Post on 04-Apr-2018
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
1/37
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
2/37
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
3/37
3
INTRODUCTION48
Phosphorus (P) is an essential macroelement for plants, and its bioavailability is often49
limited in soil because it forms highly insoluble iron/aluminum oxide complexes (11).50
Several bacteria are known to solubilize phosphate from these soil complexes, rendering51
phosphorus available to plants and thereby improving plant growth. Among P-solubilizing52
microorganisms, rhizosphere-colonizing pseudomonads are of major interest as they possess53
many other plant-beneficial traits, such as the capacity to directly improve growth, induce54
systemic resistance in plants and suppress soilborne diseases (15). A recent metagenomic55
analysis of rhizosphere microbiomes has shown that -proteobacteria (with pseudomonads56
being the most important group of rhizosphere-associated -proteobacteria) are enriched in57
disease suppressive soils and also in response to attack by fungal pathogens (26). Fluorescent58
Pseudomonas spp. have received special attention because they are efficient root colonizers,59
and strains belonging to a subgroup that produces the potent antifungal metabolites 2,4-60
diacetylphloroglucinol (DAPG) and hydrogen cyanide (HCN) are particularly efficient in61
providing protection against several fungal pathogens of different plants species (15, 16, 18).62
Phosphate solubilization by Pseudomonas spp. in soil is mainly associated with the63
production and excretion of gluconic acid, which chelates the cations bound to phosphate,64
thereby releasing the element (7). The production of this acid implies the direct oxidation of65
glucose catalyzed by a periplasmic membrane-bound glucose dehydrogenase (GDH), which66
forms a complex with the cofactor pyrroloquinoline quinone (PQQ).67
PQQ also serves as a redox cofactor for various bacterial dehydrogenases other than68
GDH, but is not produced in animals or plants. Several studies with bacterial mutants unable69
to produce PQQ and gluconic acid have demonstrated the intimate relation of the cofactor to70
phosphate solubilization processes (7, 17). Beside its relevant role in P-solubilization, PQQ is71
reported to be a potent growth-promoting factor for bacteria and plants, has antioxidant72
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
4/37
4
properties (5), and is directly related to the production of antimicrobial substances (7, 14, 36)73
as well as to the induction of systemic plant defenses (17). Hence, the cofactor PQQ has74
multiple plant beneficial effects.75
The genes responsible for PQQ production have been cloned and sequenced in several76
bacterial genera, including Pseudomonas, Methylobacterium, Acinetobacter, Klebsiella,77
Enterobacterand Rhanella (5, 14, 17, 36, 42). In P. fluorescens B16, the PQQ operon is78
formed by eleven genes,pqqA, -B, -C, -D, -E, -F, -H, -I, -J, -KandpqqM(5). ThepqqCgene79
encodes the pyrroloquinoline quinone synthase C (PqqC), which is the best characterized80
enzyme in the pathway and catalyzes the final step of the PQQ biosynthesis, namely81
cyclization and oxidation of the intermediate 3a-(2-amino-2-carboxy-ethyl)-4,5-dioxo-82
4,5,6,7,8,9-hexahydroquinoline-7,9-dicarboxylic acid to PQQ (22).83
No studies have yet focused on the evolutionary history and the genetic diversity of PQQ84
in bacteria, although this would be particularly interesting for the agriculturally important85
genus Pseudomonas. Previous studies on the occurrence, diversity and evolution of plant-86
associatedPseudomonas spp. have mostly focused on the diversity of the 16S rRNA(4, 31,87
33), other housekeeping genes (4, 8, 32) or biocontrol-relevant genes involved in the88
suppression of various plant pathogenic fungi (6, 8, 9, 18, 31, 33, 40). In addition, little is89
known about the occurrence ofpqq genes amongPseudomonas species. The main aim of this90
study was therefore to investigate the phylogeny of thepqqCgene and to evaluate whether it91
could serve as a marker to study the diversity and evolution in pseudomonads. To this end,92
we designed primers for the amplification ofpqqCspecifically in the genus Pseudomonas.93
The phylogeny ofpqqCwas then inferred from sequences ofPseudomonas reference strains94
and ofPseudomonas spp. isolated from wheat roots and compared to that of the two95
housekeeping genes rpoD and gyrB. To capture most of the pqqCdiversity present in the96
wheat root samples that we studied, we used cultivation-dependent and cultivation-97
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
5/37
5
independent approaches. Finally, we related the pqqC phylogeny to the phosphate98
solubilizing activity of the pseudomonads investigated.99
100
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
6/37
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
7/37
7
amplification, sequencing ofpqqC, rpoD and gyrB genes and for phosphate solubilisation126
studies (described below).127
Total DNA extraction from root samples. The total DNA from root pieces (0.5 g) and128
50 ml root suspension (prepared as described above) was extracted, using a Fast DNA Spin129
Kit for soil (MP Biomedicals, Irvine, CA, USA). The frozen samples were briefly thawed130
overnight at 4C, and root pieces were added to DNA extraction tubes. The remaining root131
suspension was centrifuged at 3500 rpm for 20 min, and 50 l of the resulting pellets were132
additionally added to the extraction tubes. Total DNA was further extracted according to the133
manufacturers recommendations but using reduced volumes of the sodium phosphate and134
MT buffers. DNA was diluted to a concentration of 10 ng/l. DNA extracts were then135
subjected topqqCPCR amplification, cloning and sequencing.136
Design ofpqqCprimers pqqCr1 and pqqCf1. Alignment of thepqqCregions retrieved137
from the GenBank was performed using the multiple sequence alignment program ClustalW138
1.8 (41) to determine regions conserved only within the genus Pseudomonas. The primers139
pqqCr1 (5-CAGGGCTGGGTCGCCAACC-3) and pqqCf1 (5-140
CATGGCATCGAGCATGCTCC-3), which amplify a 546-bp long (including primer141
sequences)pqqCfragment, were designed and their specificity tested against DNA sequences142
available in GenBank with the program Molecular Evolutionary Genetics Analysis (MEGA)143
software version 4.0 (41). Furthermore, pqqC primer specificity was tested by PCR144
amplification (see below) on 57 reference Pseudomonas strains (i.e., 37 DAPG-producing145
fluorescent pseudomonads, and 20 pseudomonads not producing DAPG, representing the146
major phylogenetic groups of thePseudomonas genus) and on bacterial strains representative147
of 12 different non-Pseudomonas genera, mostly found in the soil environment (listed in148
Table 1). For phylogenetic analyses, a subset of 36Pseudomonas reference strains were used149
as described below.150
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
8/37
8
PCR assays. PCRamplifications ofpqqCfrom bacterial DNA lysates were carried out in151
20-l mixtures containing 1 x ThermoPol Buffer (New England Biolabs, Inc., Beverly, MA,152
USA) 100 M of each dNTP, 0.4 M of each forward and reverse primer, 0.75 U Taq DNA-153
Polymerase (5000 U/ml, New England Biolabs, Inc.) and 2 l of genomic DNA. The154
following thermocycling conditions were used: initial denaturation at 96C for 10 min155
followed by 30 cycles of 96C for 30 s, 63C for 30 s, 72C for 1 min and final elongation at156
72C for 10 min. ForpqqC amplification from roots, 20 ng total DNA extracts, 5%157
dimethylsulfoxide (Sigma-Aldrich, St. Louis, MO, USA) and 5% bovine serum albumin were158
added to the PCR mix, and thermocycling conditions were slightly modified from those159
described above, i.e. 35 cycles instead of 30, denaturing and annealing times of 1 min and an160
elongation time of 2 min per cycle. The presence of amplified fragments was checked by161
standard gel electrophoresis and ethidium bromide staining.162
The genes involved in the biosynthesis of HCN (hcnA, hcnB), DAPG (phlD) and163
phenazine (phzF), respectively, and two housekeeping genes (gyrB and rpoD) were amplified164
with primers and the annealing temperatures listed in Table 2,using the same thermocycling165
conditions as for thepqqCgene.166
Prior to ligation and sequencing reactions, all PCR amplicons were purified on a167
MultiScreen PCR plate (Millipore, Molsheim, France), resuspended in 30 l of sterile double-168
distilled water and quantified using Nanodrop ND-1000 (NanoDrop Technologies,169
Wilmington, DE, USA).170
pqqCcloning. PurifiedpqqCfragments amplified from DNA extracted from root samples171
were cloned using the TA cloning vector pJET1.2 (CloneJet PCR cloning kit; Fermentas,172
Glen Burnie, USA). The constructs were transformed into chemically competent E. coli One173
Shot TOP 10 cells (Invitrogen, Carlsbad, USA), and a total of 107 transformants (3040 per174
root sample replicate) containing the pJET1.2_pqqCconstruct were selected for sequencing.175
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
9/37
9
Sequencing of the pqqC, rpoD and gyrB genes. Sequencing reactions were performed176
with 310 ng of purified PCR product and primers at a final concentration of 0.16 M, using177
an ABI PRISM BigDye Terminator v3.0 cycle sequencing kit (Applied Biosystems, Foster178
City, CA, USA) according to manufacturer's instructions. The obtained products were179
cleaned by gel-filtration through Sephadex G-50 columns (Amersham Biosciences, Uppsala,180
Sweden) on MultiScreen HV plates (Millipore). Purified products were sequenced using an181
ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) at the182
Genetic Diversity Centre of the ETH Zrich. DNA sequences were edited using the183
Sequencher package (Gene Codes, Ann Arbor, MI, USA). Sequences of 507 bp-long pqqC184
fragments (without primer sequences) were submitted to the GenBank under accession185
numbers JN397402560 (76 sequences from cloned pqqC fragments, 33 pqqC sequences186
amplified from wheat root isolates and 50 pqqC sequences from Pseudomonas reference187
strains). Sequences of 533536 bp-long gyrB fragments and of 581587 bp-long rpoD188
fragments from 5 (gyrB) and 8 (rpoD) reference pseudomonads and from 32 (gyrB) and 33189
(rpoD) wheat root isolates were submitted to the GenBank under accession numbers190
JN397569573, JN397607638, JN397561568 and JN397574606, respectively.191
Phylogenetic analysis. Pseudomonas phylogenies shown in Figs. 1, 2, S1, S2 and S3192
were inferred from pqqC, rpoD and gyrB sequences from a selection of 36 Pseudomonas193
reference strains, including 12 DAPG-producing and 14 non DAPG-producing fluorescent194
pseudomonads listed in Table 1 (underlined strains) and GenBank sequences of 10195
Pseudomonas strains: P. aeruginosa UCBPP-PA14 (GenBank database accession number:196
CP000438.1), P. entomophila L48 (CT573326.1), P. mendocina ymp (CP000680.1), P.197
putida GB-1 (CP000926.1), P. putida KT2440 (AE015451.1), P. putida W619198
(CP000949.1), P. stutzeri A1501 (CP000304.1), P. syringae pv. phaseolicola 1448A199
(CP000058.1), P. syringae pv. syringae B728a (CP000075.1), P. syringae pv. tomato200
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
10/37
10
DC3000 (AE016853.1). The alignment of DNA sequences was performed with ClustalW 1.8201
implemented in the MEGA software version 4.0 package (41). Phylogenetic trees were202
constructed with the MEGA software version 4.0 (41), using the neighbor-joining(NJ)203
method (35) for trees shown in Figs. 1, 2, S1, S2 and S3 or with the PhyML 3.0 phylogeny204
software (12), using the maximum likelihood (ML) method for trees additionally included in205
the ShimodairaHasegawa test (see below). The genetic distances were computed, based on206
the maximum composite likelihood estimated by using the TamuraNei model, MEGA207
software version 4.0 (41). The nucleotide sequences of thepqqC,gyrB and rpoD genes from208
Pseudomonas aeruginosa PAO1, P. aeruginosa UCBPP-PA14, Pseudomonas mendocina209
ymp andPseudomonas stutzeri A1501 were used as outgroups.210
The ShimodairaHasegawa (SH) test (37) implemented in the phylogenetic analysis by211
maximum likelihood (PAML) software package version 3.14 (44) was performed to compare212
different ML and NJ trees of the Pseudomonas genus (36 reference strains) inferred from213
single and concatenated loci.214
pqqC sequence analysis. The GC content, the diversity index () and ratios of non-215
synonymous to synonymous substitutions (dN/dS) were calculated forpqqC sequences216
derived from i) a subset of 19 reference Pseudomonas strains representing the main217
phylogenetic groups as defined by Mulet et al. (29) includingsix strains of theP. fluorescens218
group 1 (LMG2172, Pf0-1, 30-84, CHA0, 2-79, SBW25), four strains of the P. syringae219
group 2 (LMG2152, DC3000, B728a, 140BA), five strains of theP. putida group 3 (P3, GB1,220
W619, KT2440, L48) and four strains of theP. aeruginosa group 4 (PAO1, UCBPP-PA14,221
ymp, A1501) and ii) aPseudomonas wheat root population illustrated in Fig. 2B representing222
106 different operational taxonomical units (OTUs). The GC content and nucleotide diversity223
() indexes were calculated with the DnaSP program version 5 (34). The index expresses224
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
11/37
11
the genetic diversity or polymorphism of a gene in a population, with = 0 meaning no225
polymorphism and = 1 indicating maximal polymorphism.226
In order to identify the type of selection acting on pqqC,gyrB and rpoD codons, the fast227
single-likelihood ancestor (SLAC) counting method was applied. The SLAC method is228
available in a free public web implementation (http://www.datamonkey.org) and compares229
the ratio of non-synonymous (dN) and synonymous (dS) codon changes of a given population230
assuming neutral evolution, providing information about the type of selective constraint231
acting on the proteins (20). AdN/dS< 1 indicates purifying selection, dN/dS > 1 positive232
selection, and a dN/dS 1 neutral selection.233
Phosphate solubilisation activity ofPseudomonas isolates. The ability ofPseudomonas234
strains/isolates to solubilize phosphate was measured for 41 pseudomonads reference strains235
and 29 wheat root isolates belonging each to a different rpoD-gyrB operational taxonomical236
unit (OTU) (Table S1) on solid NBRIP medium (30) as follows. LB overnight cultures of237
bacterial strains were used to spot-inoculate (5 l) the NBRIP plates, which were then sealed238
with parafilm and incubated in the dark at 27C for 19 days. Solubilization of tri-239
calciumphosphate resulted in the formation of clear halos around the bacterial colonies. The240
solubilization activity per bacterial strain was evaluated by subtracting the diameter of the241
colonies from the entire diameter of the halos (7). Strains were divided into four classes242
according to their P-solubilization activity: 1, very low activity (0.04.4 mm); 2, low activity243
(4.55.4 mm); 3, medium activity (5.56.4 mm); and 4, strong activity (6.57.5 mm). Three244
to six replicate plates were prepared for each strain.245
P solubilisation data were statistically analysed using SYSTAT 12 (Systat Software, Inc.,246
San Jose, CA, USA) at the probability threshold of 0.05. Data were first analyzed by analysis247
of variance (ANOVA), and pairwise mean comparisons of different (sub)groups were248
subsequently done, using Tukeys range test.249
250
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
12/37
12
RESULTS251
Primer specificity and pqqCabundance in pseudomonads. The pqqCf1 and pqqCr1252
primers pair was specific for the genusPseudomonas and did not amplify any of the twelve253
other tested genera. ThepqqCgene could be amplified in all tested pseudomonads, i.e. in 57254
reference strains (37 DAPG-producing fluorescent pseudomonadsand 20 pseudomonads not255
producing DAPG belonging to at least nine different species) and in 140 wheat root isolates256
from a Swiss field site belonging to the Pseudomonas genus based on similarity levels257
determined by BLAST search of sequenced gyrB orrpoD fragments. All strains produced a258
single amplicon, except DAPG-producing strains of the multilocus group E (strains F96.27,259
P97.38, P97.6, P97.1 and F96.26) (8) and P. aeruginosa PAO1, which produced unspecific260
PCR products.261
Phylogenetic comparison between pqqCand the two housekeeping genes rpoD and262
gyrB within the genus Pseudomonas. The phylogeny of the pqqCgene was compared to263
that of the two housekeeping genes rpoD and gyrB for 36 Pseudomonas reference strains,264
including known biocontrol strains and other strains found in soil environment. To allow a265
better resolution of the Pseudomonas phylogeny, the rpoD and gyrB sequences were266
concatenated as done by Yamamoto et al. before inferring the phylogenetic tree (Fig. 1A)267
(43). The tree based on pqqCsequences (Fig. 1B) showed phylogenetic clusters similar to268
those of the tree inferred from the concatenated housekeeping genes (Fig 1A). Nevertheless,269
there were some emplacement differences. First, in the concatenated rpoD-gyrB tree, theP.270
syringae strains (thin lined box, Fig. 1) were well separated from the P. fluorescens main271
group as defined in Mulet et al. (29), whereas in the pqqC tree, they clustered within this272
group. Second, in the rpoD-gyrB tree, the group of DAPG and PLT producers (thick lined273
box, Fig.1) were located within the P. fluorescens group and clustered close to the P.274
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
13/37
13
chlororaphis subgroup (dashed lined box, Fig. 1) while in the pqqC tree, these strains275
clustered apart from theP. fluorescens group.276
Single-locus trees often display incongruent topologies when compared with one another.277
Concatenation of two or more loci has been shown to increase the resolution of the inferred278
phylogenies (43). Assuming that thegyrB-rpoD tree (Fig. 1A) represents a good explanation279
of the species phylogeny of the genus Pseudomonas (43), we compared different tree280
topologies based on single loci (gyrB, rpoD, and pqqC) and concatenated loci (gyrB-pqqC,281
gyrB-rpoD-pqqCand rpoD-pqqC) to that reference tree using the SH test. ThepqqCtree was282
found to be the only single locus tree incongruent with the gyrB-rpoD reference tree (P
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
14/37
14
Interestingly, only two wheat root isolates (RW09-C22 and RW09-C29) shared the same300
OTU as some cloned pqqC fragments. This means a total of 108 different OTUs were301
detected in the wheat rhizosphere population investigated. The amount of total pqqC302
pseudomonads on the roots of the wheat plants and in the bulk soil was quantified by the303
Most Probable Number Technique (MPN) and resulted in 2.83E+08 pseudomonads per g root304
and 1.77E+06 pseudomonads per g soil, respectively.305
Phylogenetic analyses of pseudomonads colonizing the roots of field grown wheat306
based on pqqCor concatenated rpoD-gyrB sequences. Phylogenetic trees were inferred307
from concatenated rpoD-gyrB and frompqqCsequences of 36 reference pseudomonads and308
136 pseudomonads isolated from wheat roots (Figs. 2A and S2). Moreover a pqqC309
phylogenetic tree was constructed which additionally included 107 cloned pqqCsequences310
obtained from a cultivation-independent method (Fig. 2B). In the rpoD-gyrB tree (Fig. 2A)311
two lineages and four main groups were identified according to Mulet et al. (29), i.e. the P.312
fluorescens lineage containingP. fluorescens (group 1),P. syringae (group 2) andP. putida313
(group 3), and the P. aeruginosa lineage containing P. aeruginosa, P. mendocina and P.314
stutzeri (group 4). TheP. fluorescens group 1 was further subdivided into seven subgroups;315
i.e. 1a (DAPG producers,P. kilonensis andP. corrugata), 1b (containingP. fluorescens Pf0-316
1), 1c (P. chlororaphis), 1d (DAPG and PLT producers),1e (wheat isolates from this study),317
1f (containingP. fluorescens 2-79) and 1g (containingP. fluorescens SBW25).318
ThepqqCtrees displayed a topology similar to that of the rpoD-gyrB tree; however, some319
differences in group allocations were detected. Remarkably, in bothpqqCtrees (Figs. 2B and320
S2B) including or not sequences from non-cultivated pseudomonads, subgroup 1d (DAPG321
and PLT producers) clearly clustered away from the P. fluorescens group whereas the P.322
syringae group clustered within the P. fluorescens group. In the pqqC tree that is based on323
sequences of cultivated pseudomonads only (Fig. S2B), subgroup 1c which contains the P.324
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
15/37
15
chlororaphis strains also clustered outside theP. fluorescens group and close to subgroup 1d.325
ThreepqqCsequences from non-cultivated pseudomonads did not fit in any of the four main326
groups and were thus designated as group 5 (one sequence) which clustered close to the P.327
syringae group and group 6 (two sequences) which clustered close to theP. aeruginosa group328
(Fig. 2B). Finally, four different sequences derived from the pqqC clone library clustered329
within theP. fluorescens group 1 but away from any defined subgroup and were thus defined330
as subgroup 1h.331
Phylogenetic distribution of cultivated and non-cultivated pseudomonads from332
wheat roots based on pqqC. Nearly all of 140 root-isolated pseudomonads as well as the333
great majority (98%) of the 107 cloned pqqC sequences derived from the cultivation-334
independent approach were found to cluster within theP. fluorescens group 1 (Fig. 2B, Table335
3). However, their distribution among the subgroups of group 1 was different. The majority336
of cloned pqqC sequences (84%) was located in subgroup 1g. In contrast, most of the337
cultivated bacteria were distributed within subgroups 1b (34%), 1g (29%), 1f (19 %) and 1e338
(12%). Interestingly, subgroups 1a, 1d and 1f contained only cultivated whereas subgroup 1h339
contained only non-cultivated bacteria.340
pqqC, gyrB and rpoD GC contents and polymorphism. To gain an insight into the341
polymorphism and the selective pressure acting onpqqC, the GC content, the diversity index342
() and ratios of non-synonymous to synonymous substitutions (dN/dS) were calculated for343
the genusPseudomonas and a wheat root population (Table 4). The nucleotide diversity ()344
of strains representing the genusPseudomonas was 0.145 forpqqC. This value was situated345
between the values of the housekeeping genesgyrB (0.125) and rpoD (0.236), indicating a346
polymorphism ofpqqCgreater thangyrB but lower than rpoD. For all the investigated data347
sets, synonymous to non-synonymous substitutions (dN/dS) ratios were significantly below 1,348
indicating that the selective pressure acting onpqqC, gyrB and rpoD is purifying (Table 4).349
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
16/37
16
Phosphate solubilization activity and presence of hcnAB and phlD genes. The350
relationship between the pqqC phylogeny and the P-solubilization activity and also the351
presence ofhcnAB andphlD genes which are known to be involved in antifungal activity of352
fluorescent pseudomonads was investigated (Table S1). DAPG and PLT producing reference353
strain CHA0 of subgroup 1d and the RW09-C21 isolate of subgroup 1a were the strongest354
phosphate solubilizers (7.25 mm halo size on NBRIP agar plates). Isolate RW09-C25 of355
subgroup 1b exhibited the lowest solubilization activity (1.25 mm halo size). When356
comparing the average solubilization activities of the different phylogenetic groups, the357
highest solubilization activity was found for bacteria of subgroup 1d, with an average halo358
size of 6.74 mm, which was significantly (P value < 0.05) higher than that of the other359
subgroups (Table 3). All other (sub)groups were generally more heterogeneous in their360
solubilization activity and did not differ significantly from one another. Nevertheless,361
subgroup 1g (average halo size = 6.02 mm) also contained some isolates with high362
solubilization properties (Table S1). Among the bacteria isolated from wheat roots only six363
were found to contain thehcnAB genes, five among them also contain thephlD gene and are364
located in subgroup 1d (Table S1).365
366
367
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
17/37
17
DISCUSSION368
This work represents the first study on the phylogeny of a gene involved in the369
pyrroloquinoline quinone (PQQ) biosynthesis in the genus Pseudomonas. We furthermore370
provide data on the frequency and diversity of this gene, pqqC, in a natural Pseudomonas371
rhizosphere population. The development of a Pseudomonas-specific primer pair targeting372
pqqCallowed us to detect the gene by PCR in all tested species ranging from human- and373
plant-pathogenic pseudomonads (P. aeruginosa,P. corrugata andP. syringae) to plant- and374
soil-associated non-pathogenic pseudomonads (P. fluorescens, P. kilonensis, and P. putida)375
and also in all the pseudomonads we have isolated from wheat roots. Overall, this suggests376
thatpqqCis ubiquitous in the genus Pseudomonas. Although PQQ seems to be present also377
in a majority of other bacterial genera, it is not ubiquitous, since especially species and378
strains, that live in anaerobic environments and do not use glucose as carbon source produce379
PQQ-dependent GDH but not the PQQ cofactor, thus the enzyme remains inactive in these380
bacteria (1). In contrast, the majority of the Pseudomonas species are strictly aerobic381
organisms and glucose oxidizers.382
So far, mainly 16S rRNA and a few other housekeeping genes were considered to be383
suitable for studying species phylogeny (43), because they are conserved and ubiquitous384
among genera. Here, we demonstrate the usefulnessofpqqC, a gene which is involved in385
plant-beneficial activities for phylogeny studies in the genusPseudomonas. The pqqCgene386
delineated similar phylogenetic groupsas the concatenated rpoD-gyrB genes (43) when387
considering reference pseudomonads only (Fig. 1), demonstrating that pqqCis conserved. It388
is worth noting, however, that the emplacement of some strains, such as those from subgroup389
1d (with reference strains CHA0 and Pf 5) and group 2 (P. syringae), in the pqqCtree was390
different from that of those in the rpoD, gyrB and rpoD-gyrB trees. Similar findings were391
obtained by de Souza et al. for the topology of the gacA gene, which encodes a global392
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
18/37
18
regulator of secondary metabolites production (6). Interestingly in thepqqCbased trees (Fig.393
1B and Fig. 2B), subgroup 1d was always phylogenetically well separated from the P.394
fluorescens main group 1. The phylogenetic incongruence between the pqqC tree and the395
rpoD-gyrB tree is in accordance with results obtained by Frapolli et al., which showed that396
single-locus topologies of different housekeeping genes were mostly incongruent when397
compared with each other (8). In fact, the addition ofpqqCto the rpoD-gyrB dataset resulted398
in a topology congruent to that of the concatenated rpoD-gyrB tree (Fig. S1). The clear399
demarcation, however, of subgroup 1d strains from other DAPG-producing fluorescent400
pseudomonads observed in other studies based on genetic and phenotypic traits (8, 18, 31) led401
to a comprehensive taxonomic study on CHA0/Pf-5-like strains, for which the name P.402
protegens was suggested (32). In the present study, the phylogenetic analysis of the pqqC403
gene of this species and its greater ability to solubilize phosphate than other strains (see404
below) points to the same conclusion with respect to the particular position of this group405
within the fluorescent pseudomonads.406
Purifying and/or neutral selection are major selective forces acting on housekeeping gene407
codons (8) to remove alleles that are deleterious or to preserve protein functions, respectively.408
Here, purifying selection acting on pqqC (dN/dS = 0.036) was detected when considering409
strains belonging to the major phylogenetic groups of the Pseudomonas genus described by410
Mulet et al. (29). Therefore, it can be assumed that pqqC plays an important role in the411
Pseudomonas genus. However, since pqqCis not constitutively expressed, and its regulation412
depends on environmental factors (42), it cannot substitute for loci commonly used for413
phylogenetic studies, such as 16 rRNA or housekeeping genes, but should be considered as a414
complementary molecular marker. Our results revealed that pqqCis an excellent marker to415
study the diversity of phosphate-solubilizing pseudomonads in rhizosphere populations (Figs.416
2B and S2B). In fact, pqqCpolymorphism found within the Pseudomonas genus was high417
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
19/37
19
enough (nucleotide diversity = 0.145) to ensure a resolving power similar to that obtained418
with rpoD (nucleotide diversity = 0.236) or gyrB (nucleotide diversity = 0.125).419
MoreoverpqqCallowed a clear grouping of DAPG-producing Pseudomonas strain into the420
five multilocus groups A, C, D, E, and F, as defined by Frapolli et al. (8), hence a421
differentiation at the sub-species level (Fig. S3)422
When comparing a cultivation-independent with a cultivation-dependent approach, we423
found that the first allowed the detection of more OTUs and that the proportion ofpqqC424
clones and Pseudomonas isolates per phylogenetic (sub)group was different (Table 3). The425
large majority of non-cultivated bacteria was included in subgroup 1g (with reference strain426
SBW25), whereas the cultivated isolates were more evenly distributed. Interestingly, only427
two out of a total of 108 OTUs were detected by both methods. Our data indicate that the two428
approaches detect different pseudomonads, thereby complementing each other. The429
cultivation-dependent method probably detects bacteria that are present in low numbers and430
thus below the detection limit of the cultivation-independent method but that grow very well431
in liquid culture; so these bacteria are selected for by the cultivation step. This finding is432
supported by other reports indicating that cultivation-dependent methods allow the433
identification of different genotypes than cultivation-independent methods (9, 45). Bobwhite,434
the variety used in this study seems to accumulate pseudomonads of subgroup 1g. For wheat,435
it is known that there is a cultivar-specific preference for certain Pseudomonas groups or436
genotypes. In a previous study we have shown that different wheat cultivars accumulate437
different genotypes of DAPG-producing pseudomonads (27)438
The fact that all analyzed pseudomonads were able to solubilize phosphate on NBRIP and439
that the pqqC gene was always amplified in these strains, suggests the presence of a440
functional PQQ enzyme. Pseudomonas spp. from the subgroup 1d (corresponding to the441
newly described P. protegens) were found to solubilize significantly more phosphate on442
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
20/37
20
NBRIP plates than pseudomonads from other (sub)groups. Similarly, Miller et al. (28)443
identified strains Pf-5 and CHA0 as superior P solubilizers and hypothesised that multiple444
copies ofpqqA and pqqB, confirmed by BLAST analysis of the sequenced genome of Pf-5445
(NC_004129), could lead to increased PQQ and gluconic acid production. Remarkably,446
besides being strong phosphate-solubilizers, the pseudomonads of subgroup 1d are potent447
biocontrol bacteria producing multiple antimicrobial substances such as DAPG, HCN, PLT448
and pyrrolnitrin. Another subgroup harboring many efficient phosphate-solubilizing bacteria449
was subgroup 1g (with reference strain SBW25). There are other studies that have identified450
Pseudomonas strains closely related to SBW25 as strong P-solubilizers (4, 13). For future451
studies, it would be interesting to test strong phosphate solubilizers selected from subgroups452
1d and 1g for efficacy in planta in comparison to strains of other phylogenetic backgrounds.453
In conclusion, we provide strong evidence for the ubiquitous presence of the pqqCgene454
in the genus Pseudomonas. Our results on pqqCdiversity indicate that this gene is conserved455
within the genus Pseudomonas and has a high phylogenetic resolving power comparable to456
that of the widely used gyrB and rpoD genes. pqqC therefore emerges as a novel marker,457
complementary to the conventionally used housekeeping genes, which is suited for458
phylogenetic studies on the genus Pseudomonas and for the analysis of Pseudomonas459
populations in natural habitats.460
461
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
21/37
21
ACKNOWLEDGMENTS462
We thank Andrea Foetzki, Carolin Luginbhl, Michael Winzeler, and other collaborators463
from the Swiss agricultural research station Agroscope Reckenholz-Tnikon ART for464
management of the field experiment and Aria Maya Minder and Tania Torossi from the465
Genetic Diversity Centre, ETH Zrich for technical support. This study was supported by the466
Swiss National Science Foundation (National Research Program NRP59, project 405940-467
115596).468
469
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
22/37
22
REFERENCES470
1. Adamovicz, M., T. Conway, and K. W. Nickerson. 1991. Nutritional471complementation of oxidative glucose metabolism in Escherichia coli via472
pyrroloquinoline quinone-dependent glucose dehydrogenase and the Entner-473
Doudoroff pathway. Appl. Environ. Microbiol. 57:20122015.474
2. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by475lysogenicEscherichia coli. J. Bacteriol. 62:293300.476
3. Brandl, H., S. Lehmann, M. A. Faramarzi, and D. Martinelli. 2008.477Biomobilization of silver, gold, and platinum from solid materials by HCN-forming478
microorganisms. Hydrometallurgy 94:1417.479
4. Browne, P., O. Rice, S. H. Miller, J. Burke, D. N. Dowling, J. P. Morrissey, and480F. OGara.2009.Superior inorganic phosphate solubilization is linked to phylogeny481
within thePseudomonas fluorescens complex. Appl. Soil Ecol. 43:131138.482
5. Choi, O., J. Kim, J. G. Kim, Y. Jeong, J. S. Moon, C. S. Park, and I.Hwang.4832008. Pyrroloquinoline quinone is a plant growth promotion factor produced by484
Pseudomonas fluorescens B16. Plant Physiol. 146:657668.485
6. de Souza, J. T., M. Mazzola, and J. M. Raaijmakers . 2003. Conservation of the486response regulator gene gacA inPseudomonas species. Environ. Microbiol. 5:1328487
1340.488
7. de Werra, P., M. Pechy-Tarr, C. Keel, and M. Maurhofer. 2009. Role of gluconic489acid production in the regulation of biocontrol traits ofPseudomonas fluorescens490
CHA0. Appl. Environ. Microbiol.75:41624174.491
8. Frapolli, M., G. Dfago, and Y. Monne-Loccoz. 2007. Multilocus sequence492analysis of biocontrol fluorescent Pseudomonas spp. producing the antifungal493
compound 2,4-diacetylphloroglucinol. Environ. Microbiol. 9:19391955.494
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
23/37
23
9. Frapolli, M., Y. Monne-Loccoz, J. Meyer, and G. Dfago. 2008. A new DGGE495protocol targeting 2,4-diacetylphloroglucinol biosynthetic gene phlD from496
phylogenetically contrasted biocontrol pseudomonads for assessment of disease-497
suppressive soils. FEMS Microbiol. Ecol. 64:468481.498
10.Gobbin, D., F. Rezzonico, and C. Gessler. 2007. Quantification of the biocontrol499agent Pseudomonas fluorescens Pf153 in soil using a quantitative competitive PCR500
assay unaffected by variability in cell lysis- and DNA-extraction efficiency. Soil Biol.501
Biochem. 39:16091619.502
11.Goldstein, A. H. 1986. Bacterial solubilization of mineralphosphates: historical503perspective and future prospects. Am. J. Alternative Agr. 1:5157.504
12.Guindon, S., F. Lethiec, P. Duroux, and O. Gascuel. 2005. PHYML Onlinea505web server for fast maximum likelihood-based phylogenetic inference. Nucleic Acids506
Res. 33:W557W559.507
13.Gulati, A., P. Rahi, and P. Vyas. 2008. Characterization of phosphate-solubilizing508fluorescent pseudomonads from the rhizosphere of seabuckthorn growing in the cold509
deserts of Himalayas. Curr. Microbiol. 56:7379.510
14.Guo, Y. B., J. Li, L. Li, F. Chen, W. Wu, J. Wang, and H. Wang .2009. Mutations511that disrupt either thepqq or thegdh gene ofRahnella aquatilis abolish the production512
of an antibacterial substance and result in reduced biological control of grapevine513
crown gall. Appl. Environ. Microbiol. 75:67926803.514
15.Haas, D., and G. Dfago. 2005. Biological control of soil-borne pathogens by515fluorescent pseudomonads. Nat. Rev. Microbiol. 3:307319.516
16.Haas, D., and C. Keel. 2003. Regulation of antibiotic production in root-colonizing517Pseudomonas spp. and relevance for biological control of plant disease. Annu. Rev.518
Phytopathol. 41:117153.519
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
24/37
24
17.Han, S. H., C. H. Kim, J. H. Lee, J. Y. Park, S. M. Cho, S. K. Park, K. Y. Kim, H.520B. Krishnan, and Y. C. Kim. 2008. Inactivation ofpqq genes ofEnterobacter521
intermedium 60-2G reduces antifungal activity and induction of systemic resistance.522
FEMS Microbiol. Lett. 282:140146.523
18.Keel, C., D. M. Weller, A. Natsch, G. Dfago, R. J. Cook, and L. S. Thomashow.5241996. Conservation of the 2,4-diacetylphloroglucinol biosynthesis locus among525
fluorescent Pseudomonas strains from diverse geographic locations. Appl. Environ.526
Microbiol. 62:552563.527
19.King, E., M. K. Ward, and D. E. Raney . 1954. Two simple media for the528
demonstration of pyocanin and fluorescin. J. Lab. Clin. Med. 44:301307.529
20.Kosakovsky Pond, S. L., A. F. Y. Poon, and S. D. W. Frost . 2007. Estimating530selection pressures on alignments of coding sequences analyses using HyPhy.531
www.hyphy.org/pubs/hyphybook2007.pdf.532
21.Landa, B. B., J. M. Cachinero-Daz, P. Lemanceau, R. M. Jimnez-Daz, and C.533Alabouvette. 2002. Effect of fusaric acid and phytoanticipins on growth of534
rhizobacteria andFusarium oxysporum. Can. J. Microbiol. 48:971985.535
22.Magnusson, O. T., H. Toyama, M. Saeki, A. Rojas, J. C. Reed, R. C. Liddington,536J. P. Klinman, and R. Schwarzenbacher. 2004. Quinone biogenesis: structure and537
mechanism of PqqC, the final catalyst in the production of pyrroloquinoline quinone.538
Proc. Natl. Acad. Sci. U.S.A. 101:79137918.539
23.Mavrodi, D. V., T. L. Peever, O. V. Mavrodi, J. A. Parejko, J. M. Raaijmakers,540P. Lemanceau, S. Mazurier, L. Heide, W. Blankenfeldt, D. M. Weller, and L. S.541
Thomashow. 2010.Diversity and evolution of the phenazine biosynthesis pathway.542
Appl. Environ. Microbiol. 76:866879.543
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
25/37
25
24.McGowan, S. J., M. Sebaihia, L. E. Porter, G. S. A. B. Stewart, P. Williams, B.544W. Bycroft, and G. P. C. Salmond. 1996. Analysis of bacterial carbapenem545
antibiotic production genes reveals a novel beta-lactam biosynthesis pathway. Mol.546
Microbiol. 22:415426.547
25.McSpadden Gardener, B. B., D. V. Mavrodi, L. S. Thomashow, and D. M.548Weller. 2001. A rapid polymerase chain reaction-based assay characterizing549
rhizosphere populations of 2,4-diacetylphloroglucinol-producing bacteria.550
Phytopathology 91:4454.551
26.Mendes, R., Kruijt, M., de Bruijn, I., Dekkers, E., van der Voort, M., Schneider,552
J. H. M., Piceno, Y. M., DeSantis, T. Z., Andersen G. L., Bakker, P. A. H. M.,553
and J. M. Raaijmakers. 2011. Deciphering the rizosphere microbiome for disease-554
suppressive bacteria. Science 332:10971100.555
27.Meyer, J. B., M. P. Lutz, M. Frapolli, M. Pchy-Tarr, L. Rochat, C. Keel, G.556Dfago, and M. Maurhofer. 2010. Interplay between wheat cultivars, biocontrol557
pseudomonads, and soil. Appl. Environ. Microbiol. 76:61966204.558
28.Miller, S., P. Browne, C. Prigent-Combaret, E. Combes-Meynet, J. Morrissey,559and F. OGara. 2010. Biochemical and genomic comparison of inorganic phosphate560
solubilization inPseudomonas species. Environ. Microbial. Rep. 2:403411.561
29.Mulet, M., J. Lalucat, and E. Garca-Valds. 2010. DNA sequence-based analysis562of thePseudomonas species. Environ. Microbiol. 12:15131530.563
30.Nautiyal, C. S. 1999. An efficient microbiological growth medium for screening564phosphate solubilizing microorganisms. FEMS Microbiol. Lett. 170:265270.565
31.Ramette, A., M. Frapolli, G. Dfago, and Y. Monne-Loccoz. 2003. Phylogeny of566HCN synthase-encoding hcnBCgenes in biocontrol fluorescent pseudomonads and its567
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
26/37
26
relationship with host plant species and HCN synthesis ability. Mol. Plant Microbe568
Interact. 16:525535.569
32.Ramette, A., M. Frapolli, M. Fischer-Le Saux, C. Gruffaz, J. M. Meyer, G.570Dfago, L. Sutra, and Y. Monne-Loccoz. 2011.Pseudomonas protegens sp. nov.,571
widespread plant-protecting bacteria producing the biocontrol compounds 2,4-572
diacetylphloroglucinol and pyoluteorin. Syst. Appl. Microbiol. 34:180188.573
33.Rezzonico, F., G. Dfago, and Y. Monne-Loccoz. 2004. Comparison of ATPase-574encoding type III secretion system hrcN genes in biocontrol fluorescent575
pseudomonads and in phytopathogenic proteobacteria. Appl. Environ. Microbiol.576
70:51195131.577
34.Rozas, J., J. C. Sanchez-DeL Barrio, X. Messeguer, and R. Rozas . 2003. DnaSP,578DNA polymorphism analyses by the coalescent and other methods. Bioinformatics579
19:24962497.580
35.Saitou N., and M. Nei. 1987. The neighbor-joining method: a new method for581reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406425.582
36.Schnider, U., C. Keel, C. Voisard, G. Dfago, and D. Haas . 1995. Tn5-directed583cloning ofpqq genes fromPseudomonas fluorescens CHA0: mutational inactivation584
of the genes results in overproduction of the antibiotic pyoluteorin. Appl. Environ.585
Microbiol. 61:38563864.586
37.Shimodaira, H. and M. Hasegawa. 1999. Multiple comparisons of log-likelihoods587with applications to phylogenetic inference. Mol. Biol. Evol. 16:11141116.588
38.Silby, M. W., et al. 2009. Genomic and genetic analyses of diversity and plant589interactions ofPseudomonas fluorescens. Genome Biol. 10:R51.590
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
27/37
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
28/37
28
FIG. 1. Phylogenetic relationships among 36 Pseudomonas reference strains, including612
known biocontrol strains described in Table 1. The neighbor-joining (NJ) trees were inferred613
from concatenated sequences of the two housekeeping genes rpoD andgyrB (1130 bp) (1A)614
and frompqqC(507 bp) sequences (1B). Only bootstrap values greater than 50% are shown.615
Scale bar = 0.02 substitutions per site. Thin-lined box: P. syringae group, dashed-lined box:616
P. chlororaphis group and thick-lined box: subgroup 1d (containing strains described as P.617
protegens by Ramette et al., (32). Capital letters following the names of DAPG-producing618
strains indicate the multilocus group defined by Frapolli et al. (8).619
620
FIG. 2. Phylogenetic relationships amongPseudomonas reference strains and pseudomonads621
isolated from the rhizosphere of field-grown wheat in this study. The neighbor-joining (NJ)622
trees were inferred from concatenated sequences of the two housekeeping genes rpoD and623
gyrB (1130 bp) (2A) and from pqqC(507 bp) sequences (2B). Only bootstrap values greater624
than 50% are shown. Scale bar = 0.02 substitutions per site. Both trees include sequences of625
36 reference strains and of 136 pseudomonads isolated from wheat roots. Furthermore, the626
pqqC tree (2B) includes additional 107 partial pqqC sequences of non-cultivated bacteria627
(cloned sequences).Pseudomonas isolates are described as follows: the first and the second628
number indicate the number of isolates per OTU (operational taxonomic unit) and the OTU629
number, respectively, while C designates cultivated bacteria. Non-cultivated pseudomonads630
are described by NC preceded by a figure indicating the number of cloned sequences and631
followed by a figure in brackets describing the number of different OTUs identified from632
these sequences. Cultivated and non-cultivated bacteria were obtained from the same wheat633
roots sampled in a Swiss field. Capital letters following the names of reference strains634
indicate the multilocus group defined by Frapolli et al. (8). Font colours indicate phosphate635
solubilization classes on NBRIP medium (based on halo diameter) as described in the636
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
29/37
29
Material and Methods section and correspond to very low (violet), low (dark blue), medium637
(green), or strong (red) activity or not determined (black).638
639
640
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
30/37
30
TABLE 1. Bacterial strains and isolates used in this study641
Bacterial strains Comments Reference
DAPG-producing reference pseudomonads
(A)a: C*1A1, CM1'A2, K93.3, K94.31, P96.25, P97.30,
Q65c-80 b, Q128-87, S8-151, TM1B2(B): F113, K93.2, K94.37, P12, Q37-87
(C): Q2-87, Q7-87, Q12-87, Q86-87
(D): C10-186, C10-190, K93.52, PILH1, PITR2(E): F96.26, P97.1, P97.6, P97.38, F96.27
(F): CHA0, K94.41, PF, Pf-5, PGNL1, PGNR1, S8-62
(-): P97.26
Biocontrol8, 18
Reference pseudomonads, not producing DAPG
P. aeruginosa PAO1 T (LMG12228 T)Human pathogen,
biocontrol, type strainBCCM c
P. caricapapayae LMG2152 TPlant pathogen, type
strainBCCM
P. chlororaphis 30-84 Biocontrol 23P. chlororaphis DTR133 Soil bacterium 21
P. chlororaphis LMG1245 T Type strain BCCM
P. chlororaphis LMG5004 T Type strain BCCM
P. corrugata LMG2172 TPlant pathogen, type
strainBCCM
P. fluorescens 2-79 Biocontrol 23
P. fluorescens DSS73 Biocontrol C. Keel (UNIL) c
P. fluorescens KD Biocontrol 33
P. fluorescens LMG1794 T Type strain BCCM
P. fluorescens MIACH Soil bacterium This study
P. fluorescens GUGO Soil bacterium This study
P. fluorescens Pf0-1 Soil bacterium 38
P. fluorescens SBW25 Biocontrol 38
P. kilonensis 520-20T
(DSM13647T
) Type strain DMSZc
P. plecoglossicida PCPF1 Soil bacterium 3
P. putida LMG2257 T Type strain BCCM
P. putida P3 Soil bacterium C. Keel (UNIL)
P. rhizospherae IH5 T (LMG21640 T) Type strain BCCM
Non-Pseudomonas bacteria
Agrobacterium tumefaciens Plant pathogen C. Keel (UNIL)
Bacillus mycoides A23 Not documented 10
Burkholderia cepacia Biocontrol C. Keel (UNIL)
Cupriavidus necatorJMP134 (LMG1197) Biodegradation BCCM
Escherichia coli DH5 Laboratory strainInvitrogen, Carlsbad,
CA, USA
Erwinia carotovora ATTn10 Plant pathogen 24
Photorhabdus luminescens TT01T (DSM15139 T) Insect pathogen, typestrain DMSZ
Rhodococcus sp. strain C125 (DSM44236) Biodegradation DMSZ
Sphingomonas herbicidovorans MHT (DSM11019 T)Biodegradation, type
strainDMSZ
Sphingobium japonicum UT26T (DSM16413T)Biodegradation, typestrain
DMSZ
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
31/37
31
Streptomyces scabies Sy9103 Plant pathogen C. Beaulieu (UdeS) c
Xanthomonas campestris LMG568TPlant pathogen, type
strainBCCM
Pseudomonas wheat root isolates
140 isolates representing 34 OTUs (see Fig. 2) described
as RW09-C1.x to RW09-C34.x (Table S1) where x standsfor the isolate number
Soil bacteria This study
a Letters in brackets indicate the multilocus group of DAPG-producing pseudomonad as defined by Frapolli et642
al. (8).643
b Underlined strains were included in the phylogenetic analysis presented in Figs. 1, 2 as well as Figs. S1 and644
S2 (supplemental material).645
c Abbreviations. BCCM: Belgian Co-ordinated Collections of Microorganisms. DSMZ: Deutsche Sammlung646
von Mikroorganismen und Zellkulturen GmbH..UNIL = University of Lausanne, Switzerland. UdeS: University647
of Sherbrooke, Canada.648
649
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
32/37
32
TABLE 2. Primers used in this study650
Gene product Primer sequence (5-3)Primer
name
Annealing
temperature (C)
Product
length (bp)
Target
geneReference
Pyrroloquinoline
quinone (PQQ)
oxidase
CAGGGCTGGGTCGCCAACC
CATGGCATCGAGCATGCTCC
pqqCf1
pqqCr163 546 pqqC This study
DNA gyrase subunit BTTCAGCTGGGACATCCTGGCCAA
TCGATCATCTTGCCGACRACCA
gyrBf
gyrBr265 584-587 gyrB 8
RNA polymerase
subunit D
ACTTCCCTGGCACGGTTGACCA
TCGACATGCGACGGTTGATGTC
rpoDf
rpoDr60 693-696 rpoD 8
Phenazine biosynthetic
enzyme
ATCTTCACCCCGGTCAACG
CCRTAGGCCGGTGAGAAC
Ps_up1
Ps_low157 427 phzF 23
2,4-DAPG type III
polyketide synthase
ACCCACCGCAGCATCGTTTATGAGC
CCGCCGGTATGGAAGATGAAAAAGTC
B2BF
BPR460 629 phlD 25
Hydrogen cyanide
biosynthetic enzymes
TGCGGCATGGGCGTGTGCCATTGCTGCCTGG
CCGCTCTTGATCTGCAATTGCAGGCC
PM2
PM7-26R 67 570 hcnAB 40
651
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
33/37
33
TABLE 3. Distribution ofpqqC sequences derived from cultivated and non-cultivated (cloned652
sequences) pseudomonads obtained from wheat roots among the phylogenetic groups defined in Fig.653
2 and phosphate solubilization activity of different phylogenetic groups654
Pseudomonas phylogenetic groups as defined in Fig. 2 Percentage of bacteria per
phylogenetic (sub)groupsa
P-solubilization
activity b
Main group Subgroup Cultivated
(C) bacteria
Non-cultivated
(NC) bacteria
Halo diameter (mm)
1.P. fluorescens
group
1a DAPG producers,
P. kilonensis andP.
corrugata
1 0 5.80 0.11 (n = 23) c
1b ContainingP.fluorescens Pf0-1
34 4 5.52 0.27 (n = 10)
1c P. chlororaphis 0 0 5.70 0.24 (n = 3)
1d DAPG and PLT
producers
4 0 6.74 0.17 (n = 7)* d
1e Wheat isolates
from this study
12 6 5.64 0.57 (n = 3)
1f ContainingP.
fluorescens 2-79
19 0 5.91 0.37 (n = 6)
1g ContainingP.
fluorescens SBW25
29 84 6.02 0.11 (n = 12)
1h Non-cultivated
bacteria from this
study
0 4 -
2.P. syringae 0 0 6.50 0.18 (n = 1)
3.P. putida 1 0 5.96 0.18 (n = 5)
4.P. aeruginosa,
P. mendocina and
P. stutzeri
0 0 5.80 0.22 (n = 2)
5. Non-cultivated
bacteria from this
study
0 1 -
6. Non-cultivated
bacteria from this
study
0 1 -
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
34/37
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
35/37
35
TABLE 4. GC content, nucleotide diversity () and non-synonymous (dN) to synonymous (dS)662
substitution rates of pqqC, gyrB and rpoD sequences among the Pseudomonas genus and663
pseudomonads from wheat roots.664
Group Gene GC % b dN/dS c
Pseudomonas genus (n=19) a pqqC 65.5 0.145 0.036
Pseudomonas genus (n=19) gyrB 56.3 0.125 0.035
Pseudomonas genus (n=19) rpoD 62.4 0.236 0.250
Pseudomonads representing a wheat
root population (n=106)
pqqC 64.2 0.097 0.044
665
a n, number of analyzed sequences. Pseudomonas genus (pqqC, gyrB and rpoD): six strains of the phylogenetic P.666
fluorescens group 1 (LMG2172, Pf0-1, 30-84, CHA0, 2-79, SBW25), four strains of theP. syringae group 2 (LMG2152,667
DC3000, B728a, 140BA), five strains of theP. putida group 3 (P3, GB1, W619, KT2440, L48) and four strains of the P.668
aeruginosa group 4 (PAO1, UCBPP-PA14, ymp, A1501). Pseudomonas spp. from wheat roots (onlypqqC): 30 RW09669
isolates and 76 clonedpqqCsequences all representing different OTUs.670
b, nucleotide diversity per site.671
c dS, number of synonymous substitutions per site; dN, number of non-synonymous substitutions per site.672
673
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
36/37
7/29/2019 Appl. Environ. Microbiol. 2011 Meyer AEM.05434 11
37/37