Phylogenetic reconstruction. Types of data used in phylogenetic inference: Distance-based methods: Transform the sequence data into pairwise distances,
More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.
BIOS E-127 – 08.09.29. Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.
