Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org...

Post on 19-Jan-2018

222 views 0 download

description

Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally one circular chromosome in prokaryotes

Transcript of Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org...

Functions

GenomeEntire set of DNA in each cell of an orgNormally one circular chromosome in

prokaryotes

Binary FissionSingle chromosome replicatesOne pulls awayMembrane & wall separate cell

Human Genome

Haploid(n)

Diploid(2n)

6,000,000,000 base pairs longSomatic cells’ DNA is split into 46

chromosomes23 are maternal23 are paternal

Gametes have ½ the DNA which is split into 23 chroms

Human Genome ( )♂Human Genome ( )♀

1 2 3 4 5 6 7 8

9 10 11 12 13 14 15 16

X21 2219 2017 18 Y

Human ChromosomeA length of DNA

Each has a homologous chromosome

♀ ♂Homologous Pair

CENTROMERES

A length of DNAEach has a homologous

chromosome1000’s of genes1,000,000’s of base pairsCombined with proteins

Homologous Pair ♀ ♂

ATCGCGGCATTATATACGGCGCCGTA

Human Chromosome

Each chromosome replicates to form identical chromatids

Attached by centromeres

Chromosome Replication

Cell Cycle

Identical distribution of replicated DNA into nuclei of 2

daughter cells

Splitting of the rest of the cell

Late InterphaseCentrosomes replicate

ProphaseChromosomes supercoilNucleoli disappearSpindle forms

Spindle Elongation

Prometaphase Nuc envelope breaks downmtubules from opposite poles

attach to kinetochores

MetaphaseSpindle fibers force chroms

to metaphase plate

AnaphaseChromatids migrate toward

opposite polesNonkinetochore mtubules

elongate cell

Anaphase Chromatid may “walk” along

mtubule toward pole

TelophaseCell continues elongationNuclear envelopes reformDNA uncoils

Cytokinesis (animal) Microfilaments

constrict cell to form cleavage furrow

Membrane pinches off

Cytokinesis (Plant)

Cellulose vesicles gather in the middle of the cell forming the cell plate