y. Tao, M. R. Weil, K. Tang, L. A. Rowe, S. Sammons, X. Xu, M. Frace, K. A. Lindblade, N. J. Cox, L. J. Anderson, C. E. Rupprecht, R. O. Donis, A distinct lineage of influenza A virus from bats. Proc. Natl. Acad. Sci. U.S.A. 109, 4269–4274 (2012). doi:10.1073/pnas.1116200109
7. L. Wang, A. Brock, B. Herberich, P. G. Schultz, Expanding the genetic code of Escherichia coli. Science 292, 498–500 (2001). doi:10.1126/science.1060077
8. J. W. Chin et al., An expanded eukaryotic genetic code. Science 301, 964–967 (2003). doi:10.1126/science.1084772
9. A. J. Rovner, A. D. Haimovich, S. R. Katz, Z. Li, M. W. Grome, B. M. Gassaway, M. Amiram, J. R. Patel, R. R. Gallagher, J. Rinehart, F. J. Isaacs, Recoded organisms engineered to depend on synthetic amino acids. Nature 518, 89–93 (2015). doi:10.1038/nature14095
10. S. B. Sun, P. G. Schultz, C. H. Kim, Therapeutic applications of an expanded genetic code. ChemBioChem 15, 1721–1729 (2014). doi:10.1002/cbic.201402154
11. Y. Zheng, F. Yu, Y. Wu, L. Si, H. Xu, C. Zhang, Q. Xia, S. Xiao, Q. Wang, Q. He, P. Chen, J. Wang, K. Taira, L. Zhang, D. Zhou, Broadening the versatility of lentiviral vectors as a tool in nucleic acid research via genetic code expansion. Nucleic Acids Res. 43, e73 (2015). doi:10.1093/nar/gkv202
12. N. Wang, Y. Li, W. Niu, M. Sun, R. Cerny, Q. Li, J. Guo, Construction of a live-attenuated HIV-1 vaccine through genetic code expansion. Angew. Chem. Int. Ed. 53, 4867–4871 (2014). doi:10.1002/anie.201402092
13. C. Zhang, T. Yao, Y. Zheng, Z. Li, Q. Zhang, L. Zhang, D. Zhou, Development of next generation adeno-associated viral vectors capable of selective tropism and efficient gene delivery. Biomaterials 80, 134–145 (2016). doi:10.1016/j.biomaterials.2015.11.066
14. X. Jin, T. Sun, C. Zhao, Y. Zheng, Y. Zhang, W. Cai, Q. He, K. Taira, L. Zhang, D. Zhou, Strand antagonism in RNAi: An explanation of differences in potency between intracellularly expressed siRNA and shRNA. Nucleic Acids Res. 40, 1797–1806 (2012). doi:10.1093/nar/gkr927
15. J. Hsieh, A. Fire, Recognition and silencing of repeated DNA. Annu. Rev. Genet. 34, 187–204 (2000). doi:10.1146/annurev.genet.34.1.187
16. W. Wang, J. K. Takimoto, G. V. Louie, T. J. Baiga, J. P. Noel, K.-F. Lee, P. A. Slesinger, L. Wang, Genetically encoding unnatural amino acids for cellular and neuronal studies. Nat. Neurosci. 10, 1063–1072 (2007). doi:10.1038/nn1932
17. G. Neumann, T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, Y. Kawaoka, Generation of influenza A viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. U.S.A. 96, 9345–9350 (1999). doi:10.1073/pnas.96.16.9345
18. M. Yu, L. Si, Y. Wang, Y. Wu, F. Yu, P. Jiao, Y. Shi, H. Wang, S. Xiao, G. Fu, K. Tian, Y. Wang, Z. Guo, X. Ye, L. Zhang, D. Zhou, Discovery of pentacyclic triterpenoids as potential entry inhibitors of influenza viruses. J. Med. Chem. 57, 10058–10071 (2014). doi:10.1021/jm5014067
19. S. Xiao, L. Si, Z. Tian, P. Jiao, Z. Fan, K. Meng, X. Zhou, H. Wang, R. Xu, X. Han, G. Fu, Y. Zhang, L. Zhang, D. Zhou, Pentacyclic triterpenes grafted on CD cores to interfere with influenza virus entry: A dramatic multivalent effect. Biomaterials 78, 74–85 (2016). doi:10.1016/j.biomaterials.2015.11.034
20. E. J. Jung, K. H. Lee, B. L. Seong, Reverse genetic platform for inactivated and live-attenuated influenza vaccine. Exp. Mol. Med. 42, 116–121 (2010). doi:10.3858/emm.2010.42.2.013
21. J. R. Coleman, D. Papamichail, S. Skiena, B. Futcher, E. Wimmer, S. Mueller, Virus attenuation by genome-scale changes in codon pair bias. Science 320, 1784–1787 (2008). doi:10.1126/science.1155761
22. A. Nogales, S. F. Baker, E. Ortiz-Riano, S. Dewhurst, D. J. Topham, L. Martinez-Sobrido, Influenza A virus attenuation by codon deoptimization of the NS gene for vaccine development. J. Virol. 88, 10525–10540 (2014). doi:10.1128/JVI.01565-14
23. H. Ashkenazy, E. Erez, E. Martz, T. Pupko, N. Ben-Tal, ConSurf 2010: Calculating evolutionary conservation in sequence and structure of proteins and nucleic acids. Nucleic Acids Res. 38, W529–W533 (2010). doi:10.1093/nar/gkq399
24. A. Impagliazzo, F. Milder, H. Kuipers, M. V. Wagner, X. Zhu, R. M. B. Hoffman, R. van Meersbergen, J. Huizingh, P. Wanningen, J. Verspuij, M. de Man, Z. Ding, A. Apetri, B. Kukrer, E. Sneekes-Vriese, D. Tomkiewicz, N. S. Laursen, P. S. Lee, A. Zakrzewska, L. Dekking, J. Tolboom, L. Tettero, S. van Meerten, W. Yu, W. Koudstaal, J. Goudsmit, A. B. Ward, W. Meijberg, I. A. Wilson, K. Rado evi, A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen. Science 349, 1301–1306 (2015). doi:10.1126/science.aac7263
25. D. R. Burton, P. Poignard, R. L. Stanfield, I. A. Wilson, Broadly neutralizing antibodies present new prospects to counter highly antigenically diverse viruses. Science 337, 183–186 (2012). doi:10.1126/science.1225416
26. Z. Staneková, E. Varečková, Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development. Virol. J. 7, 351 (2010). doi:10.1186/1743-422X-7-351
27. J. Cohen, Unfilled vials. Science 351, 16–19 (2016). doi:10.1126/science.351.6268.16
28. A. L. Hiti, D. P. Nayak, Complete nucleotide sequence of the neuraminidase gene of human influenza virus A/WSN/33. J. Virol. 41, 730–734 (1982).
29. D. Hobson, E. A. Gould, H. I. Flockton, M. G. Gregory, Laboratory differences between the WS strain of influenza A virus and its neurotropic variants. Br. J. Exp. Pathol. 49, 516–524 (1968).
30. S. Wilson, C. Andrews, P. Laidlaw, A virus obtained from influenza patients. Lancet 2, 66–68 (1933).
31. S. Cao, X. Liu, M. Yu, J. Li, X. Jia, Y. Bi, L. Sun, G. F. Gao, W. Liu, A nuclear export signal in the matrix protein of Influenza A virus is required for efficient virus replication. J. Virol. 86, 4883–4891 (2012). doi:10.1128/JVI.06586-11
32. H. Katsura, K. Iwatsuki-Horimoto, S. Fukuyama, S. Watanabe, S. Sakabe, Y. Hatta, S. Murakami, M. Shimojima, T. Horimoto, Y. Kawaoka, A replication-incompetent virus possessing an uncleavable hemagglutinin as an influenza vaccine. Vaccine 30, 6027–6033 (2012). doi:10.1016/j.vaccine.2012.07.059
33. H. Kong, Q. Zhang, C. Gu, J. Shi, G. Deng, S. Ma, J. Liu, P. Chen, Y. Guan, Y. Jiang, H. Chen, A live attenuated vaccine prevents replication and transmission of H7N9 virus in mammals. Sci. Rep. 5, 11233 (2015). doi:10.1038/srep11233
34. S. Niu, L. Si, D. Liu, A. Zhou, Z. Zhang, Z. Shao, S. Wang, L. Zhang, D. Zhou, W. Lin, Spiromastilactones: A new class of influenza virus inhibitors from deep-sea fungus. Eur. J. Med. Chem. 108, 229–244 (2016). doi:10.1016/j.ejmech.2015.09.037
35. B. Y. Chua, C. Y. Wong, E. J. Mifsud, K. M. Edenborough, T. Sekiya, A. C. L. Tan, F. Mercuri, S. Rockman, W. Chen, S. J. Turner, P. C. Doherty, A. Kelso, L. E. Brown, D. C. Jackson, Inactivated influenza vaccine that provides rapid, innate-immune-system-mediated protection and subsequent long-term adaptive immunity. MBio 6, e01024-15 (2015). doi:10.1128/mBio.01024-15
36. J. C. Pedersen, Hemagglutination-inhibition assay for influenza virus subtype identification and the detection and quantitation of serum antibodies to influenza virus. Methods Mol. Biol. 1161, 11–25 (2014). doi:10.1007/978-1-4939-0758-8_2
37. P. Kitikoon, A. L. Vincent, Microneutralization assay for swine influenza virus in swine serum. Methods Mol. Biol. 1161, 325–335 (2014). doi:10.1007/978-1-4939-0758-8_27
38. D. P. Nayak, R. A. Balogun, H. Yamada, Z. H. Zhou, S. Barman, Influenza virus morphogenesis and budding. Virus Res. 143, 147–161 (2009). doi:10.1016/j.virusres.2009.05.010
39. S. Boivin, S. Cusack, R. W. Ruigrok, D. J. Hart, Influenza A virus polymerase: Structural insights into replication and host adaptation mechanisms. J. Biol. Chem. 285, 28411–28417 (2010). doi:10.1074/jbc.R110.117531
40. T. Noda, H. Sagara, A. Yen, A. Takada, H. Kida, R. H. Cheng, Y. Kawaoka, Architecture of ribonucleoprotein complexes in influenza A virus particles. Nature 439, 490–492 (2006). doi:10.1038/nature04378
41. G. Neumann, T. Noda, Y. Kawaoka, Emergence and pandemic potential of swine-origin H1N1 influenza virus. Nature 459, 931–939 (2009). doi:10.1038/nature08157