www.sciencemag.org/content/354/6316/1170/suppl/DC1

Supplementary Materials for

Generation of influenza A viruses as live but replication-incompetent virus

vaccines

Longlong Si, Huan Xu, Xueying Zhou, Ziwei Zhang, Zhenyu Tian, Yan Wang, Yiming Wu, Bo Zhang, Zhenlan Niu, Chuanling Zhang, Ge Fu, Sulong Xiao, Qing Xia, Lihe Zhang,

Demin Zhou* *Corresponding author. Email: deminzhou@bjmu.edu.cn

Published 2 December 2016, Science 354, 1170 (2016)

DOI: 10.1126/science.aah5869

This PDF file includes: Materials and Methods

Figs. S1 to S15

Tables S1 and S2

References

Materials and Methods

Viruses and vaccines.

Influenza A/WSN/33 virus (H1N1) (WSN) was utilized as a study model. “WSN”

is the acronym for the influenza A/Wilson Smith/1933 (H1N1) Neurotropic variant,

which was deliberately selected by repeatedly passaging its parent virus, influenza

A/Wilson Smith/1933 (H1N1) virus (WS), in mouse brain (28,29). The WS virus was

isolated by Wilson Smith and his colleagues from human influenza by inoculating

ferrets in 1933 (30). The influenza A/reassortant/NYMC X-179A (pH1N1) and

influenza A/Aichi/2/68 (H3N2) viruses were kindly provided by Sinovac Biotech Ltd

(Beijing). Two marketed vaccines, an inactivated influenza vaccine (IIV) and a cold-

adapted live attenuated influenza vaccine (CAIV), which have been used clinically in

China and the USA, respectively, were provided by Sinovac Biotech Ltd (Beijing) and

BioVector NTCC Inc (China) and utilized as positive controls.

Plasmid construction.

The 12-plasmid influenza A/WSN/33 virus (H1N1) rescue system was kindly

provided by Professor George F. Gao and Professor Wenjun Liu from the Center for

Molecular Virology, CAS Key Laboratory of Pathogenic Microbiology and

Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China.

Mutant plasmids (pHH21-NP-TAG, pHH21-PB2-TAG, pHH21-PB1-TAG, pHH21-

PA-TAG, pHH21-M-TAG, pHH21-NS-TAG, pHH21-HA-TAG, and pHH21-NA-

TAG) containing amber codons within the open reading frame were obtained from the

wild-type plasmids (pHH21-NP, pHH21-PB2, pHH21-PB1, pHH21-PA, pHH21-M,

pHH21-NS, pHH21-HA, pHH21-NA) via site-directed mutagenesis (Agilent

Technologies) and confirmed by gene sequencing (BGI Beijing).

The methanosarcina barkeri MS pyrrolysyl tRNA synthetase/tRNACUA pair

(MbpylRS/tRNACUA) for site-specific incorporation of the unnatural amino acid (UAA)

Nε-2-azidoethyloxycarbonyl-L-lysine (NAEK) was developed in-house as previously

reported (12, 13). NAEK is nontoxic, as shown in Fig. S15.

The pSD31 lentiviral vector and helper plasmids (pRSV, pMD2G-VSVG and

pRRE) were preserved in our lab (14). The pSD31-IRES-hygro plasmid was obtained

by replacing the SV40 promoter and pac gene, which confers puromycin resistance, in

the pSD31 lentivirus plasmid with the IRES (internal ribosome entry site) gene and hph

gene, which confers hygromycin resistance. The pSD31-IRES-puro plasmid was

obtained in the same way. The PylRS gene driven by a nonregulated CMV promoter

was cloned into the pSD31-IRES-puro plasmid to obtain the pSD31-pylRS plasmid.

The GFP gene with an amber codon engineered at residue position 39 was expressed

under a CMV promoter and cloned into the pSD31-IRES-hygro plasmid to obtain the

pSD31-GFP39TAG plasmid. The bjmu vector backbone was constructed by inserting a

fragment containing a polyA signal, f1 origin and SV40 origin within the KpnI and

EcoRI sites of the PUC19 vector. To obtain the bjmu-12t-zeo vector, the Sh ble gene,

which was used to confer resistance to Zeocin™, and an SV40 polyA signal were

cloned in after the SV40 promoter of the bjmu vector, then 12 copies of tRNA CUAPyl

genes driven by human 7sk, human H1, human U6 and mouse U6 respectively were

digested with BamHI/BglII restriction enzymes and cloned into the BamHI site of the

bjmu vector. All plasmids were confirmed by gene sequencing (BGI Beijing).

All plasmids used for transfection were amplified using a Maxiprep kit (Promega),

according to the manufacturer’s instructions.

Establishment of the transgenic cell line HEK293T-tRNA/pylRS/GFP39TAG.

HEK293T cells were used for lentiviral vector packaging and transduction. The

cells were cultured in DMEM medium (Macgene, without sodium pyruvate),

supplemented with 10% FBS (PAA), and 1 mM nonessential amid acids (Gibco).

Subconfluent HEK293T cells in 6-well plates were co-transfected with 0.72 µg of

pSD31 transfer plasmid, 0.64 µg of pRSV, 0.32 µg of pMD2G-VSVG and 0.32 µg of

pRRE using the transfection reagent Megatran1.0 (Origene). Then, 6 h later, the

transfection medium was replaced by DMEM medium supplemented with 3% FBS and

1 mM nonessential amid acids. Next, the lentivirus-containing supernatant was

harvested at 48 h post-infection and filtered through a 0.45 µm filter. The resultant dual

lentiviruses pSD31-pylRS and pSD31-GFP39TAG were used to integrate pylRS and the

GFP39TAG gene into the genome of HEK293T cells. Experiments for stable lentiviral

transduction were carried out as follows: HEK293T cells were seeded in a 6-well plate

and transduced 24 h later with lentiviral filtrates in the presence of 8 µg/mL polybrene.

Then, selection was performed under the pressure of 600 ng/mL puromycin and 200

µg/ml hygromycin until parental cells completely died. The resultant stably transduced

HEK293T-pylRS/GFP39TAG cells were transfected with linearized bjmu-12t-zeo

plasmid DNA and cultured under the pressure of 200 µg/ml Zeocin until parental cells

completely died. In presence of UAA, the stably transfected cells, HEK293T-

tRNA/pylRS/GFP39TAG, were then sorted by fluorescence-activated cell sorting (FACS)

according to the GFP phenotype and verified by their dependence on UAA for GFP

expression.

Generation of wild-type influenza viruses and replication-incompetent

influenza viruses harboring amber codon(s) in their genome.

For generation of wild-type influenza viruses, 2×105 cells per well from the

HEK293T-tRNA/pylRS/GFP39TAG cell line were seeded into 6-well plates in DMEM

supplemented with 10% FBS 24 h before transfection. Then a mixture of 0.1 µg each

of the 12 plasmids in the virus rescue system was transfected into the cells using

Megatran 1.0 reagent (Origene) according to the manufacturer’s instructions. Six hours

later, the medium containing the mixture of plasmids and Megatran 1.0 reagent was

replaced with DMEM supplemented with 1% FBS and 2 µg/ml L-1-tosylamide-2-

phenylethyl chloromethyl ketone (TPCK)-treated trypsin. The cells were further

incubated at 37℃ in 5% CO2 until >90% cytopathic effect (CPE) was observed, and

the supernatant containing the generated virus was harvested and centrifuged at 1000 ×

g for 10 min to remove contaminating cells (17, 31).

To generate replication-incompetent influenza viruses harboring amber codon(s)

in their genome, an almost identical procedure was carried out, with the following

changed: The plasmid(s) expressing wild-type viral RNA was replaced by the

corresponding mutant plasmid(s), and the medium was further supplemented with 1

mM UAA, e.g., Nε-2-azidoethyloxycarbonyl-L-lysine (NAEK). To identify the UAA-

dependent viral strains, a parallel packaging experiment was conducted, in which the

medium was not supplemented with UAA.

Plaque formation assay.

MDCK cells or transgenic HEK293T-tRNA/pylRS/GFP39TAG cells were grown in

a 12-well cell culture plate to produce a confluent monolayer. After the cells were

washed with PBS, they were inoculated with influenza virus and incubated at 37℃for

1 h for viral absorption. Unabsorbed virus was removed by washing the cells with PBS,

and then 1 ml of DMEM supplemented with 2 µg/ml TPCK-treated trypsin, 10 mM

NAEK, and 1.5 % agarose was then added to each well. After incubation for 4-16 days

at 37℃ in 5 % CO2, the cells were fixed with 4 % paraformaldehyde, then stained with

crystal violet (Sigma-Aldrich). Visible plaques were counted, and the virus titers were

determined (31).

Virus growth curve analysis.

To determine in vitro virus growth rates, triplicate wells of confluent transgenic

cells, HEK293T-tRNA/pylRS/GFP39TAG, (6-well plate format, 106 cells/well) were

infected at an MOI of 0.001(21,22). After 1 h of virus adsorption at 37℃, cells were

washed and overlaid with DMEM supplemented with 1% FBS, 2 µg/ml TPCK-treated

trypsin, and 1 mM NAEK. At the indicated times post-infection (1, 2, 3, 4, 5, 6, and 7

day), the cell supernatants were collected and viral titers were determined by the plaque

formation assay as described above.

Genetic stability evaluation of replication-incompetent viruses.

HEK293T-tRNA/pylRS/GFP39TAG cells at 104 cells per well in 24-well plates were

infected with replication-incompetent influenza virus strains at an MOI of 0.01 in

DMEM supplemented with 1% FBS, 2 µg/ml TPCK-treated trypsin and 1 mM NAEK.

When >90% CPE was observed, the supernatants were collected and used for infection

in the next round of investigation. The procedure was repeated more than 20 times. A

parallel experiment, in which the medium was not supplemented with NAEK, was

conducted to detect the viral UAA-dependency. After each passage, total RNA was

isolated from cells using TRIzol (Invitrogen, Carlsbad, CA, USA). Next, the first strand

of cDNA was synthesized by using AMV reverse transcriptase (Promega) with a

random primer and an oligo (dT) primer, according to manufacturer’s specifications.

PCR was carried out using the Phusion Hot Start Flex 2 × Master Mix (BioLab) with

30 µl of a reaction mixture containing primers specific for different influenza

A/WSN/33 (H1N1) gene segments. The PCR conditions were 1 cycle at 98℃ for 2

min, followed by 30 cycles at 98℃ for 15 s, 55℃ for 30 sec, 72℃ (30sec/kb), and

finally 1 cycle at 72℃ for 5 min. The resulting PCR products were gene sequenced to

investigate whether any mutation occurred during viral passages.

Escape assay.

The escape frequencies of PTC virus strains were obtained by measuring the ratio

of escape mutant plaque formation units (PFU) to total PFU. Briefly, the collected PTC

virus supernatant was serial diluted, and equal volumes of the supernatant were used to

infect transgenic cells. After 1 h at 37 ℃, unabsorbed virus was removed by washing

the cells with PBS. To obtain the total PFU, the cells were overlaid with DMEM

supplemented with 2 µg/ml TPCK-treated trypsin, 1.5 % agarose, and 10 mM UAA. To

obtain the escape mutant PFU, the cells were overlaid with DMEM supplemented with

2 µg/ml TPCK-treated trypsin and 1.5 % agarose. After incubation for 4-16 days at 37℃

in 5 % CO2, visible plaques in absence or presence of UAA were counted, and the

escape frequencies were calculated as the total number of escape mutant PFU observed

per total PFU. When escape mutants were not detected if the total PFU reached 1011,

the escape frequency was described to be below the limit of detection. Reported escape

frequencies are the means of three technical replicates where error bars represent ± s.d.

Escape mutant identity.

Six escape mutants per virus strain (HA-K57, PB2-Q13, PB2-T35, NS-F103, M2-

K49, and M2-K60) were isolated from the virus pools through plaque purification in

the absence of UAA. An escape mutant was designated by a number following the letter

‘E’ (for example, E1). The purified escape mutants were cultured in conventional 293T

cells, total RNA was isolated from cells using TRIzol. Then the first strand of cDNA

was synthesized using AMV reverse transcriptase (Promega, Madison, WI, USA) with

a random primer and an oligo (dT) primer, according to manufacturer’s specifications.

PCR was carried out using the Phusion Hot Start Flex 2 × Master Mix (New England

BioLab, UK) with 30 µl of a reaction mixture containing primers specific for different

influenza A/WSN/33 (H1N1) gene segments. The PCR conditions were 1 cycle at 98℃

for 2 min, followed by 30 cycles at 98℃ for 15 s, 55℃ for 30 sec, 72℃ (30sec/kb),

and finally 1 cycle at 72℃ for 5min. The resulting PCR products were gene sequenced

to investigate whether any mutation occurred in escape mutants.

Purification and morphological observation of wild-type and replication-

incompetent influenza virus particles.

Wild-type and replication-incompetent influenza viruses were prepared as

described above. The supernatant was harvested and clarified (1000 × g, 15 min, 4℃).

The clarified supernatant was concentrated by ultracentrifugation (105 × g, 2 h, 4℃, in

a Ti40 rotor). Then, the precipitated virus was resuspended in 0.5 ml of NTE buffer

(100 mM NaCl, 10 mM Tris-Cl (pH 7.4), 1 mM EDTA) and purified over a 20-60%

sucrose gradient (105 × g, 2 h, 4℃, in a SW40 rotor). The banded viruses were collected,

diluted with NTE buffer, pelleted (105 × g, 2 h, 4℃, in a SW40 rotor), and resuspended

in approximately 1 ml of PBS. The purified viruses were either used immediately or

flash frozen in aliquots and stored at -80℃ until use. The morphology of viruses was

observed under transmission electron microscope (TEM) by negative straining (18).

Preparation of formalin-inactivated virus.

The IIV was manufactured according to the Chinese Pharmacopoeia’s instructions

and provided by Sinovac Biotech Ltd (Beijing). Briefly, the influenza virus was

generated using plasmid-based reverse genetics as described above. The culture

supernatant containing the virus was treated with 0.1% formalin (final concentration)

(Sigma-Aldrich) at 4℃ for a week to inactivate infectivity (32). Inactivation of the

virus was confirmed by the absence of detectable infectious virus following inoculation

of formalin-treated virus into MDCK cells. After confirmation of inactivation of

infectivity, formalin-treated virus was purified by sucrose-gradient ultracentrifugation

at 105 × g for 2 h at 4℃ and stored at -80℃ until use. An ELISA assay was employed

to quantify the concentrations of HA antigen in the IIV and PTC virus vaccine. To

directly compare the immunogenicity and protective efficacy between does of PTC

virus and inactivated vaccine, the amount of HA antigen in inactivated vaccine used in

animal experiments was equal to that in the PTC virus vaccine.

Mouse studies.

Six-week-old female specific-pathogen-free BALB/c mice were used in this study.

First, wild-type A/WSN/33 (H1N1), PTC-4A, inactivated influenza A/WSN/33 (H1N1)

virus vaccine (IIV), and cold-adapted live attenuated influenza vaccine (CAIV) were

tested for their replicative capacity. Groups of fifteen mice were anesthetized with

pentobarbital sodium before being inoculated intranasally with either 50 µl of 105 PFU

of wild-type A/WSN/33 (H1N1), 105 PFU of IIV, 105 PFU of CAIV, 105, 107, or 109

PFU of PTC-4A, which were 10-fold, 103-fold, and 105-fold equivalent to the LD50 of

the wild-type A/WSN/33 (H1N1), respectively, or with PBS as a control. Five mice

from each group were sacrificed on day 3 post-inoculation (p.i.), and their organs were

harvested, homogenized, and titered by plaque formation assay. The remaining ten mice

were observed daily for body weight changes and death for 2 weeks (33). All animal

experiments were performed in accordance with the guidelines of the Institutional

Animal Care and Use Committee of the Peking University.

For immunogenicity and vaccine studies, groups of twenty mice were anesthetized

with pentobarbital sodium and intranasally inoculated with 106 PFU of either PTC-4A

or CAIV in 50 µl once or twice (three weeks apart), or with PBS as a control. In the IIV

groups, twenty mice were intramuscularly inoculated with the same dosage of IIV once

or twice (three weeks apart). Sera were collected from five animals in each group 3

weeks after each vaccination for hemagglutination inhibition (HI) assays, neutralization

(NT) antibody detection, and immunoglobulin G (IgG) antibody detection. Three weeks

after the second vaccination, lung tissue samples were harvested from five mice in each

group, suspended in 200 µl PBS, and kept at -80℃ until used for immunoglobulin A

(IgA) and virus-specific CD8+ T cell detection. Three weeks after vaccination, groups

of fifteen mice were intranasally challenged with 5 × 105 PFU of homologous wild-type

viruses. Five mice from each group were sacrificed on day 3 post-challenge (p.c.), and

their lung organs were collected for virus titration. The remaining ten mice were

observed for body weight changes and death for 2 weeks (33).

To evaluate the cross-reactive immunity of PTC-4A against

heterologous/heterosubtypic influenza viruses, groups of fifteen mice were

anesthetized with pentobarbital sodium and intranasally inoculated with 106 PFU of

either PTC-4A in 50 µl once or twice (three weeks apart), or with PBS as a control.

Three weeks after the second vaccination, the mice were challenged with either 50 µl

of 106 PFU of heterologous influenza A/reassortant/NYMC X-179A (pH1N1) or

heterosubtypic A/Aichi/2/68 (H3N2) viruses, which were kindly provided by Sinovac

Biotech Ltd (Beijing). Five mice from each group were sacrificed on day 3 post-

challenge (p.c.), and their organs were collected for virus titration. The remaining ten

mice were observed for body weight changes and death for 2 weeks (33).

Ferret studies.

Four-month-old female ferrets (Wuxi Cay Ferret Farm, Jiangsu, China) that were

sero-negative were used in this study. To evaluate the replication ability of wild-type

A/WSN/33 (H1N1), PTC-4A, IIV, and CAIV in this animal model, groups of ten ferrets

were inoculated with either 106 PFU of wild-type A/WSN/33 (H1N1), 106 PFU of IIV,

106 PFU of CAIV, 106, 107, and 109 PFU of PTC-4A, or with PBS as a control. Each

ferret was inoculated with test virus in a volume of 500 µl (250 µl per nostril). Five

ferrets from each group were sacrificed on day 3 post-inoculation (p.i.), and their organs

were harvested, homogenized, and titered by plaque formation assay. The remaining

five ferrets were observed daily for body weight changes and death for 2 weeks (33).

To evaluate the protective efficacy of PTC-4A, groups of ten 4-month-old female

ferrets were intranasally inoculated once or twice with 107 PFU of PTC-4A or CAIV in

500 µl (250 µl per nostril) (three weeks apart) or with PBS as a control. In the IIV group,

ten ferrets were intramuscularly inoculated with the same dosage of IIV once or twice

(three weeks apart). Sera were collected from five animals in each group 3 weeks after

each vaccination for hemagglutination inhibition (HI) assays, neutralization (NT)

antibody detection, and immunoglobulin G (IgG) antibody detection. Three weeks after

the second vaccination, lung tissue samples were harvested from three ferrets in each

group for immunoglobulin A (IgA) detection. The remaining seven ferrets were

intranasally challenged with 106 PFU of homologous wild-type viruses. Three ferrets

from each group were sacrificed on day 3 post-challenge (p.c.), and their organs were

collected for virus titration. The remaining four ferrets were observed for body weight

changes and death for 2 weeks (33).

Guinea pig studies.

Female guinea pigs (VITAL RIVER) weighing 250-280 g were used in this study.

To evaluate the replication ability of wild-type A/WSN/33 (H1N1), PTC-4A, IIV, and

CAIV in this animal model, groups of ten guinea pigs were inoculated with 106 PFU of

either wild-type A/WSN/33 (H1N1), IIV, CAIV, PTC-4A, or with PBS as a control.

Each guinea pig was inoculated with test virus in a volume of 300 µl (150 µl per nostril).

Five guinea pigs from each group were sacrificed on day 3 post-inoculation (p.i.), and

their organs were harvested, homogenized, and titered by plaque formation assay. The

remaining five guinea pigs were observed daily for body weight changes and death for

2 weeks (33).

To evaluate whether a natural route of transmission could occur between PTC

virus-inoculated and non-inoculated animals, five guinea pigs from the vehicle group

were put into the same cage that hosted five guinea pigs that had been inoculated with

106 PFU of wild-type A/WSN/33 (H1N1) or PTC-4A 24 h before. Nasal washes were

collected from all animals at 2-day intervals, beginning on day 0 post-contact and

continuing for 7 days, and then titrated by plaque formation assay. The ambient

conditions for these studies were set at 20-22 ℃ and 30%-40% relative humidity.

To evaluate the protective efficacy of PTC-4A, groups of ten female guinea pigs

were intranasally inoculated twice with 107 PFU of PTC-4A or CAIV in 300 µl (150 µl

per nostril) (three weeks apart) or with PBS as a control. In the IIV group, ten guinea

pigs were intramuscularly inoculated with the same dosage of IIV twice (three weeks

apart). Sera were collected from five animals in each group 3 weeks after each

vaccination for hemagglutination inhibition (HI) assays and neutralization (NT)

antibody detection. Three weeks after the second vaccination, the guinea pigs were

intranasally challenged with 106 PFU of homologous wild-type viruses. Five guinea

pigs from each group were sacrificed on day 3 post-challenge (p.c.), and their organs

were collected for virus titration. The remaining five guinea pigs were observed for

body weight changes and death for 2 weeks (33).

To evaluate whether a single dose of the PTC virus vaccine could prevent wild-

type influenza virus infection by a natural route of transmission, groups of five guinea

pigs were inoculated with either 107 PFU of PTC-4A in a volume of 300 µl (150 µl per

nostril) or with PBS as a control. Three weeks later, five animals from each group were

put into the same cage that hosted five guinea pigs that had been inoculated with 107

PFU of wild-type viruses 24 h before. Nasal washes were collected from all animals at

2-day intervals, beginning on day 0 post-contact and continuing for 7 days, and then

titrated by plaque formation assay. The ambient conditions for these studies were set at

20-22 ℃ and 30%-40% relative humidity.

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR).

To detect the influenza virus vRNA levels in different tissues of mice infected with

wild-type or PTC-4A viruses, total RNA was isolated from tissue cells using TRIzol

(Invitrogen, Carlsbad, CA, USA). The first strand of cDNA was then synthesized using

AMV reverse transcriptase (Promega), according to manufacturer’s specifications, with

strand- and sense-specific oligonucleotides for vRNA (5’ AGCGAAAGCAGG 3’ and

5’ AGCAAAAGCAGG 3’). The GAPDH gene with a specific primer (5’

GAAGATGGTGATGGGATTTC 3’) was included as an internal control in the reverse

transcription reaction mixture for vRNA analysis. Quantitative real-time PCR was

carried out according to the GoTaq qPCR Master Mix (Promega) with 20 μl of a

reaction mixture containing primers specific for influenza A/WSN/33 M1 segment

(forward: 5’GACCAATCCTGTCACCTC 3’ and reverse: 5’

GATCTCCGTTCCCATTAAGAG 3’) or for GAPDH RNA (forward: 5’

GAAGGTGAAGGTCGGAGTC 3’ and reverse: 5’ GAAGATGGTGATGGGATTTC

3’). The PCR conditions were 1 cycle at 95℃ for 5 min, followed by 40 cycles at 95℃

for 15 s, 60℃ for 1 min, and 1 cycle at 95℃ for 15 s, 60℃ for 15 s, 95℃ for 15 s.

The results were calculated using the 2-△△CT (two delta delta CT) method according to

the GoTaq qPCR Master Mix (Promega) manufacturer’s specifications (34).

Enzyme-linked immunosorbent assay (ELISA).

Immunoglobulin G (IgG) antibody in sera and IgA antibody in lung wash fluid

from the immunized animals was measured using an enzyme-linked immunosorbent

assay (ELISA) (38). In this assay, 96-well ELISA plates (Thermo Fisher Scientific Inc.,

USA) were coated with recombinant proteins (HA, NA and NP) from homologous wild-

type viruses (0.2 µg/ml) (Sino Biological Inc., Beijing, China) or purified wild-type

viruses in 100 mM bicarbonate/carbonate buffer at pH 9.5 (100 µl/well, overnight at

4℃). Before and after each step, wells were washed with PBS. Wells were blocked with

2% bovine serum albumin (BSA; Sigma) in PBS-0.05% Tween 20 (blocking buffer)

(150 µl/well, 1 h at 37℃). Serum samples for viral protein-specific IgG detection, or

lung wash fluids for virus-specific IgA detection, were diluted in blocking buffer and

added to wells (100 µl/well, 1 h at 37℃). After washing, plates were blocked again with

blocking buffer (150 µl/well, 1 h at 37℃) and then HRP-conjugated anti-mouse/ferret

IgG antibody or HRP-conjugated anti-mouse/ferret IgA antibody (Zhongshan Golden

Bridge Biotechnology Inc., Beijing, China) diluted 1:5000 in blocking buffer was added

(100 µl/well, 1h at 37℃). Plates were detected with 3,3’,5,5’-tetramethyl benzidine

(TMB) substrate (Millipore, Billerica, MA, USA) and stopped after 15 min with 0.5 M

H2SO4. Plates were read at 450 nm using a plate reader (Tecan Infinite M2000 PRO;

Tecan Group Ltd., Mannedorf, Switzerland).

Detection of virus-specific CD8+ T lymphocytes.

A tetramer assay was used to detect virus-specific CD8+ T lymphocytes (35).

Immunized mice were anesthetized, and their lungs were perfused through the heart

with a total of 20 ml of PBS with heparin. Then, the lungs were dissected and cut into

small pieces using a sterile scalpel. The pieces of lung tissue were incubated with

1mg/ml collagenase D (Roche) for 3 hours at 37℃. After incubation, lung homogenates

were forced through cell strainers (BD Biosciences) and washed 3 times with DMEM

supplemented with 2% FBS. Finally, lymphocytes were isolated using lympholyte

density gradients (Sanbio) according to the manufacturer’s protocol and washed with

FACS buffer (1% BSA, 5 mM EDTA in PBS). Cells were then stained with anti-mouse

CD8a-APC antibody (BD Bioscience) and Phycoerythrin (PE)-conjugated H-2Kd

tetramer specific to the NP epitope (amino acid positions 147-155, TYQRTRALV)

(MBL). Samples were analyzed with a FACSCalibur flow cytometer (BD Biosciences).

Reassortment of PTC virus with wild-type virus in vitro and in vivo.

In our in vitro assay, MDCK cells were infected with a mixture of wild-type virus

(MOI=0.01) and PTC virus (MOI=1 or 0.1). The cell supernatants were collected at 12-

h intervals, beginning at 24 h post-infection and continuing for 72 hours, and then

titrated by plaque formation assay. CAIV was used as a control.

For our in vivo assay, groups of fifteen BALB/c mice were intranasally inoculated

with 2 × 104 PFU of wild-type virus or a mixture of 2 × 104 PFU of wild-type virus and

2 × 106 PFU of PTC-4A, IIV or CAIV. It is important to note that simultaneous infection

is more or less artificial. In reality, individuals vaccinated with PTC virus vaccine would

more likely be infected with wild-type virus shortly before or after vaccination. To

mimic this theoretical situation, a group of fifteen mice was intranasally inoculated with

2 × 106 PFU of PTC-4A 24 h post-infection with 2 × 104 PFU of wild-type virus. Five

mice from each group were sacrificed on day 3 post-inoculation (p.i.), and their organs

were harvested, homogenized, and titered by plaque formation assay. The titers of wild-

type viruses were obtained by plaque formation in the absence of UAA. The reassortant

clones were isolated from the virus pools through plaque purification in the presence of

UAA. The remaining ten mice were observed daily for body weight changes and death

for 2 weeks (33). All animal experiments were performed in accordance with the

guidelines of the Institutional Animal Care and Use Committee of the Peking University.

Hemagglutination inhibition (HAI) assay.

Sera samples were tested for the titer of HAI antibodies by standard methods

using 4 HA units of wild-type virus in V-bottom 96-well microtiter plates with 0.5%

chicken red blood cells (cRBC) (36). Briefly, sera were pre-treated with receptor-

destroying enzyme (RDE) (1 volume sera: 3 volume RDE) from Vibrio cholerae at

37℃ for 16 h prior to heat to inactivation for 30 min at 56℃. Sera were two-fold

serially diluted starting at 1:10 in PBS in V-bottom well microtiter plates, and an equal

volume of eight agglutinating doses (AD) of virus antigen as determined by titration

against 0.5% chicken red blood cell suspension in PBS was added, and then incubated

at room temperature for 1 h. An equal volume of 0.5% (v/v) chicken red blood cells

in PBS were added. The mixture was incubated for 30 min at room temperature before

HI titers were read.

Microneutralization (MN) assay.

The MN assay was adapted from the method recommended by the World Health

Organization (37). MDCK cells were grown in DMEM supplemented with 10% FBS,

2 mM L-glutamine, 100 µg/ml streptomycin, and 100 U/ml penicillin at 37℃ with

5% CO2. Sera were treated with destroying enzyme (RDE) as described by Kitikoon,

P. and Vincent, A.L. and stored at -20℃ until processing (37). MDCK cells were

subcultured into 96-well plates 2 or 3 days prior to conducting the assay to ensure

confluent monolayers when starting the neutralization assay. Two-fold serial dilutions

of RDE-treated sera starting at 1:10 in infection medium were incubated with 100×50%

tissue culture infective doses (TCID50) of virus for 1 h at 37℃. The sera/virus mixture

was then added to MDCK cells in infection medium with 2 μg/ml TPCK-treated

trypsin. The cells were incubated for 3 to 5 days at 37℃ with 5% CO2, and observed

for the presence of cytopathic effect. Neutralizing titer was defined as the reciprocal

of the highest dilution of sera that completely neutralized infectivity of 100×TCID50

of wild-type virus for MDCK cells. Infectivity was identified by the presence of CPE.

Statistical analysis.

The one-way ANOVA with Newman-Keuls multiple comparisons test was used

to analyze differences in mean values between groups. Differences were considered

significant when the P value was less than 0.05. ★, P < 0.05; ★★, P < 0.01; ★★★, P <

0.001; n.s., not significant. All results are expressed as means ± SDs of the means.

Error bars indicated N > 2.

Fig. S1. Schematic representative of the generation of a transgenic cell line,

HEK293T-tRNA/pylRS/GFP39TAG, which is compatible with orthogonal

translation machinery for constitutive expression of amber codon-containing

genes with such an integrated GFP gene as a reporter. (A) The pSD31-derived

lentiviral vectors (pSD31-pylRS-IRES-puro and pSD31-GFP39TAG-IRES-hygro) and

PUC19-derived vector bjmu-12t-zeo used for sequential integration of a CMV

promoter-driven pylRS gene cassette, an amber codon-containing green fluorescent

protein (GFP) gene cassette (GFP39TAG), and a cassette harboring 12 tandem tRNA-

expression sequences driven separately by four different pol III promoters (human 7sk,

U6, H1, and mouse U6) into the host genome of HEK293T. (B) Schematic

representative of the sequential transduction and stable transfection of HEK-293T cells

for generation of transgenic HEK293T-tRNA/pylRS/GFP39TAG cells compatible with

orthogonal translation machinery; an amber codon-containing GFP gene acting as a

reporter.

Fig. S2. Multicycle growth curve of the strain NP-D101, CAIV, and wild-type

viruses. Transgenic cells, HEK293T-tRNA/pylRS/GFP39TAG, or conventional 293T

cells were infected at an MOI of 0.001. After 1 h of virus adsorption at 37℃, cells were

washed and overlaid with DMEM supplemented with 1% FBS, 2 µg/ml TPCK-treated

trypsin, and 1 mM NAEK. At the indicated times post-infection (1, 2, 3, 4, 5, 6, and 7

day), the cell supernatants were collected and viral titers were determined by plaque

formation assay.

(A)

NP

PB1

NA

HA

NS

PB2

PA

M2

M1

(B)

Fig. S3. An evolutionary conservation analysis of the influenza viral proteins

according to ConSurf calculation (23). (A) The constitutive amino acid residues in

eight viral proteins together with their conservation levels were graded by color. (B)

Either 22 or 8 amino acid residues selected for replacement by UAA were labeled

within the tertiary structure of each viral protein. NP, PDB: 2IQH; PB1, PDB: 4WSB;

NA, PDB: 3TI6; HA, PDB: 1RVT; NS, PDB: 4OPH; PB2, PDB: 4WSB; PA, PDB:

4IUJ; M2, PDB: 2RLF; M1, PDB: 4PUS.

NP

PB1

NA

HA

NS

PB2

PA

M2

M1

Fig. S4. (A) Characterizations of the effect, by CPE assay, on generation of progeny

viruses upon replacement of the selected codon in a viral genome by an amber codon.

Transgenic HEK293T-tRNA/pylRS/GFP39TAG cells were cultured in the presence or

absence of UAA. (B) Verification of the genetic stability of progeny PTC viruses after

20 passages in the transgenic cells, as reflected by UAA-dependent or independent CPE

formation.

Fig. S5. Systematic exploration of the effect of the amber codon introduction on

PTC virus production at different test sites located in variable, average or

conserved domains, based on ConSurf analysis (23). The relative efficiency

represented a normalization of the days required for formation of ~100% CPE at each

test site to that of the wild-type WSN virus. * Indicates that the strains lost their

dependency on UAA after multiple passaging.

Fig. S6. Multicycle growth kinetics of different PTC viruses. Transgenic cells,

HEK293T-tRNA/pylRS/GFP39TAG, or conventional 293T cells were infected at an MOI

of 0.001. After 1 h of virus adsorption at 37℃, cells were washed and overlaid with

DMEM supplemented with 1% FBS, 2 µg/ml TPCK-treated trypsin, and 1 mM NAEK.

At the indicated times post-infection (1, 2, 3, 4, 5, 6, and 7 day), the cell supernatants

were collected and viral titers were determined by plaque formation assay.

Fig. S7. Schematic view of the influenza A virion structure. Influenza virions are

usually close to spherical, with diameters ranging from 100 – 200 nm. The outer lipid

layer of influenza viruses originates from the plasma membranes of the host in which

the virus was propagated (38). Outside of the lipid envelope, there are approximately

500 projections/virions in the form of spikes. Approximately 80% of these projections

resemble rods which are composed of hemagglutinin (HA). The remaining projections

are in the shape of mushrooms, and they are built from molecules of neuraminidase

(NA). The viral outer membrane also contains some copies of the small M2 protein that

form ion channels in the virion particles. The matrix protein M1, which is the most

abundant protein in virions, underlies the lipid layer and plays an important role in the

attachment of the ribonucleoprotein (RNP). The RNP core is a complex structure

composed mostly of the nucleoprotein NP, which wraps eight different RNA segments

of the influenza A genome. Additionally, RNPs contain approximately 50 copies per

virion of RNA-dependent RNA polymerase, which in case of influenza A virus is a

complex of three proteins: PB1, PB2 and PA (39,40).

The HA protein is critical for both binding to cellular receptors and fusion of the

viral and endosomal membranes. The viral M2 ion channel can be activated by the low

pH inside the endosomes to transport proton ions from the endosome into the virion,

resulting in a decrease in pH within the virus particle. As a result, the vRNPs become

dissociated from the M1 matrix protein (a process called uncoating) before they are

imported into the nucleus. Replication and transcription of viral RNAs (vRNAs) are

carried out by the three polymerase subunits PB2, PB1, and PA, as well as the

nucleoprotein NP. Newly synthesized viral ribonucleoprotein (vRNP) complexes are

exported from the nucleus to the cytoplasm by the nuclear export protein (NEP,

formerly called NS2) and the matrix protein M1, and are assembled into virions at the

plasma membrane. The NA protein facilitates virus release from infected cells by

removing sialic acids from cellular and viral HA and NA proteins (41). The NS1 protein

can facilitate viral replication as an interferon antagonist that blocks the activation of

transcription factors and IFN-β-stimulated gene products, and binds to double-stranded

RNA (dsRNA) to prevent the dsRNA-dependent activation of 2′-5′ oligo(A) synthetase

(OAS) and the subsequent activation of RNase L, a key player in the innate immune

response.

Fig. S8. (A) Verification of the genetic stability, as reflected by UAA-dependent CPE

formation, of the progeny PTC viruses, PCT-4A and PCT-4B after 1, 10 and 20 passages

in the transgenic HEK293T-tRNA/pylRS/GFP39TAG cells. Conventional HEK293T

cells infected by the 1st passage of viruses acted as a control. (B) Verification of genetic

stability by sequencing of PTC-4A and PTC-4B, after 1 and 20 passages in the

transgenic cells.

Fig. S9. Characterizations of in vivo safety of the PTC viruses. (A) The dose-

dependent death rate curves of mice upon infection of the wild-type WSN virus and

PTC viruses, PTC-4A and PTC-4B, for determination of their LD50. (B) Respiratory

droplet transmission of wild-type viruses, PTC-4A viruses, and CAIV between guinea

pigs (n = 5), as reflected by the viral titers in nasal washes. Data plotted for individual

mice and overlaid with mean ± SD. The dashed black line indicates the lower limit of

detection. (C) The effect of virus infection via intranasal administration on ferrets (n =

5) in terms of body weight at different dosages. (D) Detection of the viral titers in

different organs of ferrets and guinea pigs (n = 5) 3 days after infection with 107 PFU

of wild-type viruses, CAIV, or PTC-4A. ★, P < 0.05; ★★, P < 0.01; ★★★, P < 0.001.

Fig. S10. Vaccination with VSV could not protect BALB/c mice from challenge

with wild-type influenza viruses. Three weeks after inoculation with two doses of

VSVpp (20 µg P24/dose), we challenged the mice intranasally with 5 × 105 PFU of

wild-type influenza viruses. Detection of viral titers in lung 3 days post-infection

showed that the viral titers were almost equal to those in the vehicle group. All mice

from both vaccinated and unvaccinated groups experienced up to 25% body weight loss,

and died 9 days post-challenge. These results indicated that the protection observed in

our PTC virus vaccination experiments was primarily due to adaptive immunity rather

than lingering nonspecific inflammatory responses.

Fig S11. Characterizations of the protective efficacy and immunogenicity of the

PTC-4A in ferrets. (A) Antibody responses induced by PTC-4A, IIV, and CAIV in

ferrets. Ferrets were inoculated with one or two doses, with a 3-week interval, of 107

PFU of the PTC-4A, IIV, CAIV, or PBS. Three weeks after dose 1 or dose 2, sera were

collected to determine HI, NT, and NP-specific IgG antibody titers using the

homologous wild-type viruses (n = 5). Three weeks after dose 2, lungs were collected

to determine virus-specific IgA antibody titers (n = 3). (B) Protective efficacy of PTC-

4A. Ferrets were challenged with 106 PFU of wild-type viruses three weeks after being

inoculated with two doses of PTC-4A, IIV, CAIV, or PBS. Body weight changes were

observed for 14 days (n = 4). (C) Organs were collected for titration on day 4 post-

challenge (n = 3). ★, P < 0.05; ★★, P < 0.01; ★★★, P < 0.001.

Fig S12. Characterizations of the protective efficacy and immunogenicity of PTC-

4A in guinea pigs. (A) Antibody responses induced by PTC-4A, IIV, and CAIV in

guinea pigs. Guinea pigs were inoculated with one or two doses, at a 3-week interval,

of 107 PFU of PTC-4A, IIV, CAIV, or PBS. Three weeks after dose 1 or dose 2, sera

were collected to determine HI and NT antibody titers using the homologous wild-type

viruses (n = 5). (B) Protective efficacy of PTC-4A. Guinea pigs were challenged with

106 PFU wild-type viruses three weeks after being inoculated with two doses of PTC-

4A, IIV, CAIV, or PBS. Organs were collected for titration on day 4 post-challenge (n

= 5). (C) Respiratory droplet transmission of wild-type viruses. Groups of five guinea

pigs were inoculated with 107 PFU of PTC-4A or with PBS as a control. Three weeks

later, five animals from each group were put into the same cage that hosted five guinea

pigs inoculated with 107 PFU of wild-type viruses 24 h before. Nasal washes were

collected from all animals at 2-day intervals, beginning on day 0 post-contact and

continuing for 7 days, and then titrated by plaque formation assay. The dashed black

line indicates the lower limit of detection. ★, P < 0.05; ★★, P < 0.01; ★★★, P < 0.001.

Fig S13. Evaluation of the cross-reactive protection against A/reassortant/NYMC X-

179A (pH1N1) and A/Aichi/2/68 (H3N2) in terms of survival rates, body weight, and

virus titers after intranasally inoculation with one or two doses of PTC-4A. ★, P < 0.05;

★★, P < 0.01; ★★★, P < 0.001.

(D)

Fig S14. Reassortment between PTC and wild-type viruses reduced the infection

of wild-type viruses in vitro and in vivo. (A) and (B) Reassortment between PTC and

wild-type viruses reduced the titers of wild-type progeny viruses. MDCK cells were

infected with a mixture of wild-type virus (MOI=0.01 or 0.1) and PTC viruses (MOI=1).

The cell supernatants were collected at 12-hour intervals, beginning at 24 h post-

infection and continuing for 72 hours, and then titrated by plaque formation assay in

conventional or transgenic cells in the absence of UAA. The inhibitory effect of PTC

viruses on plaque titers of wild-type progeny viruses was dependent on the number of

stop codons; increasing the number of stop codons could increase the inhibitory effect.

IIV and CAIV were used as controls. (C) PTC virus-mediated attenuation of the

virulence of infectious viruses was confirmed in mouse models based on observations

of survival rates, changes in body weight, and viral titration (D) Generation of

reassortants of PTC-4A with wild-type viruses in BALB/c mice was verified by

sequencing. The codon in the dotted box is the amber codon TAG. ★, P < 0.05; ★★, P <

0.01; ★★★, P < 0.001.

Fig. S15. No acute toxicity of NAEK on BALB/c mice, upon consumption of a dose of

130 mg/kg/day (equal to 100 mM × 100 µl in vitro), was observed, according to both

survival rate and body weight, in a 2-week follow-up study (A). Furthermore,

immunohistochemical staining of mice organs indicated no toxic side effects (B).

Table S1. Summary of escape frequencies for PTC influenza viruses.

Name Protein(s) TAG

location(s)

Relative

packaging

efficiency (%)

Escape frequency

(Passage 1)

Escape frequency

(Passage 20)

NP-D101 NP D101 80 ± 3 2.00E-09 ± 1.20E-09 8.00E-09 ± 7.10E-09

NP-G102 NP G102 50 ± 5 8.90E-08 ± 5.89E-09 4.10E-07 ± 9.40E-08

NP-G126 NP G126 40 ± 5 3.21E-08 ± 6.50E-09 1.10E-07 ± 5.20E-08

NP-D128 NP D128 33 ± 4 4.16E-07 ± 2.13E-07 5.90E-07 ± 7.26E-08

NP-R150 NP R150 31 ± 4 data not collected data not collected

NP-M163 NP M163 67 ± 5 7.00E-10 ± 1.02E-10 2.00E-9 ± 8.90E-10

NP-G169 NP G169 25 ± 3 data not collected data not collected

PB1-K11 PB1 K11 25 ± 2 data not collected data not collected

PB1-Y30 PB1 Y30 25 ± 2 data not collected data not collected

PB1-R52 PB1 R52 67 ± 3 7.10E-07 ± 1.10E-07 1.21E-06 ± 4.42E-07

PB1-G65 PB1 G65 31 ± 5 data not collected data not collected

PB1-T105 PB1 T105 57 ± 5 6.24E-06 ± 3.12E-06 7.35E-05 ± 3.62E-05

PB1-R126 PB1 R126 25 ± 3 data not collected data not collected

PB1-M227 PB1 M227 31 ± 5 data not collected data not collected

PB1-K229 PB1 K229 25 ± 1 data not collected data not collected

PB1-D230 PB1 D230 25 ± 2 data not collected data not collected

PB1-S375 PB1 S375 57 ± 5 3.20E-07 ± 1.06E-07 5.10E-07 ± 4.25E-07

PB1-K736 PB1 K736 29 ± 4 data not collected data not collected

NA-N2 NA N2 33 ± 3 data not collected data not collected

NA-K6 NA K6 24 ± 2 data not collected data not collected

NA-I7 NA I7 25 ± 1 data not collected data not collected

NA-I8 NA I8 33 ± 3 data not collected data not collected

NA-G11 NA G11 36 ± 5 data not collected data not collected

NA-V16 NA V16 31 ± 2 data not collected data not collected

NA-N28 NA N28 50 ± 4 9.30E-05 ± 8.56E-06 1.21E-03 ± 2.12E-04

NA-I29 NA I29 40 ± 4 3.10E-06 ± 5.34E-07 6.10E-06 ± 1.11E-06

NA-C76 NA C76 25 ± 3 data not collected data not collected

NA-K244 NA K244 36 ± 2 data not collected data not collected

HA-K57 HA K57 57 ± 5 6.20E-04 ± 1.30E-05 1.80E-01 ± 1.50E-02

HA-G317 HA G317 25 ± 1 data not collected data not collected

HA-C319 HA C319 25 ± 3 data not collected data not collected

HA-G333 HA G333 25 ± 2 data not collected data not collected

HA-N336 HA N336 25 ± 3 data not collected data not collected

PB2-Q13 PB2 Q13 67 ± 5 5.80E-04 ± 2.20E-05 8.90E-01 ± 8.90E-02

PB2-T24 PB2 T24 50 ± 4 6.00E-06 ± 6.12E-07 1.30E-05 ± 1.10E-06

PB2-K33 PB2 K33 67 ± 5 3.00E-09 ± 1.12E-09 7.00E-09 ± 3.28E-09

PB2-T35 PB2 T35 67 ± 5 3.50E-04 ± 3.08E-04 9.20E-01 ± 4.25E-02

PB2-S320 PB2 S320 36 ± 3 data not collected data not collected

Name Protein(s) TAG

location(s)

Relat ive

packaging

efficiency (%)

Escape frequency

(Passage 1)

Escape frequency

(Passage 20)

NS-M1 NS M1 25 ± 1 data not collected data not collected

NS-D2 NS D2 25 ± 2 data not collected data not collected

NS-N4 NS N4 25 ± 1 data not collected data not collected

NS-V6 NS V6 25 ± 2 data not collected data not collected

NS-S7 NS S7 25 ± 1 data not collected data not collected

NS-S8 NS S8 33 ± 1 8.70E-07 ± 4.50E-07 5.10E-05 ± 8.55E-06

NS-R37 NS R37 67 ± 3 6.10E-07 ± 7.31E-08 1.20E-06 ± 1.17E-06

NS-K41 NS K41 67 ± 5 1.20E-06 ± 8.22E-07 7.20E-05 ± 3.96E-05

NS-L43 NS L43 67 ± 4 6.50E-07 ± 3.27E-07 2.13E-06 ± 7.24E-07

NS-S83 NS S83 100 ± 2 8.90E-06 ± 6.60E-07 6.89E-03 ± 1.27E-03

NS-A86 NS A86 100 ± 3 3.00E-06 ± 6.15E-07 2.30E-04 ± 8.29E-05

NS-H101 NS H101 67 ± 5 4.50E-06 ± 7.30E-07 6.10E-06 ± 1.08E-06

NS-F103 NS F103 67 ± 5 8.90E-03 ± 1.12E-03 9.10E-01 ± 3.30E-02

NS-K110 NS K110 67 ± 5 2.10E-06 ± 2.13E-06 5.98E-05 ± 1.02E-05

NS-A122 NS A122 44 ± 4 2.10E-07 ± 1.13E-08 9.20E-06 ± 2.54E-06

NS-K126 NS K126 67 ± 6 6.79E-05 ± 1.27E-05 8.21E-04 ± 8.56E-05

NS-K131 NS K131 50 ± 2 5.60E-07 ± 3.55E-07 7.68E-06 ± 6.05E-07

NS-A132 NS A132 25 ± 1 data not collected data not collected

PA-R266 PA R266 80 ± 6 1.00E-08 ± 1.10E-08 6.80E-08 ± 1.80E-08

PA-L270 PA L270 80 ± 5 6.70E-07 ± 1.09E-07 3.90E-06 ± 5.13E-07

PA-D272 PA D272 80 ± 3 9.30E-06 ± 1.00E-06 5.91E-04 ± 2.25E-04

PA-K289 PA K289 25 ± 1 data not collected data not collected

PA-K318 PA K318 33 ± 2 data not collected data not collected

PA-K328 PA K328 67 ± 4 1.12E-06 ± 2.45E-07 2.10E-05 ± 6.20E-06

M2-S23 M2 S23 25 ± 2 data not collected data not collected

M2-D24 M2 D24 25 ± 1 data not collected data not collected

M2-H37 M2 H37 50 ± 4 8.00E-06 ± 7.75E-07 1.10E-05 ± 3.21E-06

M2-W41 M2 W41 25 ± 2 data not collected data not collected

M2-K49 M2 K49 57 ± 5 7.90E-03 ± 1.11E-03 7.50E-01 ± 2.25E-02

M2-K60 M2 K60 57 ± 6 5.70E-03 ± 3.29E-03 6.30E-01 ± 2.13E-01

PTC-1

(PA-R266) PA R266 80 ± 6 1.00E-08 ± 1.10E-08 6.80E-08 ± 1.80E-08

PTC-2 PA R266

67 ± 5 1.20E-10 ± 4.46E-11 3.10E-10 ± 6.45E-11 PB2 K33

PTC-3

PA R266

67 ± 6 <1.00E-11 <1.00E-11 PB2 K33

PB1 R52

Name Protein(s) TAG

location(s)

Relat ive

packaging

efficiency (%)

Escape frequency

(Passage 1)

Escape frequency

(Passage 20)

PTC-4A

PA R266

67 ± 5 <1.00E-11 <1.00E-11 PB2 K33

PB1 R52

NP D101

PTC-4B

PA R266

57 ± 6 <1.00E-11 <1.00E-11 PB2 K33

PB1 S375

NP M163

PTC-5

PA R266

50 ± 3 <1.00E-11 <1.00E-11

PB2 K33

PB1 R52

NP D101

NS K131

PTC-6

PA R266

50 ± 2 <1.00E-11 <1.00E-11

PB2 K33

PB1 R52

NP D101

NS K131

M2 H37

PTC-7

PA R266

50 ± 3 <1.00E-11 <1.00E-11

PB2 K33

PB1 R52

NP D101

NS K131

M2 H37

NA N28

PTC-8

PA R266

50 ± 2 <1.00E-11 <1.00E-11

PB2 K33

PB1 R52

NP D101

NS K131

M2 H37

NA N28

HA K57

The detection limit of the escape frequency in this study is 1.00E-11. The escape

frequency data of the PTC virus strains with low packaging efficiency was not collected.

The data are mean ± SD. The experiments were independently performed three times (N = 3).

Table S2. TAG codon mutations were confirmed by gene sequencing in escape

strains HA-K57, PB2-Q13, PB2-T35, NS-F103, M2-K49 and M2-K60.

Escape

mutant Gene segment

TAG codon mutated

to UAA is replaced by

HA-K57 E1 HA CAG Q

HA-K57 E2 HA CAG Q

HA-K57 E3 HA CAG Q

HA-K57 E4 HA GAG E

HA-K57 E5 HA GAA E

HA-K57 E6 HA CAA Q

PB2-Q13 E1 PB2 CAG Q

PB2-Q13 E2 PB2 CAG Q

PB2-Q13 E3 PB2 CAG Q

PB2-Q13 E4 PB2 CAG Q

PB2-Q13 E5 PB2 CAG Q

PB2-Q13 E6 PB2 CAG Q

PB2-T35 E1 PB2 CAG Q

PB2-T35 E2 PB2 CAG Q

PB2-T35 E3 PB2 CAG Q

PB2-T35 E4 PB2 CAG Q

PB2-T35 E5 PB2 CAG Q

PB2-T35 E6 PB2 CAG Q

NS-F103 E1 NS CAG Q

NS-F103 E2 NS CAG Q

NS-F103 E3 NS CAG Q

NS-F103 E4 NS CAG Q

NS-F103 E5 NS CAG Q

NS-F103 E6 NS CAG Q

M2-K49 E1 M2 TGG W

M2-K49 E2 M2 TGG W

M2-K49 E3 M2 TGG W

M2-K49 E4 M2 TGG W

M2-K49 E5 M2 TCG S

M2-K49 E6 M2 TCG S

M2-K60 E1 M2 AAA K

M2-K60 E2 M2 AAA K

M2-K60 E3 M2 AAA K

M2-K60 E4 M2 AAA K

M2-K60 E5 M2 AAG K

M2-K60 E6 M2 AAG K

Six escape mutants per virus strain were isolated from the virus pool through plaque

purification in the absence of UAA. An escape mutant was designated by a number

following the letter “E” (for example, E1).

References

1. F. Krammer, P. Palese, Advances in the development of influenza virus vaccines. Nat. Rev. Drug Discov. 14, 167–182 (2015). doi:10.1038/nrd4529

2. A. Marzi, P. Halfmann, L. Hill-Batorski, F. Feldmann, W. L. Shupert, G. Neumann, H. Feldmann, Y. Kawaoka, An Ebola whole-virus vaccine is protective in nonhuman primates. Science 348, 439–442 (2015). doi:10.1126/science.aaa4919

3. J. B. Ulmer, U. Valley, R. Rappuoli, Vaccine manufacturing: Challenges and solutions. Nat. Biotechnol. 24, 1377–1383 (2006). doi:10.1038/nbt1261

4. S. A. Plotkin, Vaccines: Past, present and future. Nat. Med. 11, S5–S11 (2005). doi:10.1038/nm1209

5. Y. H. Jang, B. L. Seong, Principles underlying rational design of live attenuated influenza vaccines. Clin. Exp. Vaccine Res. 1, 35–49 (2012). doi:10.7774/cevr.2012.1.1.35

6. S. Tong, Y. Li, P. Rivailler, C. Conrardy, D. A. A. Castillo, L.-M. Chen, S. Recuenco, J. A. Ellison, C. T. Davis, I. A. York, A. S. Turmelle, D. Moran, S. Rogers, M. Shi, Y. Tao, M. R. Weil, K. Tang, L. A. Rowe, S. Sammons, X. Xu, M. Frace, K. A. Lindblade, N. J. Cox, L. J. Anderson, C. E. Rupprecht, R. O. Donis, A distinct lineage of influenza A virus from bats. Proc. Natl. Acad. Sci. U.S.A. 109, 4269–4274 (2012). doi:10.1073/pnas.1116200109

7. L. Wang, A. Brock, B. Herberich, P. G. Schultz, Expanding the genetic code of Escherichia coli. Science 292, 498–500 (2001). doi:10.1126/science.1060077

8. J. W. Chin et al., An expanded eukaryotic genetic code. Science 301, 964–967 (2003). doi:10.1126/science.1084772

9. A. J. Rovner, A. D. Haimovich, S. R. Katz, Z. Li, M. W. Grome, B. M. Gassaway, M. Amiram, J. R. Patel, R. R. Gallagher, J. Rinehart, F. J. Isaacs, Recoded organisms engineered to depend on synthetic amino acids. Nature 518, 89–93 (2015). doi:10.1038/nature14095

10. S. B. Sun, P. G. Schultz, C. H. Kim, Therapeutic applications of an expanded genetic code. ChemBioChem 15, 1721–1729 (2014). doi:10.1002/cbic.201402154

11. Y. Zheng, F. Yu, Y. Wu, L. Si, H. Xu, C. Zhang, Q. Xia, S. Xiao, Q. Wang, Q. He, P. Chen, J. Wang, K. Taira, L. Zhang, D. Zhou, Broadening the versatility of lentiviral vectors as a tool in nucleic acid research via genetic code expansion. Nucleic Acids Res. 43, e73 (2015). doi:10.1093/nar/gkv202

12. N. Wang, Y. Li, W. Niu, M. Sun, R. Cerny, Q. Li, J. Guo, Construction of a live-attenuated HIV-1 vaccine through genetic code expansion. Angew. Chem. Int. Ed. 53, 4867–4871 (2014). doi:10.1002/anie.201402092

13. C. Zhang, T. Yao, Y. Zheng, Z. Li, Q. Zhang, L. Zhang, D. Zhou, Development of next generation adeno-associated viral vectors capable of selective tropism and efficient gene delivery. Biomaterials 80, 134–145 (2016). doi:10.1016/j.biomaterials.2015.11.066

14. X. Jin, T. Sun, C. Zhao, Y. Zheng, Y. Zhang, W. Cai, Q. He, K. Taira, L. Zhang, D. Zhou, Strand antagonism in RNAi: An explanation of differences in potency between intracellularly expressed siRNA and shRNA. Nucleic Acids Res. 40, 1797–1806 (2012). doi:10.1093/nar/gkr927

15. J. Hsieh, A. Fire, Recognition and silencing of repeated DNA. Annu. Rev. Genet. 34, 187–204 (2000). doi:10.1146/annurev.genet.34.1.187

16. W. Wang, J. K. Takimoto, G. V. Louie, T. J. Baiga, J. P. Noel, K.-F. Lee, P. A. Slesinger, L. Wang, Genetically encoding unnatural amino acids for cellular and neuronal studies. Nat. Neurosci. 10, 1063–1072 (2007). doi:10.1038/nn1932

17. G. Neumann, T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, Y. Kawaoka, Generation of influenza A viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. U.S.A. 96, 9345–9350 (1999). doi:10.1073/pnas.96.16.9345

18. M. Yu, L. Si, Y. Wang, Y. Wu, F. Yu, P. Jiao, Y. Shi, H. Wang, S. Xiao, G. Fu, K. Tian, Y. Wang, Z. Guo, X. Ye, L. Zhang, D. Zhou, Discovery of pentacyclic triterpenoids as potential entry inhibitors of influenza viruses. J. Med. Chem. 57, 10058–10071 (2014). doi:10.1021/jm5014067

19. S. Xiao, L. Si, Z. Tian, P. Jiao, Z. Fan, K. Meng, X. Zhou, H. Wang, R. Xu, X. Han, G. Fu, Y. Zhang, L. Zhang, D. Zhou, Pentacyclic triterpenes grafted on CD cores to interfere with influenza virus entry: A dramatic multivalent effect. Biomaterials 78, 74–85 (2016). doi:10.1016/j.biomaterials.2015.11.034

20. E. J. Jung, K. H. Lee, B. L. Seong, Reverse genetic platform for inactivated and live-attenuated influenza vaccine. Exp. Mol. Med. 42, 116–121 (2010). doi:10.3858/emm.2010.42.2.013

21. J. R. Coleman, D. Papamichail, S. Skiena, B. Futcher, E. Wimmer, S. Mueller, Virus attenuation by genome-scale changes in codon pair bias. Science 320, 1784–1787 (2008). doi:10.1126/science.1155761

22. A. Nogales, S. F. Baker, E. Ortiz-Riano, S. Dewhurst, D. J. Topham, L. Martinez-Sobrido, Influenza A virus attenuation by codon deoptimization of the NS gene for vaccine development. J. Virol. 88, 10525–10540 (2014). doi:10.1128/JVI.01565-14

23. H. Ashkenazy, E. Erez, E. Martz, T. Pupko, N. Ben-Tal, ConSurf 2010: Calculating evolutionary conservation in sequence and structure of proteins and nucleic acids. Nucleic Acids Res. 38, W529–W533 (2010). doi:10.1093/nar/gkq399

24. A. Impagliazzo, F. Milder, H. Kuipers, M. V. Wagner, X. Zhu, R. M. B. Hoffman, R. van Meersbergen, J. Huizingh, P. Wanningen, J. Verspuij, M. de Man, Z. Ding, A. Apetri, B. Kukrer, E. Sneekes-Vriese, D. Tomkiewicz, N. S. Laursen, P. S. Lee, A. Zakrzewska, L. Dekking, J. Tolboom, L. Tettero, S. van Meerten, W. Yu, W. Koudstaal, J. Goudsmit, A. B. Ward, W. Meijberg, I. A. Wilson, K. Rado evi, A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen. Science 349, 1301–1306 (2015). doi:10.1126/science.aac7263

25. D. R. Burton, P. Poignard, R. L. Stanfield, I. A. Wilson, Broadly neutralizing antibodies present new prospects to counter highly antigenically diverse viruses. Science 337, 183–186 (2012). doi:10.1126/science.1225416

26. Z. Staneková, E. Varečková, Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development. Virol. J. 7, 351 (2010). doi:10.1186/1743-422X-7-351

27. J. Cohen, Unfilled vials. Science 351, 16–19 (2016). doi:10.1126/science.351.6268.16

28. A. L. Hiti, D. P. Nayak, Complete nucleotide sequence of the neuraminidase gene of human influenza virus A/WSN/33. J. Virol. 41, 730–734 (1982).

29. D. Hobson, E. A. Gould, H. I. Flockton, M. G. Gregory, Laboratory differences between the WS strain of influenza A virus and its neurotropic variants. Br. J. Exp. Pathol. 49, 516–524 (1968).

30. S. Wilson, C. Andrews, P. Laidlaw, A virus obtained from influenza patients. Lancet 2, 66–68 (1933).

31. S. Cao, X. Liu, M. Yu, J. Li, X. Jia, Y. Bi, L. Sun, G. F. Gao, W. Liu, A nuclear export signal in the matrix protein of Influenza A virus is required for efficient virus replication. J. Virol. 86, 4883–4891 (2012). doi:10.1128/JVI.06586-11

32. H. Katsura, K. Iwatsuki-Horimoto, S. Fukuyama, S. Watanabe, S. Sakabe, Y. Hatta, S. Murakami, M. Shimojima, T. Horimoto, Y. Kawaoka, A replication-incompetent virus possessing an uncleavable hemagglutinin as an influenza vaccine. Vaccine 30, 6027–6033 (2012). doi:10.1016/j.vaccine.2012.07.059

33. H. Kong, Q. Zhang, C. Gu, J. Shi, G. Deng, S. Ma, J. Liu, P. Chen, Y. Guan, Y. Jiang, H. Chen, A live attenuated vaccine prevents replication and transmission of H7N9 virus in mammals. Sci. Rep. 5, 11233 (2015). doi:10.1038/srep11233

34. S. Niu, L. Si, D. Liu, A. Zhou, Z. Zhang, Z. Shao, S. Wang, L. Zhang, D. Zhou, W. Lin, Spiromastilactones: A new class of influenza virus inhibitors from deep-sea fungus. Eur. J. Med. Chem. 108, 229–244 (2016). doi:10.1016/j.ejmech.2015.09.037

35. B. Y. Chua, C. Y. Wong, E. J. Mifsud, K. M. Edenborough, T. Sekiya, A. C. L. Tan, F. Mercuri, S. Rockman, W. Chen, S. J. Turner, P. C. Doherty, A. Kelso, L. E. Brown, D. C. Jackson, Inactivated influenza vaccine that provides rapid, innate-immune-system-mediated protection and subsequent long-term adaptive immunity. MBio 6, e01024-15 (2015). doi:10.1128/mBio.01024-15

36. J. C. Pedersen, Hemagglutination-inhibition assay for influenza virus subtype identification and the detection and quantitation of serum antibodies to influenza virus. Methods Mol. Biol. 1161, 11–25 (2014). doi:10.1007/978-1-4939-0758-8_2

37. P. Kitikoon, A. L. Vincent, Microneutralization assay for swine influenza virus in swine serum. Methods Mol. Biol. 1161, 325–335 (2014). doi:10.1007/978-1-4939-0758-8_27

38. D. P. Nayak, R. A. Balogun, H. Yamada, Z. H. Zhou, S. Barman, Influenza virus morphogenesis and budding. Virus Res. 143, 147–161 (2009). doi:10.1016/j.virusres.2009.05.010

39. S. Boivin, S. Cusack, R. W. Ruigrok, D. J. Hart, Influenza A virus polymerase: Structural insights into replication and host adaptation mechanisms. J. Biol. Chem. 285, 28411–28417 (2010). doi:10.1074/jbc.R110.117531

40. T. Noda, H. Sagara, A. Yen, A. Takada, H. Kida, R. H. Cheng, Y. Kawaoka, Architecture of ribonucleoprotein complexes in influenza A virus particles. Nature 439, 490–492 (2006). doi:10.1038/nature04378

41. G. Neumann, T. Noda, Y. Kawaoka, Emergence and pandemic potential of swine-origin H1N1 influenza virus. Nature 459, 931–939 (2009). doi:10.1038/nature08157