Post on 21-Oct-2019
66
with A. hydrophila biofilm with increased antibody production and protection in three
species of Indian major carps.
The antigenic diversity of A. hydrophila has posed a great difficulty in developing a
vaccine, and at present, no vaccine for protection against A. hydrophila is commercially
available. In this situation, the search for common protective antigens of A. hydrophila
becomes critical for developing a common vaccine against this bacterium. One of the
potential candidates of conserved antigens is the outer membrane component of this
bacterium which is involved in the adherence and invasion of fish. Fang et al. (2000)
characterized a 43Kda adhesin which could provide protective immunity to fish (blue
gourami) against A. hydrophila and Vibrio spp. in vivo. Rekha et al. (2007) immunized
Indian major carp, Labeo rohita Hamilton using a purified 37 kDa temperature sensitive
OMP (OMP TS) of A. hydrophila. The protein induced antibodies with mean titers of
1:4000 on day 14 and 1:12,000 on day 28 indicating that the protein is highly immunogenic
in fish and that the gene is a potential candidate for vaccine development.
III. MATERIALS AND METHODS
3.1. Isolation and identification of A. hydrophila
The isolates used in the study were obtained from diseased and moribund
freshwater fish (Labeo rohitha) exhibiting tail rot and fin rot. The generic level
identification of Aeromonas group was performed as per the scheme proposed by Bain
& Shewan (1968) Le Chevallier et al., (1980) (Fig. 1 & 2).
The species level differentiation of A. hydrophila from other Aeromonas spp was
carried out as previously described by and and Popoff & Lallier (1984), Abbott et al
(2003) and Martin-Carnahan and Joseph (2005) (Table 8). All these cultures were
67
routinely maintained in tryptic soya broth (TSB) or on tryptic soya agar (TSA) at 37
ºC and stock cultures were kept in a suspension of TSB with 30% glycerol and stored
at -80ºC.
Tryptone soya broth (TSB)
Tryptone 17.0 g
Soya peptone 3.0 g
Sodium chloride 5.0 g
Dipotassium phosphate 2.5 g
Distilled water 1L
Final pH 7.2+0.2
The ingredients were dissolved in distilled water, dispensed into tubes and flasks
according to the volume required and sterilized by autoclaving at 121 ºC for 15min.
Tryptone soya agar (TSA)
Tryptone 15.0 g
Soya peptone : 5.0 g
Sodium chloride : 5.0 g
Agar : 15.0 g
Distilled water: 1L
Final pH : 7.2+0.2
The ingredients were dissolved in distilled water, sterilized by autoclaving at 121 ºC for
15 min and poured into plates.
Isolation and identification of aeromonads is done by carrying out a series of
biochemical tests as described by Bain and Shewan (1968), Holding and Collen (1971)
and MacFaddin (1990).
3.1.1. Gram staining
68
Huckers modification of Gram staining was followed. The stained smears were
observed under oil immersion objective to record the Gram reaction and only Gram
negative isolates were further proceeded with.
Crystal Violet
Solution A
Crystal violet 2.0 g
Ethanol (95%) 20.0 ml
Solution B
Ammonium oxalate 0.2 g
Distilled water 20.0 ml
Solution A was diluted 10 fold with distilled water and mixed with equal volume of
solution B, filtered and stored.
Lugols Iodine
Iodine crystals 1.0 g
Potassium iodide 2.0 g
Distilled water 300 ml
Iodine crystals and potassium iodide were mixed and dissolved in distilled water,
filtered and stored in a amber coloured bottle.
Safranin (Counter Stain)
Safranin 2.5 g
Ethanol(95%) 100 ml
Safranin was added to 100ml ethanol to prepare the stock solution. To get the working
solution, 10ml of the alcoholic solution was diluted with 90ml distilled water.
3.1.2. Motility test
16- 18 h cultures of the isolates grown in tryptone soya broth were tested for
motility by hanging drop technique, using cavity slide. Only actively motile isolates
were proceeded with for further biochemical tests.
69
3.1.3. Oxidation - Fermentation (O/F) test
Hugh and Leifson’s O/F medium
Peptone : 2.0 g
Yeast extract : 5.0 g
Sodium chloride : 5.0 g
Glucose : 10.0 g
Bromocresol purple : 0.016g
Agar : 3.0 g
Distilled water : 1 L
Final pH : 7.2±0.1
Liquid paraffin
Liquid paraffin was sterilized at 180 ºC for 1 h in a hot air oven.
Bromocresol purple (1.6%)
Bromocresol purple : 1.6 g
Ethyl alcohol (95%) : 50 ml
Distilled Water : 50 ml
Bromocresol purple was first dissolved in 95% ethyl alcohol followed by the addition
of 50 ml distilled water. The solution was filtered to remove any suspended particles
and stored.
The ingredients were dissolved in distilled water by boiling and dispensed into
tubes so as to get one and half inch butt and sterilized by autoclaving at 110 ºC for 15
min.
70
The culture to be tested was stabbed into the butts of two tubes containing
Hugh and Leifson’s O/F medium. One of the tubes was overlaid with sterile liquid
paraffin. Reactions were recorded after 48 h of incubation at 30 ºC as fermentative if
both the tubes turned yellow. Isolates which were fermentative were recorded and
proceeded with.
3.1.4. Cytochrome oxidase test (Holding and Collen, 1971)
Oxidase reagent strips
Oxidase Reagent 0.1 g
(NNN-N'- Tetramethyl p-phenylene diamine dihydrochloride) (Sigma Chemicals,
USA) :
Distilled water: 10.0 ml
Whatman No.1 filter paper was cut into strips of 2.5 cm x 1.0 cm, dipped in the
reagent, dried and stored in dark bottles at 4 ºC.
Young culture (18h old) on TSA slants were picked up using a platinum wire
loop and spotted onto pre-moistened oxidase strips. Development of a dark purple
color within 10sec was recorded as positive. Only oxidase positive isolates were
proceeded with.
3.1.5. Sensitivity to O/129 compound (Bain and Shewan, 1968)
O/129 Discs
O/129 Compound 15.0 g
(2,4- diamino 6,7- di-isopropyl pteridine) (Sigma Chemicals, USA)
Acetone: 1.0 ml
O/129 compound was dissolved in acetone. Hundred numbers of filter paper
discs, each of 6.5 mm in diameter (pre-sterilized at 140 ºC for 1h), were soaked in this
71
solution; so that, each disc contained a concentration of 150 mg of the compound. The
discs were then dried in an incubator and stored at 4 ºC.
A young culture (18h old) of test organism was spread on a sector of TSA plate
and O/129 discs placed over it. The plates were incubated for 24 h at 30 ºC. A uniform
growth with no zone of inhibition around the disc was recorded as resistant to
pteridine compound. O/129 resistant isolates were proceeded with.
3.1.6. Triple sugar iron (TSI) reaction (McFaddin, 1980)
Triple sugar iron (TSI) agar (Hi Media, Mumbai)
The dehydrated media was suspended in distilled water (65.0 g in 1L) and
dissolved by boiling and distributed into tubes in 5.0 ml volumes. Tubes were sterilized
by autoclaving at 110 ºC for 15 min and allowed to set at an angle to have both butt
and slant.
Cultures to be tested were inoculated to TSI agar tubes by stabbing the butt
and streaking the slant surface. Tubes were incubated at 30 ºC for 18 to 24 h and
observed for the typical reaction of acid butt (yellow color) and alkaline slants (pink
color). Cultures showing an acid butt and an alkaline slant, with gas production and
blackening (H2S production) were further proceeded with.
3.1.7. Amino acid decarboxylase test
Basal medium for amino acid decarboxylase test
Peptone : 5.0 g
Yeast extract : 3.0 g
Sodium chloride : 5.0 g
Glucose : 1.0 g
Bromocresol purple : 0.016g
Distilled water : 1L
Final pH : 7.2+0.1
72
The basal medium was divided into four portions and the amino acids, viz. L-
lysine monohydrochloride, L-ornithine monohydrochloride and L- agrinine
monohydrochloride were added individually to each part at a concentration of 0.5, 0.5
and 0.4% respectively. The fourth portion served as control without any amino acid.
The media were distributed into tubes in 4.0 ml volumes and sterilized by autoclaving
at 110 ºC for 15 min.
A young broth culture (18 h old) was inoculated to each of the four tubes:
control, lysine, ornithine, arginine and overlaid with sterile liquid paraffin. The tubes
were incubated at 30 ºC for 3 to 4 days and results recorded. A positive reaction was
recorded as yellow coloration in the control tube while the amino acid containing tubes
turned yellow and returned to purple. Isolates that gave positive reaction for lysin and
arginine and negative for ornithine were proceeded with.
3.1.8. Sugar fermentation test (McFaddin, 1980)
Sugar fermentation medium
Peptone 10.0 g
Sodium chloride 5.0 g
Sugars 10.0 g
Bromocresol purple 0.016 g
Distilled water 1L
Final pH 7.2 ±0.1
The ingredients were dissolved in distilled water and dispensed into tubes
containing 4 ml each with Durham's tube and sterilized by autoclaving at 110 ºC for 15
min. The sugars used in this study were glucose, sucrose, lactose, arabinose, salicin,
The fermentation of the sugars was studied by inoculating the medium with a young
culture, incubating at 30 ºC for 24 h and recording results as change in the color of the
73
medium from purple to yellow. Isolates that fermented glucose, sucrose, lactose,
arabinose and salicin were proceeded with.
3.1.9. Catalase test (MacFaddin, 1980)
Young cultures of the isolates were placed in a drop of 3%v/v hydrogen
peroxide taken in a tile, release of oxygen observed as effervescence was recorded as
positive reaction. Catalase positive isolates were proceeded with.
3.1.10. Indole test (MacFaddin, 1980)
Tryptophan broth
Tryptophan 10.0 g
Sodium chloride 10.0 g
Distilled water 1L
pH 7.1
This medium was distributed in small test tubes in 2.5 ml volume and autoclaved at
121 ºC for 15 min.
Kovacs Reagent
p- dimethyl amino benaldehyde (DMAB) 5.0 g
Amyl alcohol 75 ml
Concentrated Hydrochloric acid 25 ml
DMAB was dissolved in amyl alcohol and then the conc. HCL was added slowly. The
solution was stored and used to perform the test whenever required The isolates were
grown in tryptone broth for 24-48 h and a few drops of Kovacs reagent was added.
Formation if a pink indole ring floating in the surface of the broth was recorded as a
positive reaction. Indole positive isolates were proceeded with.
3.1.11. Methyl Red (MR) test (MacFaddin, 1980)
MR-VP broth
Peptone : 5.0 g
74
Dipotassium hydrogen Phosphate (K2HPO4) : 5.0 g
Sodium Chloride : 5.0 g
Glucose : 5.0 g
Distilled water : 1L
Final pH : 7.2±0.1
The ingredients were dissolved in distilled water and dispensed into 5.0 ml volume into
tubes and sterilized by autoclaving at 110 ºC for 15 min.
Reagents for Methyl Red (MR) test
Methyl red : 0.1 g
Ethyl alcohol : 300 ml
Distilled water : 200 ml
Methyl red was first dissolved in ethyl alcohol and the volume was then made upto 500
ml using distilled water.
The break down of glucose to acidic end-product by the bacteria in MR - VP broth
culture was tested after growing bacteria at 30 ºC for 48 to 72 h by adding a few drops
of alcoholic methyl red indicator. Development of a pink to red color was recorded as
positive. MR positive cultures were proceeded with.
3.1.12. Voges – Proskauer (VP) test (MacFaddin, 1980)
Reagents for Voges - Proskauer (VP) test
Solution A:
α - Naphthol : 5.0 g
Ethyl alcohol : 100 ml
Solution B:
Potassium hydroxide : 40.0 g
75
Distilled water : 100 ml
The production of neutral end products like acetyl methyl carbinol (acetoin) from
glucose by the bacteria was tested by growing the organism in 5.0ml of MR - VP broth
at 30 ºC for 48 to 72 h and adding VP reagents consisting of solution A (0.6 ml) and
solution B (0.2 ml). Development of a port wine colour was recorded as positive. VP
positive isolates were proceeded with.
3.1.13. Aesculin hydrolysis (MacFaddin, 1980)
Aesculin agar
Peptone : 5.0 g
Beef extract : 3.0 g
Sodium Chloride : 5.0 g
Aesculin : 1.0 g
Ferric citrate : 0.5 g
Agar : 15.0 g
Distilled water : 1L
Final pH : 7.2+0.1
The medium was boiled to dissolve the ingredients, sterilized by autoclaving 110 ºC for
15 min and poured into sterilized petriplates.
The ability of some aeromonads to hydrolyze the glycoside aesculin to aesculetin and
glucose was studied by spot inoculating the cultures on the surface of aesculin agar
plates and incubating at 30 ºC for 48 h. Appearance of black to dark brown zone
around the spot indicated positive reaction. Isolates that were positive for this test
were proceeded with.
3.2. SDS-polyacrylamide gel electrophoresis
Proteins of A. hydrophila were analysed by the method of Laemmli (1970) using SDS-
PAGE with some modifications. All 16 isolates of A. hydrophila including environmental
76
and clinical along with other Aeromonas sp viz A. caviae, A. veronii, A. trota, A. sobria, A.
schubertii, A. jandaei were anlalysed for their whole cell protein profile. Two
environmental isolates (Ah68, G49), two clinical isolates (AhF0002, AhF12044) of A.
hydrophila, A. veronii, A. sobria, A. caviae GB912, A. trota F06662 were analysed for the
outer membrane proterin profile.
3.2.1. Sample preparation for SDS-PAGE
3.2.1.1. For whole cell protein profile
The whole cell lysate of A. hydrophila in the study were prepared as per the method
described by Chanphog and Sirirat (1997). 1.5 ml of an overnight culture of the organism in
brain heart infusion broth was centrifuged at 10000 rpm for 10 min at 4ºC. The pellet was
resuspended in 1ml of 20 mM Tris HCl buffer (pH 7.2) and centrifuged at 2000x g for 10
min at 4ºC. The process of washing and centrifugation was repeated twice. The pellet was
suspended in 50 µl of sample buffer and heated at 95ºC for 10 min and them stored at -20ºC
for further studies.
3.2.1.2. For outer membrane protein profile
OMP was prepared as per Rahman et al. (1999) with slight modifications.
A. hydrophila was cultured in 25 ml Brain heart infusion broth (Himedia) at 37ºC for 24 h,
then cells were harvested by centrifugation at 3000xgfor 20 min. Cells of A. hydrophila was
washed twice in PBS and once in Tris–HCl (pH 7·5) by centrifugation at 3000xg for 20
min. Cells were resuspended in Tris–HCI and sonicated at 50-W for 30-s, four times on ice.
The suspension was centrifuged at 30000xg for 90 min. The pellet was mixed with 500µl of
2% Sarkosyl in Tris–HCI for solubilisation of the inner membrane and incubated at 4º C for
overnight. The suspension was centrifuged at 45000xg for 2 h to harvest the outer
77
membrane protein. The OMP were resuspended in distilled water and analysed by SDS-
PAGE.
The various buffers and reagents used for SDS PAGE are as follows:
a) Acrylamide-bisacrylamide mixture
Twenty nine grams of acrylamide and 1.0 g of bisacrylamide (N, N’-methylene
bisacrylamide) were dissolved in 80 ml of distilled water. The volume was made up to
100 ml and stored at 4 ºC.
b) Separating gel buffer (1.5 M Tris-Cl, pH-8.8)
181.7 g of Tris base was dissolved in 800 ml of distilled water and pH was
adjusted using concentrated HCl. Then final volume was made up to 1 liter with
distilled water and stored at 4 ºC.
c) Stacking gel buffer (1 M Tris-HCl, pH-6.8)
121.1 g of Tris base was dissolved in 800 ml of distilled water and pH was
adjusted using concentrated HCl. Then final volume was made up to 1 liter with
distilled water and stored at 4 ºC.
d) 10 % sodium dodecyl sulphate (SDS) solution
10 g of SDS was dissolved in 100 ml of distilled water and stored at room temperature.
e) 10% ammonium persulfate (APS) solution
1 g of APS was dissolved in 10 ml of the distilled water and stored at 4 ºC temperature.
APS decomposes slowly and hence fresh solution was prepared after one week.
f) N,N,N’,N’-tetramethylethylenediamine (TEMED)
78
Electrophoresis grade TEMED (Bangalore Genei, Bangalore) stored at 4oC was
used.
g) Electrode buffer ( 5 solution)
5 stock solution was prepared by dissolving 15.1 g of Tris base, 94 g of
glycine (electrophoresis grade) in 900 ml distilled water and then 50 ml of 10 % SDS
solution of electrophoresis grade was added and the final volume was completed to 1
liter with distilled water and stored at room temperature. For running the gel, 1X buffer
was prepared using 5 electrode buffer.
h) SDS gel loading buffer (2)
2 gel loading buffer contained 100 mM Tris-Cl (pH 6.8); 4% (w/v) SDS; 20%
(v/v) glycerol; 0.1% (w/v) bromophenol blue; 200 mM β-mercaptoethanol. Gel loading
buffer lacking thiol reagent was stored at room temperature. 200 mM β-
mercaptoethanol was added to buffer from 14 M stock mercaptoethanol just before use.
i) Staining solution
2.5 g of Coomassie Brilliant blue R250 (HiMedia, Mumbai), 450 ml of
methanol and 100 ml of acetic acid were mixed, filtered and volume was made to 1
liter with distilled water. Solution was stored at room temperature.
j) Destaining solution
300 ml of methanol and 100 ml of acetic acid mixed with distilled water and
completed to 1 liter with distilled water. Solution was stored at room temperature.
k) Standard protein molecular weight marker
79
A medium-range protein molecular weight marker ((PMW-M) Bangalore
Genei, Bangalore) was used for determination of molecular weights of desired protein.
The molecular weight protein standards included phosphorylase b (97,000 Da), bovine
serum albumin (66,000 Da), ovalbumin (43,000 Da), carbonic anhydrase (29,000 Da),
soyabean trypsin inhibitor (20,100 Da) and lysozyme (14,300 Da).
3.2.2. Preparation of SDS-PAGE apparatus (Sambrook et al., 1989)
Depending on the proteins to be separated, 10-15% resolving gel and 5% stacking
gels were used in this study. Glass plates were rinsed by absolute alcohol and cleaned
using tissue paper. Spacers (1 mm) were placed on both sides between two plates in such a
way that any bubbles could not move through that and seated in stand and checked by
water. 10-15% resolving gel was prepared and poured up to 3\4 portion, and kept for
solidification. After solidification, 5% stacking gel was prepared, poured and 1 mm comb
was inserted into the staking gel. Gel was allowed to solidify. Comb was removed and the
solidified gel with plates was fixed in gel running apparatus. Gel running tank was filled
with 1x electrode buffer and samples were loaded into wells. Samples were resolved by
applying constant current of 20 mA for 2 hr. After electrophoresis, the gel was transferred to
a clean container and stained overnight at room temperature with shaking. After staining,
the gel was destained using destaining solution until a clear background was obtained.
Photographs of the gels were taken with Herolab gel documentation system (Germany). The
photographs were scanned and the profiles of each lane transferred to a densitometry
interface in the GelCompare II version 2.5 (Applied Maths, Sint-Martens-Latem, Belgium),
and the exact position of the protein peaks were determined.
80
Resolving gel mixture was prepared in a small beaker with a magnetic stirrer by
mixing the components for a desired concentration of acrylamide according to the following
chart (Harlow and Lane, 1998).
Preparation of resolving gels (pH 8.8) (Sambrook et al., 1989)
12% gel 15% gel Solution component
Component volumes (ml) Component Volumes (ml)
Total volume 5.0 10.0 5.0 10.0
Deionised water 1.7 3.3 1.2 2.3
30% acrylamide mix 2.0 4.0 2.5 5.0
1.5 M Tris-HCl pH 8.8 1.3 2.5 1.3 2.5
10% (w/v) SDS 0.05 0.1 0.05 0.1
10 % (w/v) APS 0.05 0.1 0.05 0.1
TEMED 0.002 0.004 0.002 0.004
81
Preparation of stacking gels (pH 6.8) (Sambrook et al., 1989)
Component 1 ml 3 ml 5 ml 8 ml 10 ml
H20 0.68 2.1 3.4 5.5 6.8
30% Acrylamide Mix 0.17 0.5 0.83 1.3 1.7
1.0 M Tris (pH-6.8) 0.13 0.38 0.63 1.0 1.25
10% SDS 0.01 0.03 0.05 0.08 0.1
10% APS 0.01 0.03 0.05 0.08 0.1
TEMED 0.001 0.003 0.005 0.008 0.01
For preparation of resolving gel, immediately upon addition of APS and TEMED,
the solution was poured into the assembled plates and overlaid with isobutanol to prevent
diffusion of oxygen into the gel and for obtaining a uniform margin of the gel. It was
allowed to polymerize for about 15 min.
In a similar manner, stacking gel mixture with 5% acrylamide mix was prepared by
mixing the components as give above.
3.3. Cloning and expression of outer membrane proteins
3.3.1. Preparation of crude bacterial cell lysates
Test cultures were grown overnight in 3ml Luria Bertani broth (HiMedia,
Mumbai) and centrifuged at 10,000g for 10min. The resultant pellet was washed twice
in sterile distilled water, resuspended in 100μl sterile distilled water and heated to
95oC for 15min in a hot bath. The tubes were then kept in ice for rapid release of DNA.
82
The cell debris was settled by centrifugation at 10,000g for 10 min and the supernatant
used for PCR. The cell lysates were stored at -20C till further use.
3.3.2. Genomic DNA extraction from the isolates
Genomic DNA was extracted from A. hydrophila strains using Cetyl trimethyl
ammonium bromide lysis method of Ausubel et al., (1992). Briefly, the strains were
grown in Luria Bertain broth (LB) over night with shaking. A 1.5ml of the culture was
centrifuged at 10000 rpm for 10 min and the pellet was re-suspended in TE buffer,
Sodium dodecyl sulfate and proteinase k were added and incubated for 1h. Following
this CTAB-NaCl digestion was performed and the mixture was extracted twice with
phenol: chloroform: isoamyl alcohol. DNA was precipitated using isopropanol, washed
with 70% ethanol dissolved finally in TE (Tris- EDTA; pH 8.0) buffer.
Estimation of DNA concentration in the solution after elution
Spectrophotometeric method was used for determination of the concentration
of DNA. Quantification of the DNA was determined by checking the absorbance of the
suitably diluted solution at 260 nm. An OD of 1 corresponded to approximately 50
μg/ml of double stranded DNA. The ratio of absorbance at 260 and 280 was used as an
indicator of purity of DNA. The integrity of the genomic DNA was checked by
electrophoresis of genomic DNA in 0.7% agarose gel. A single band of high molecular
weight range indicates good quality DNA that is not sheared.
3.3.3. Designing of primers and application of different outer membrane proteins
genes of A. hydrophila
Gene sequences of two outer membrane proteins of A. hydrophila namely, ompW
and omp48 gene of A. veronii were retrieved from Genbank database for designing of
83
primers for amplification of these genes. The primers to amplify the whole gene as well
gene excluding the signal peptide were synthesized, by Bioserve, Hyderabad. These primers
were tested on all 16 isolates of A. hydrophila and other Aeromonas sp viz; A. caviae, A.
veronii, A. trota, A. sobria, A. schubertii, A. jandaei.
The amplification of the OMP genes was performed in a programmable
thermocycler (M J Research, USA). PCR was carried out in 30 l reaction mixture
containing 2.0 l template DNA, 1assay buffer (10 mM Tris-HCl, pH 9.0; 1.5 mM
MgCl2, 50 mM KCl, 0.01% Gelatin), 200 M of each deoxyribonucleotide triphosphates, 10
pmol of each of forward and reverse primers and 1 U of Taq DNA polymerase (Bangalore
Genei, Bangalore). The optimized PCR programme consisted of initial denaturation at 95ºC
for 5 min, followed by 30 cycles of 1 min denaturation at 95ºC, 1 min annealing at
respective annealing temperatures shown in Table 3, 1 min extention at 72ºC. The final
extension was performed at 72ºC for 10 min. OMP genes with their Genbank accession
number, primer sequence, annealing temperature and expected amplicon sizes, and cloning
vector used for cloning the PCR products are given in Table 9.
The PCR products were detected by agarose gel electrophoresis. 1-1.2% (w/v)
agarose gels were prepared in 1 TAE buffer. The molten agarose was cooled to below
65ºC, ethidium bromide was added to a final concentration of 0.5 g/ml, mixed and
poured to gel mould and allowed to set. 10 l of the PCR products were mixed with 4
l of 6 loading buffer and loaded into the wells. 1 kb or 100 bp DNA ladder
(Bangalore Genei, Bangalore) was used as a molecular weight marker. Electrophoresis
was carried out at 100-120 V and the bands were visualized under UV
transilluminator (Herolab, Germany).
84
TAE (Tris acetate EDTA) buffer (50)
Tris base 242 g
Glacial acetic acid 57 ml
0.5M EDTA (pH 8.0) 100 ml
The solution was made up to a final volume of 1 liter with distilled water. The
working solution (1000 ml of 1 TAE) was prepared by diluting 20 ml of 50 stock
solution to 1000 ml with distilled water.
Sample loading buffer (6x)
Bromophenol blue 0.25 g
Sucrose 40 g
Distilled water: 100 ml
Ethidium bromide (Sigma, U.S.A.)
A stock solution was prepared by dissolving 5 mg of ethidium bromide in 1 ml of
distilled water. The solution was either added to agarose gel during preparation or to the
appropriate buffer (1TAE buffer) to yield a final concentration of 0.5 g/ml. In the
latter case, the gel was allowed to stain in the solution for 20 min and destained in
distilled water for 10 min to remove excess stain.
Table 9. Primers used in this study
Protein Accession number
PCR product size (bp)
Anneling temp. (ºC)
ExpressionVector used
Primer sequences
OMP48 AF538866 1305 50 pRSET B
F(1)5’ tcctctcagcgggaataagga
R5’ ttaccaccaagcttccgcttg 3’
85
OMPW ABK37420.1 612
552 52 pQE30 UA
F(1)5’ atgaaaaagatccttcctct
3’
F(2)5’ caccaggctggtgatattct
3’
R5’ tcagaagcgatagccgacac 3’
F1: Forward primer for amplification of the whole gene.
F2: Forward primer for amplification of the gene excluding the signal peptide
R: Reverse primer for the amplification of the gene
86
Aeromonas hydrophila
DNA extraction
PCR amplification of desired genes by gene specific primer
Purification of PCR product
Ligation of purified PCR product in cloning vector
pRSET B(or) pQE30 UA vector
Transformation into BL21(DE3)pLysS(or) SG13009 competent cells
Screening of positive clone by PCR (gene specific primer)
Expression of recombinant protein
Purification of recombinant protein
Flow chart 1: Cloning, expression and purification of different outer membrane
proteins of A. hydrophila.
3.3.5. Purification of PCR products
87
The omp 48 and omp W genes were PCR amplified in bulk (100 l) using the
primers and conditions as mentioned above. The PCR products were purified before
ligation to remove contaminants like Taq DNA polymerase, primer dimers, remaining
dNTPs which may interfere with subsequent processes, using QIAquick PCR purification
kit (Qiagen).
To one volume of the PCR product, 5 volume of buffer PB was added and mixed
and then transferred to QIAquick spin column placed in a 2 ml collection tube. The flow
through was discarded after centrifugation at 10,000 g for 1 min, washed by adding 0.75
ml buffer PE containing ethanol followed by centrifugation at 10,000 g for 1 min. The
DNA was eluted by adding 50 l of elution buffer (10 mM Tris-Cl, pH 8.5) or distilled
water to the QIAquick column placed in a fresh microcentrifuge tube and collected by
centrifuging the column at 10,000 g for 1 min (Fig 3).
Fig. 3 Purification of PCR products using QIAquick spin column
3.3.6.1 Ligation of omp 48 gene PCR product into the expression vector
88
The ligation reactions using expression vectors were carried out according to the
manufacturer’s protocols. The expression vector used was pRSET B (Fig 4, Invitrogen,
USA).
Fig. 4. Vector used in this study- pRSET B vector (Invitrogen, USA)
The omp48 gene product was cloned into the pRSET B expression vector
(Invitrogen, USA), using Pst I at 37 bp and Hind III at 1269 bp from the start codon at 5’
and at 3’ respectively using 10 µl restriction Buffer (10x), 1 µl BSA (100x), 1 µl HindII
enzyme, 1 µl Pst I enzyme, 1 µl pRSET B Vector ((50 ng/ µl) and 86 µl DNA sample and
distilled water, mixed briefly and incubated at 37 ºC in a thermal cycler block for 2 hr.
3.3.6.2 Ligation of omp W PCR product into the expression vectors
89
The ligation reactions using expression vectors were carried out according to the
manufacturer’s protocols. The expression vector used was pQE30 UA (Fig 5. Qiagen,
USA).
Fig. 5. Vector used in this study- pQE30 UA linearized vector (Qiagen, USA)
For Qiagen vector (pQE30 UA linearized plasmid DNA), ligation was performed
using 4 µl purified PCR product and 1 µl vector (50 ng/ µl). Five microlitres of 2 ligation
master mix was added, mixed briefly and incubated the tube at 16 ºC in a thermal cycler
block for 2 hr.
3.3.7. Transformation
After ligation the pRSET vector containing the omp48 gene was maintained in
TOPO10F’ cells and the recombinant protein was expressed in the E. coli
BL21(DE3)pLysS strain. One Shot TOP10F’ and BL21(DE3)pLysS competent cells for
high efficiency transformation was procured from Invitrogen, USA and used for the study.
90
The pQE30 UA vector containing omp W gene was maintained and the recombinant
protein was expressed in E. coli SG13009 strain.
The recombinant expression vectors were transfered to a tube containing 150 µl. of
the respective competent cells. The contents were mixed by gentle tapping and incubated
on ice for 30 min. The cells were subjected to heat shock at 42 ºC for 90 sec in a water
bath. The tubes were then rapidly transferred to ice and cells were allowed to chill for 1-2
min. 500 µl of LB broth was added to the tubes and incubated at 37 ºC for 1hr with
vigorous shaking. The cells were centrifuged at 4000 rpm for 10 min. 300 µl supernatant
was discarded and transformed cells were resuspended in remaining 200 µl broth and was
spread on two LB plates (100 µl/plate) containing antibiotics (100 µg/ml ampicillin & 25
µg/ml kanamycin and 35 µg/ml chloramphenicol & 50 µg/ml ampicillin for SG13009 and
BL21(DE3)pLysS cells, respectively). The plates were then incubated overnight at 37 ºC.
3.3.7.1. Preparation of competent E. coli SG13009 cells
The procedure described by the suppliers (Qiagen, USA) was followed to prepare
the competent cells. Aliquots of E. coli strains, SG13009 were removed from the supplied
vial with a sterile tooth pick, streaked on LB agar containing antibiotics (25 µg/ml
kanamycin for SG13009 strain and incubated overnight at 37 ºC. Then single colony was
inoculated into 10 ml of LB broth containing respective antibiotic and grown overnight at
37 ºC with constant shaking at 150 rpm. The following day, 1 ml of overnight grown
culture was transferred into 100 ml of LB broth containing respective antibiotics and
incubated for 90-120 min with vigorous shaking at 200 rpm at 37 ºC. Optical density at 600
nm (OD600) was measured after every 30 min. When OD600 reached 0.4-0.5, culture was
chilled on ice, transferred to pre-chilled 50 ml polypropylene tubes and centrifuged at 2500
rpm for 10 min using cooling centrifuge (Hearus, Germany). The supernatant was
91
discarded and the cells pellet was suspended gently without damaging the cells in 30 ml of
ice cold TFB1 buffer and the suspension was kept on ice for an additional 90 min and
centrifuged at 2500 rpm at 4 ºC for 10 min. The supernatant was discarded carefully and
the cell pellet was resuspended in 4 ml of ice cold TFB2 buffer. About 150 µl of
suspension of competent cells was aliquoted in 1.5 ml microfuge tubes, frozen and stored
at -80 ºC.
Luria-Bertanii (LB) broth (Hi Media, Mumbai)
Tryptone 10 g/l
Yeast extract 5 g/l
Sodium chloride 10 g/l
2.5 g of LB broth was dissolved in 100 ml of distilled water and sterilized at 121 ºC for 15
min. To the cooled LB broth, antibiotics were added from the stock solutions to get the
desired concentrations.
Luria-Bertanii (LB) agar (Hi Media, Mumbai)
Tryptone 10 g/l
Yeast extract 5 g/l
Sodium chloride 10 g/l
Agar 15 g/l
4 g of LB broth was dissolved in 100 ml of distilled water and sterilized at 121 ºC for 15
min. Then it was cooled to 50 ºC and antibiotics were added from the stock solutions to get
the desired concentrations.
Kanamycin stock solution (25 mg/ml)
Stock solution was prepared by dissolving 0.0385 g of kanamycin powder (HiMedia,
Mumbai) having the assay potency of 650 µg/mg in 1ml distilled water, filter sterilized and
stored in aliquots at -20 ºC.
92
Ampicilin stock solution (100 mg/ml)
Stock solution was prepared by dissolving 0.1089 g of ampicillin powder (HiMedia,
Mumbai) having 98% purity in 1ml distilled water, filter sterilized and stored in aliquots at
-20 ºC.
Chloramphenicol stock solution (35 mg/ml)
Stock solution was prepared by dissolving 0.039 g of chloramphenicol powder (HiMedia,
Mumbai) having 98% purity in 1 ml 100% ethanol. It is not necessary to filter sterilize.
Store the stock solution at –20°C.
TFB1 buffer
RbCl 100 mM
MnCl2 50 mM
Potassium acetate 30 mM
Calcium chloride 10 mM
Glycerol 15%
pH 5.8
All the chemicals used were of molecular biology grade. pH was adjusted carefully to
avoid formation of insoluble manganese precipitate. After adjusting the pH, the buffer was
filter sterilized and stored at 4 ºC.
TFB2 buffer
MOPS 10 mM
RbCl 10 mM
Calcium chloride 75 mM
Glycerol 15%
pH 6.8
After adjusting the pH, the buffer was filter sterilized and stored at 4 ºC.
93
3.3.8. Screening of transformants
Transformants were randomly selected and screened for the presence of insert by
preparing crude lysate of DNA (Dileep, 2002). Briefly, each of the selected colonies were
inoculated to 2 ml of LB broth and incubated overnight at 37 ºC. To 50 µl of the culture,
450 µl of TE buffer was added and cells were lysed at 100 ºC for 10 min, snap chilled,
centrifuged briefly for 5 min and 2 µl of supernatant was used as template for PCR using
gene specific primers. Glycerol stock (30%) were made for all the positive clones and
stored at -80 ºC.
3.3.9. Confirmation of the recombinant constructs
The orientation of the insert of the cloned viral coat protein genes were confirmed
by using vector specific forward primers and gene specific reverse primer.
3.3.10. Expression of the recombinant proteins
The pRSET B vector containing the omp48 was maintained in TOPO10F’ cells and
the recombinant protein was expressed in the E. coli BL21(DE3)pLysS strain. The
recombinant gene constructs containing omp W was maintained and expressed in E. coli
SG13009 host cells.
To ascertain the expression, each of the positive clones of omp48 and ompW were
inoculated in to 5 ml of LB medium containing antibiotics. Cultures were grown overnight
at 37 ºC with constant agitation at 150 rpm and 1 ml of overnight grown cultures were
inoculated into 10 ml of LB broth with specific antibiotics and incubated at 37 ºC with
constant shaking until the OD600 is 0.5-0.7. The cultures were induced with different
concentrations of IPTG (1mM, 1.5 mM, 2 mM, 2.5 mM amd 3 mM) and further incubated
for 4 hr with the same conditions. Uninduced recombinant clone, E. coli strains SG13009
94
and E. coli BL21(DE3)pLysS were used as control. 1 ml culture from each sample was
centrifuged at 11,000 g for 3 min and the supernatant was discarded. The pellet was
resuspended in 30 µl distilled water and 30 µl of 2X sample buffer by continuous
vortexing, lysed at 95 ºC for 5-10 min in a dry bath. Then samples were loaded to the
prepared polyacrylamide gel.
Isopropylthio- β-D-galactoside (IPTG, 1 M)
Stock solution was prepared by dissolving 2.3 g of IPTG in 10 ml of distilled water,
filter sterilized and aliquots were stored at -20 ºC.
3.3.11. Plasmid DNA extraction
Reagents supplied with kit (Eppendorf Fast Plasmid Mini Kit)
Lysis solution, RNase solution, Lysozyme, Wash buffer concentrate, Elution buffer
and Fast Plasmid Spin Column Assembly.
Plasmid extraction protocol
Young bacterial cultures at the logarithmic growth phase were used for plasmid
DNA extraction. 1.5 ml of bacterial culture was centrifuged to sediment the cells to the
bottom of the microfuge tube. The clear supernatant was discarded and to the pellet, 400 l
of ice cold complete lysis solution was added. The pellet was mixed thoroughly and
incubated at room temperature for 3 min. Subsequently, the lysate was transferred to the
spin column assembly and centrifuged at maximum speed for 60 sec. 400 l of diluted
wash buffer was added to the spin column and centrifuged for 1 min. For elution, 50 l of
95
elution buffer was added to the spin column placed in a collection tube and centrifuged.
The purified plasmid was collected in the collection tube and stored (Fig 6).
96
Fig. 6. Plasmid purification using Eppendorf fast plasmid mini kit
3.4. SDS-polyacrylamide gel electrophoresis
Recombinant proteins expressed in E. coli were analysed by the method of
Laemmli (1970) using SDS-PAGE with some modifications as described above.
Sample preparation of recombinant E. coli for SDS-PAGE
1.5 ml Bacterial Culture
Centrifuge for 1 minute to pellet the cells Decant the media Add 400 µl of ice-cold complete lysis solution Vortex for a full 30 seconds at the highest setting
Incubate at room temperature for 3 minutes
Transfer the lysate to a Spin Column Assembly
Spin Column Assembly
Centrifuge for 30–60 seconds
Centrifuge for 30-60 seconds
Wash DNA with 400 µl of diluted wash buffer
Decant the filtrate from the waste tube and re-assemble the Spin Column Assembly
Centrifuge for 1 minute Add 50 µl of Elution Buffer to the center of the Spin Column Transfer the Spin Column into a collection tube
Centrifuge for 30-60 seconds
Purified Plasmid DNA
97
One ml of test cultures was pelleted by centrifugation at 11,000 × g for 3 min and
supernatant was discarded. The pellet was resuspended in 30 µl distilled water and 30 µl of
2X sample buffer, vortexed and lysed at 95 ºC for 5-10 min in a dry bath. The samples
were loaded to the SDS polyacrylamide gel.
3.4.1. Purification of recombinant proteins
For production of recombinant proteins in relatively large scale, 200 ml of LB
broth was used. The cultures of the recombinant E. coli were grown and expressions were
obtained under optimized conditions of IPTG induction and time course. The DNA inserts
were expressed with 6 histidine residues as an N-terminal fusion protein. The metal
binding domain in the fusion protein allows simple one step purification of immobilized
metal affinity chromatography (IMAC). The following steps were used for purification of
the recombinant proteins by Ni-NTA affinity chromatography.
Cells were harvested by centrifugation at 11,000 × g for 5 min after induction with
IPTG for 4 hr. Cell pellets were resuspended in lysis buffer (pH 8.0) and stirred using
magnetic beads for 1hr at room temperature, sonicated on ice at 20-30 W with six 10 sec
bursts. The lysates were centrifuged at 11,000 × g for 15 min at room temperature to pellet
the cellular debris. The supernatant was added to 1 ml of 50% Ni-NTA agarose slurry and
stirred gently on magnetic stirrer for 1 hr at 4 ºC. The lysate-Ni-NTA mixtures were loaded
into columns and each column washed twice with 4 ml wash buffer (pH 6.3). The proteins
were then eluted with 4 ml of elution buffer (pH 4.5), dialyzed against 10 mM Tris, pH
8.0, 0.1% Triton X-100 overnight at 4 ºC to remove guanidine hydrochloride and
concentrated using vacuum concentration instrument and purity of these proteins were
analyzed on 12-15 % SDS-PAGE.
98
Lysis buffer (pH 8.0)
NaH2PO4 100 mM
Tris-Cl 10 mM
Urea 8 M
pH was adjusted to 8.0 using NaOH
Wash buffer (pH 6.3)
NaH2PO4 100 mM
Tris-Cl 10 mM
Urea 8 M
pH was adjusted to 6.3 using NaOH
Elution buffer (pH 4.5)
NaH2PO4 100 mM
Tris-Cl 10 mM
Urea 8 M
pH was adjusted to 4.5 using NaOH.
3.4.2. Protein estimation
The protein content was measured by the method of Lowry (1951). The procedure
is based on quantitating the color obtained from the reaction of Folin Ciocalteau phenol
reagent with tyrosyl residues of unknown protein and comparing this with a standard
protein, usually bovine serum albumin (BSA). Five standard BSA (1 mg/ml in distilled
water) samples were prepared in 0.1 N sodium hydroxide to give concentrations of 20, 40,
60, 80 and 100 µg/ml, respectively, in glass tubes in duplicates. Test samples were taken in
2 different dilutions of 20 µg and 40 µg along with neat. Equal volume of alkaline copper
reagent was added to all tubes and the mixture was incubated for 15 min at room
temperature. Folin’s reagent (Sigma, USA) was added at a concentration of 50 µl/ml. The
99
entire mixture was mixed well and incubated for another 30 min at room temperature.
Optical density was measured at 690 nm. The protein concentration of the sample was
obtained from the graph plotted for the standard BSA concentrations as optical density
values.
Copper sulphate (1%) solution
Copper sulphate 0.1 g
Distilled water 50 ml
Sodium potassium tartarate (2%) solution
Sodium potassium tartarate 1 g
Distilled water 50 ml
Sodium carbonate (4%) solution
Sodium carbonate 2 g
Distilled water 50 ml
Sodium hydroxide (0.1 N) solution
Sodium hydroxide 0.2 g
Distilled water 50 ml
Alkaline copper reagent (ACR)
Copper sulphate (1%) 1 ml
Sodium potassium tartarate (2%) 1 ml
Sodium carbonate (4%) 48 ml
Bovine serum albumin (1%)
Bovine serum albumin 0.01 g
Distilled water 1 ml
3.4.3. Generation of hyperimmune sera in rabbit
100
Rabbits were immunized with 200 µg of purified recombinant proteins by
intramuscular injection at 7-day intervals for 4 weeks consecutively. The first dose was
administered with Freund’s complete adjuvant while subsequent doses were given with
Freund’s incomplete adjuvant. Rabbits were bled, a week after the last dose by cardiac
puncture. Sera were separated from blood cells and stored -20 ºC in aliquots.
3.4.4. Immunization of fish with recombinant protein
Overly healthy rohu (L. rohita Hamilton) weighing 350-400 g were kept in 100
liter containers for one week prior to immunization. The fish were fed with pelleted feed
during the experimental period. The fish were anaesthetized and 4 doses of the
recombinant protein (1.5 µg g-1 of fish body weight) were injected intramuscularly at 7-day
intervals for 4 weeks consecutively to one group of 5 fish while the other group of 5 was
injected with PBS. The first dose was administered with Freund’s complete adjuvant while
subsequent doses were given with Freund’s incomplete adjuvant. Fish were bled, a week
after the last dose. Sera were separated from blood cells and stored -20 ºC in aliquots.
3.4.5. Titration of hyperimmune sera
Titres of hyperimmune sera (HIS) were checked by plate ELISA (Engvall and
Perlman's, 1971). Wells of polystyrene ELISA plates were coated separately with 10
µg/ml of antigen in carbonate - bicarbonate buffer and incubated at 4 ºC overnight. After
washing with phosphate buffered saline (PBS), non-specific sites were blocked by 5%
defatted milk powder in PBS and further incubated overnight at 4 ºC. After washing thrice
with phosphate buffered saline tween-20 (PBST), plates were incubated for 1 hour at 37 ºC
with serially diluted HIS in PBS. Wells containing PBS served as controls. The plates
were washed thrice with PBST and incubated with 100 µl/well of horse-raddish-peroxidase
conjugated goat anti-rabbit immunoglobulins (Sigma, USA) at 1:2000 dilutions in PBS for
101
1 hour at 37 ºC. After extensive washing with PBST, enzyme activity was determined by
adding 100 µl of freshly prepared solution of tetramethyl benzidine hydrogen peroxide
(TMB/H2O2) into each well. Incubation was carried out for 5 minutes at room temperature
in dark and 100 µl of 2.5 N sulphuric acid was added into wells to stop the reaction.
Enzyme activity was read at 450 nm in ELISA reader (ELX 800, Bio-Teck instrument,
USA).
Carbohydrate-bicarbonate buffer (0.05 M, pH 9.5)
Na2CO3 16 mM
NaHCO3 36.9 mM
Phosphate buffered saline (PBS)
NaCl 137 mM
KCl 2.7 mM
Na2HPO4 10 mM
KH2PO4 2 mM
Phosphate buffered saline tween-20 (PBST)
PBS 100 ml
Tween-20 0.5 ml
Tetramethyl benzidine hydrogen peroxide (TMB/H2O2, 20, Bangalore Genei,
Bangalore)
TMB/H2O2 was 20 times diluted in distilled water just before use.
3.4.6. Characterization of hyperimmune sera by Western blotting
Specificity of hyperimmune serum raised against purified recombinant proteins,
whole cell proteins of uninduced non-recombinant competent cells, IPTG induced non-
recombinant competent cells, uninduced recombinant competent cells and bacterial species
were tested by Western blotting. Western Blotting was carried out as per the procedure of
102
Towbin et al. (1979) and antigenicity of recombinant proteins was determined by
developing of color with respective antisera. The following materials were used:
a) Nitrocellulose membrane
Nitrocellulose membrane (NC) (Pall Life Sciences, USA) was used as per the
manufacturer’s instructions.
b) Transfer buffer
Glycine 39 mM
Tris base 48 mM
SDS 0.037%
20% methanol was added to this solution just prior to
use.
c) Blocking solution
The blocking solution was prepared with 3% (w/v) BSA (HiMedia, Mumbai)
d) Enzyme labeled antibody
Goat anti-rabbit immunoglobulin conjugated with horseradish peroxidase (HRP)
(Bangalore Genei, Bangalore) was used at a dilution of 1:1000 in PBS.
e) Substrate
DAB(3-3’-diaminobenzidine tetrahydrochloride) and H2O2 (Bangalore Genei, Bangalore)
was used.
Procedure
The immunoblotting procedure was carried out as follows:
1) Resolution of sample by gel electrophories
2) Transfer of separated polypeptides to a nitrocellulose membrane
3) Blocking of non-specific binding sites on the membrane
103
4) Addition of antibody
5) Detection
i) Polyacrylamide gel electrophoresis
The antigens were electrophoresed on a 10% SDS-polyacrylamide gel as per the
method described in section 3.2. The samples were loaded and resolved in two sets of
repeating lanes so that the portion of gel containing one set of samples could be taken for
staining with coomassie blue and the other portion of gel for electrotransfer. A lane
containing protein molecular weight marker was included for electrophoresis for each
portion of the gel.
ii) Electrophoretic transfer
Transfer of proteins from the polyacrylamide gel to nitrocellulose membrane was
carried out using the semidry transfer unit-Semiphor (Hoefer Scientific Instruments, USA).
Electrode plates of the semiphor unit was rinsed with distilled water. Six sheets of
absorbent paper (Whatman No. 1) and one sheet of nitrocellulose membrane were cut to
the size of the gel used for electrotransfer. The transfer stack was prepared by placing a
pre-cut mylar mask (2 mm smaller than the gel from each side) on the anode in the base
centering the opening. Three sheets of absorbent papers soaked in transfer buffer were
placed at the centre of the opening. Nitrocellulose membrane soaked in deionised water
was placed on the absorbent papers. The polyacrylamide gel slightly wetted in deionised
water was placed on the absorbent papers. The polyacrylamide gel slightly wetted in
deionised water was placed carefully at one attempt on the membrane surface. The
remaining three absorbent papers soaked in transfer buffer were placed on the top of the
gel completing the stack. As each layer was added, care was taken in removing air pockets
by rolling a clean test tube over them. Electrophoresis was performed with constant
104
voltage of 45 V for 1 hr at maximum current. After electrotransfer, the nitrocellulose
membrane was taken out and dried. The lane containing molecular weight marker was cut
and stained with amido black.
iii) Blocking
The nitrocellulose membrane was rinsed several times with PBS. The blocking
solution (3% BSA/PBS) was added to the membrane placed in a clean glass petri plate.
The membrane was soaked in this solution at 4 ºC overnight.
iv) Addition of antibody
The blot was removed from blocking solution and was washed twice with PBS for
5 min each. Then NC sheet was incubated with hyperimmune serum (1:100) to specific
recombinant proteins for 1 hour at room temperature on a rotor shaker. The blot was
washed with four changes of PBST for 5 min each. After washing with PBST, the NC
sheet was incubated with goat anti rabbit antibodies HRP conjugate, at a dilution of 1:1000
at room temperature for 1 hour.
v) Detection
The blots were washed with four changes of PBST before addition of the substrate,
DAB (3-3’-diaminobenzidine tetrahydrochloride) and H2O2 for detection of bands. The
colour developed within 1-5 min and the excess development of color was stopped by
keeping the blot in distilled water.
3.4.7. DNA sequencing and analysis
The plasmids was purified using a Plasmid purification kit (QIAGEN, USA). The
cloned products were sequenced by M/s Bioserve, Hyderabad, India using M13 and gene
105
specific primers. The identity of the nucleotide and derived amino acid sequences to
known sequences in GenBank was analysed using the respective BLAST program
available at NCBI (http://www.ncbi.nlm.nih.gov/). The program Sequence Quickie-Calc
version 5.0 software (http://molecular programming.com/) was used for the prediction of
molecular weight, pI, hydrophobic nature of the proteins. Signal peptide sequence was
located using SignalP ver.3.0 (http://www.cbs.dtu.dk/services/SignalP). The structural
class of the membrane proteins was predicted using PRED-TMBB
(http://bioinformatics.biol.uoa.gr/PRED-TMBB) an online software which is capable of
predicting the transmembrane strands and the topology of the outer membrane proteins of
Gram-negative bacteria. The probable antigenic sites in the proteins were determined by
the Emboss-GUI package (http://sequenzanalyse.biologie.uni-konstanz.de/EMBOSS).
Similarity of the protein to bacterial adhesins was predicted using SEAPATH (30) from the
GenoCluster suite of programs.