ANN Simulink Examples
An Introduction to MATLAB® Dr M Ali Ahmadi-Pajouh KN Toosi University.
Video processing on dsp
Physical Modeling in MATLAB
Discussion 1
1 Advanced MATLAB Vectors and matrices fprintf Cell arrays Structures Flow of control Vectorization Functions.
dspaceinsimulink.pdf
Interactive tools and programming environments for sequence analysis Bernardo Barbiellini Northeastern University TATACATAAAGACCCAAATGGAACTGTTCTAGA TGATACACTAGCATTAAGAGAAAAATTCGAAGA.
INTRODUCTION TO SIMULINK by Yasmin Hanum Md Thayoob & Aidil Azwin Zainul Abidin.
1 How to use Matlab 27-750 Texture, Microstructure & Anisotropy A.D. Rollett Last revised: 25 th Feb. ‘14.
MATLAB Programming fprintf Cell arrays Structures Flow of control Vectorization Functions 1.
Introduction to MATLAB Session 1 Prepared By: Dina El Kholy Ahmed Dalal Statistics Course – Biomedical Department -year 3.
