Search results for Distinct Elements Problem

Explore all categories to find your favorite topic

Ariel Rosenfeld Input: a stream of m integers i1, i2, ..., im. (over 1,…,n) Output: the number of distinct elements in the stream. Example – count the distinct number…

An Optimal Algorithm for the Distinct Elements Problem Daniel M Kane∗ Jelani Nelson† David P Woodruff‡ Abstract We give the first optimal algorithm for estimating the…

Tight Lower Bounds for the Distinct Elements Problem David Woodruff MIT dpwood@mit.edu Joint work with Piotr Indyk The Problem Stream of elements a1, …, an each in {1,…

Tight Lower Bounds for the Distinct Elements Problem David Woodruff MIT dpwood@mit.edu Joint work with Piotr Indyk The Problem Stream of elements a1, …, an each in {1,…

Tight Lower Bounds for the Distinct Elements Problem David Woodruff MIT dpwood@mit.edu Joint work with Piotr Indyk The Problem Stream of elements a1, …, an each in {1,…

Slide 1Tight Lower Bounds for the Distinct Elements Problem David Woodruff MIT dpwood@mit.edu Joint work with Piotr Indyk Slide 2 The Problem Stream of elements a 1, …,…

Slide 1 1 9 Dualism and its Problems Slide 2 2 The Distinct Substances Problem The Distinct Substances Problem The fact that an individual is composed by two distinct substances…

CHENNAI INTERNATIONAL AIRPORT AND MULTI MODAL HUB CHENNAIINDIA INFRASTRUCTURETRANSPORTATION : AIRPORT These new Domestic and the International Terminals at the Chennai Airport…

Chemistry & Biology Article Distinct Structural Elements Dictate the Specificity of the Type III Pentaketide Synthase from Neurospora crassa Sheryl B. Rubin-Pitel,1,5…

What are the key elements of Problem-Based Learning? Key Elements of Problem-Based Learning: Students focus on content that is relevant to them in real-world scenarios Knowledge,…

An Optimal Algorithm for the Distinct Elements Problem Daniel M Kane Department of Mathematics Stanford University aladkeenin@gmailcom February 21st 2014 Joint work with…

1. Lo2 Elements of the Research Problem The Research Problem Variables Hypothesis Operational Definition 2. Identifying Researchable Problem - be truly sensitive to what…

An Optimal Lower Bound for Distinct Elements in the Message Passing Model David P. Woodruff IBM Research Almaden dpwoodru@us.ibm.com Qin Zhang Indiana University Bloomington…

Slide 1The Average Case Complexity of Counting Distinct Elements David Woodruff IBM Almaden Slide 2 Problem Description Given a data stream of n insertions of records, count…

Ethnicity is especially important to geographers because in the face of globalization trends in culture and economy ethnicity stands as the strongest bulwark for the preservation…

SIAM J COMPUT c© 2007 Society for Industrial and Applied Mathematics Vol 37 No 2 pp 359–379 RANGE-EFFICIENT COUNTING OF DISTINCT ELEMENTS IN A MASSIVE DATA STREAM∗ A…

DBoffi FBrezzi LDemkowicz RGDuŕan RSFalk MFortin MIXED FINITE ELEMENTS COMPATIBILITY CONDITIONS AND APPLICATIONS Lectures given at the CIME Summer School held in Cetraro…

Elements of the Sampling Problem! Professor Ron Fricker! Naval Postgraduate School! Monterey, California! 2/1/13 1 Reading Assignment:! Scheaffer, Mendenhall, Ott, &…

Young Audiences Residency Teacher Guide Synetic Theater: Bringing Your Studies to Life
 SYNthesis: the coming together of distinct elements to form a whole KinETIC: pertaining…

1 1 Supplementary Figure S1. Potential SAD promoter elements conferring gene expression in seeds. a SAD-A promoter (GenBank accession no. AF242183) TGGTCCTTTTAGGCCTAGGATTCTSCTTGGAAAGGGTCATCGACCACTCAGTCAATGGTGGAGCATTGAATC…