University of Groningen
Bacillus subtilis: sporulation, competence and the ability to take up fluorescently labelled DNABoonstra, Mirjam
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2017
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Boonstra, M. (2017). Bacillus subtilis: sporulation, competence and the ability to take up fluorescentlylabelled DNA. Rijksuniversiteit Groningen.
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 23-11-2021
Chapter 4
Following the fate of incoming
DNA during natural
transformation of Bacillus
subtilis with fluorescently
labelled DNA
Mirjam Boonstra, Nina Vesel, Oscar P. Kuipers.
Department of Genetics, GBB, University of Groningen, the Netherlands
Chapter 4
121
Abstract
During competence Bacillus subtilis is able to take up DNA from its
environment through the process of transformation. We investigated the
ability of B. subtilis to take up fluorescently labelled DNA and found that it
is able to take up either Fluorescein-dUTP, DyLight550 or DyLight650-
dUTP labelled DNA. Transformation with labelled DNA containing an
antibiotic cassette resulted in uptake of the labelled DNA and also
generated antibiotic-resistant colonies. The labelled DNA co-localises with
the chromosome and with ComFC and RecA. Fluorescent labelling of DNA
creates the opportunity to directly study interactions of exogenous DNA
with components of the competence machinery and recombination
proteins. The competence machinery is conserved among naturally
competent bacteria, which makes this method of labelling suitable for
studying transformation of other naturally competent bacteria.
Introduction
An interesting aspect of the lifestyle of Bacillus subtilis is its ability to take
up naked DNA from the environment. When nutrients are limited a sub-
population of B. subtilis cells can become competent and transport the
exogenous DNA to its interior. This transport occurs through a large
complex consisting of multiple proteins. The transport complex is highly
conserved among naturally competent bacteria and in B. subtilis it localises
primarily at the pole (Hahn et al., 2005). The first step in the transport
process is the binding of the extracellular DNA. Proteins necessary for the
binding of DNA are the major pseudopilin ComGC, the minor pseudopilins
ComCD, ComGE and ComGG, the ATPase ComGA and the membrane
protein ComGB (Chung and Dubnau, 1998). The dsDNA binding protein
ComEA is also required for transformation (Inamine and Dubnau, 1995;
Provvedi and Dubnau, 1999). The DNA is bound in its double stranded
form and in case of large molecules cleaved into fragments of 13.5-18kb by
NucA (Dubnau, 1999; Dubnau and Cirigliano, 1972). One of the strands of
the dsDNA is degraded by an unknown protein. In B. subtilis no preference
was found for the 3'-5'or 5'-3' strand (Vagner et al., 1990).
Chapter 4
122
Single stranded (ssDNA) is transported through the water-filled ComEC
channel and transport is assisted by the helicase/ATPase ComFA
(Draskovic and Dubnau, 2005; Londoño-Vallejo and Dubnau, 1993;
Takeno et al., 2011). When ssDNA enters the cytoplasm it is bound and
protected from degradation by SsbB and SsbA. (Baitin et al., 2008; Grove
et al., 2005; Yadav et al., 2012). DprA and SsbA facilitate RecA•ATP
mediated strand exchange (Yadav et al., 2012, 2014). While DNA is present
on the surface of the cell it is still accessible to DNaseI, but approximately
1-1.5 minutes after addition of DNA at 37 °C the exogenous DNA becomes
resistant to DNaseI and single-strand donor DNA can be retrieved from
lysed cells confirming uptake of DNA (Piechowska and Fox, 1971; Davidoff-
Abelson and Dubnau, 1973; Dubnau, 1999). If the foreign DNA has
homology to the genome of the recipient bacterium it can be integrated
into the chromosome by homologous recombination. If no homology is
present, but the exogenous DNA is capable of autonomous replication it
can be reconstituted as a plasmid (Kidane et al., 2012; Viret et al., 1991).
The proteins involved in DNA uptake have been extensively studied; for
reviews see (Chen and Dubnau, 2004; Chen et al., 2005; Kidane et al.,
2012). Co-localisation of proteins is often visualised using fusions of the
protein of interest to a fluorescent protein and this has been done
successfully with components of the competence machinery (Hahn et al.,
2005; Kaufenstein et al., 2011; Kramer et al., 2007). Visualising DNA has
also been done successfully although no transfer of DNA into the cytoplasm
of Helicobacter pylori or B. subtilis was detected (Stingl et al., 2010).
Although transport of fluorescently labelled DNA into the cytoplasm of B.
subtilis was not successful previously, we decided to try different labelling
methods and dyes. We incorporated covalently bound dyes into DNA in
order to be able to follow up-take and interactions of DNA with
components of the competence and replication machinery. We tested
several labelled nucleotides to be incorporated via PCR , i.e. DyLight650-
dUTP, DyLight550-dUTP, Fluorescein-dUTP, Cy3-dUTP, Cy5-dUTP and
Alexa Fluor 5 labelled dNTPs which were incorporated via the Klenow
method. To demonstrate the usefulness of labelled DNA in studying
interactions with proteins involved in transformation we also determined
co-localisation with ComFC, RecA and the chromosome.
Uptake of labelled DNA
123
Results
DNA uptake
Because under nutrient-limited conditions in the lab only 5-25% of the B.
subtilis 168 population becomes competent we used a Pxyl-comK over-
expression strain. By growing the cells in competence medium with
fructose as a carbon source we relieved repression of the xylose promoter
and reduced the amount of xylose required for induction of ectopic comK.
Under these conditions approximately 80% of the population became
competent. Labelling of DNA was done either directly through PCR as for
Fluorescein-dUTP, Cy3-dUTP and Cy5-dUTP labelled DNA or indirectly by
PCR with aminoallyl dUTP and subsequent labelling with amino reactive
DyLight650 or DyLight550. Incorporation of Alexa Fluor 5 from the
Bioprime total genomic DNA labelling module was done by use of the
Klenow reaction. All the dyes were covalently bound to the nucleotides and
both strands of the DNA were labelled. The template used was pDG1664
with a concentration of 100ng, and an erythromycin marker plus the
flanking thrC regions were amplified. A negative control was taken in
which all components were the same, except that no enzyme was added.
Amplified PCR or Klenow products were incubated for 2hrs with DpnI to
remove all template DNA. Transformation of the negative control did not
yield resistant colonies confirming that treatment with DpnI removes all
template DNA. A positive control using an amplified product with normal
dNTPs was also taken to confirm competence of the cells. Label
incorporation of Fluorescein-dUTP, Cy3-dUTP and Cy5-dUTP (measured
with a Nanodrop ) generally lies between 1.4-4.6% for Fluorescein-dUTP,
1.4-3% for DyLight650-dUTP, and between and on average 7% for Alexa
Fluor 5. Transformation with Fluorescein, DyLight550 and DyLight650
labelled DNA resulted in resistant colonies. Transformation with Alexa
Fluor 5 labelled DNA did not result in resistant colonies. Transformation
with Cy3 or Cy5 labelled DNA is also possible, but is much lower in
particular for Cy5.
Chapter 4
124
Because transformation with Fluorescein labelled DNA and DyLight
labelled DNA resulted in the highest number of colonies we compared the
transformation efficiency with unlabelled DNA. The transformation
efficiency of the labelled dyes is about 3X lower than that of unlabelled
DNA (S. table1). As mentioned previously when B. subtilis successfully
takes up DNA it becomes resistant to DNaseI treatment. We therefore
treated all samples with 10U of DNaseI for ten minutes at 37 °C after which
the cells were washed and prepared for microscopy. DyLight650-DNA,
Fluorescein-DNA bind to competent B. subtilis (Img. s1, S. Img 1.). Alexa
Fluor 5 labelled DNA also binds in a DNaseI resistant manner, but as
mentioned previously transformation does not result in resistant colonies.
To confirm that DNA binds preferentially to competent cells we incubated
B. subtilis amyE::Pxyl-comK-PcomG-gfp with DyLight650 labelled DNA. The
PcomG-gfp construct in this strain is an indicator for competence, with
competent cells expressing gfp (Smits et al., 2005). Image 3a shows that
labelled DNA binds only to the competent cells and that no binding is
present to non-competent cells. Image3b shows that B. subtilis amyE::Pxyl-
comK grown in LB does not bind labelled DNA which is expected as
competence is very low when B.subtilis is grown in LB. These results show
that labelled DNA only binds to competent cells and confirms that the
bound DNA is resistant to DNaseI. We also performed the same
experiment with Streptococcus pneumoniae D39 to see if competent S.
pneumoniae is also capable of binding labelled DNA and indeed competent
S. pneumoniae binds labelled DNA in a DNaseI resistant manner (Img. 2).
Uptake of labelled DNA
125
To further determine if the labelled DNA is truly internalised we took
advantage of the pH sensitivity of Fluorescein. Fluorescein has a very low
fluorescence at a pH below 5. When cells transformed with labelled DNA
and fixed with 2% formaldehyde are put in PBS buffer at pH 7.4 some foci
can be seen localising on the border of the cells.
Img. 1. Comparison of competent and non-competent B. subtiltis transformed with labelled DNA. (A). B. subtilis amyE::Pxyl-comK-PcomG-gfp transformed with dylight650 labelled DNA. The labelled DNA (red foci) only binds to the competent (blue) cells. (B). B. subtilis grown in LB and incubated with labelled DNA. No labelled DNA can be seen binding to the non-competent cells grown in LB.
Img. 2. Competent Streptococcus pneumoniae D39 incubated with DyLight650 labelled DNA. Labelled DNA binds to competent S. pneumoniae in a DNaseI resistant manner.
Chapter 4
126
When the cells are exposed to a 10mM sodium acetate buffer at pH4
resulting in a low pH outside the fixed cells foci are only seen inside the
cells with no foci localising on the outer edge of the cells (S. Img. 2). These
results combined with the fact that transformation with fluorescently
labelled DNA yields resistant colonies show that labelled DNA is
successfully taken up by the cells. In previous studies 1-4 foci per cell of
competence proteins were found (Kaufenstein et al., 2011). After 1hr of
incubation we also find 1-4 foci per cell for the labelled DNA with the
majority 77.6% having 1 focus, 18.4% 2 foci, 3.7% 3 foci and 0.3% having 4
foci, while rarely a cell is found with more foci (Img. 3, S1.table2). The
localisation of the DNA differs with that of the foci of components of the
competence machinery. In studies into the localisation of the components
of the competence machinery the majority of the foci are localised at the
pole with only 4-15% (average 7.7%) depending on the protein localised
near the centre of the cell (Kaufenstein et al., 2011). In cells fixed with 2%
formaldehyde the labelled DNA is more often (28-23%) localised near the
centre of the cell and co-localises with the chromosome in 21-22% of the
cases. (S. table 3,4). Single foci localise an average of 47% in the centre of
the cell and 39% at the pole.
Img. 3. Number of DyLight650 labelled DNA foci. Generally 1-4 foci per cell are found for the labelled DNA with the majority of cells having 77.6% having 1 focus, 18.4% 2 foci, 3.7% 3 foci and 0.3% having 4 foci of a total of 599 cells rarely a cell is found with more foci.
Uptake of labelled DNA
127
Image 4 shows examples of the different types of localisation of
Fluorescein-dUTP, DyLight650-DNA show the same localisation patterns
as Fluorescein labelled DNA (S table 4). A higher percentage of localisation
near the centre of the cell and co-localisation with the chromosome of
labelled DNA is in accordance with the expectation that the labelled DNA is
internalised. An interesting question is if the competence machinery can
take up multiple DNA molecules at once. Although labelling with one type
of dye creates DNA foci it is not possible to determine with regular
fluorescent microscopy how many DNA molecules there are in one focus.
Therefore to answer this question we mixed DyLight650-DNA and
Fluorescein-DNA in equal amounts and incubated the competent cells with
the mixture of labelled DNA. After 1hr their co-localization is only present
in 8% of the cells containing foci (Img. 5). In 15 % of the cells the foci are
located close to each other, but don't overlap completely. 46% of the cells
have a single Fluorescein focus and 32% have a single DyLight650 focus.
Img. 4. Localisation of foci (A). pole 34%. (B). Centre 23% C: Centre co-localising with chromosome 22%. (D). Pole (partially) co-localising with the chromosome 7%. (E). Two foci at the pole 2%. (F). Two foci at the centre 3%. (G).One focus at the pole one at the centre 3%. (H). Foci at the division site 5%. The chromosome was stained with DAPI.
Chapter 4
128
These results combined with the observation that 77% of the cells only have
one DNA focus when incubated with one type of coloured DNA indicates
that generally only one molecule is taken up at a time. The fact that co-
localisation of the 2 colours of DNA only occurs in 8% of the cases indicates
that parallel transport is rare. B. subtilis does seem to be able to take up
multiple DNA molecules at once, but this is less common (Img. 3).
Co-localisation
To determine whether labelled DNA co-localises with specific components
of the competence machinery we investigated co-localisation with ComFC-
GFP and RecA-YFP. After 10min of incubation with DNA and subsequent
fixing with 2% formaldehyde, washing and treatment with DNaseI, 33% of
the cells contain DNA foci, 26% ComFC-GFP foci and in 6% of the total
number of cells co-localisation of foci can be seen. In the cells containing
both ComFC-GFP and DyLight 650-DNA foci, co-localisation occurs in
23% of the cells (Img6 A-C), S table5). As the labelled DNA successfully co-
localises with the competence machinery we were interested if we could
also see it co-localise with the recombination protein RecA, i.e. whether
DyLight650-DNA also co-localises with RecA-YFP.
Img. 5. Co-localisation of DyLight650 DNA with Fluorescein labelled DNA. (A). Dylight650-DNA localising next to Fluorescein-DNA 14% (B). Overlapping DyLigt650 and Fluorescein-DNA foci 8% C. Single Fluorescein-DNA focus 46%. (D). Single DyLight650-DNA focus 32%. This image was changed from the draft of the thesis to improve quality in the print editon.
Uptake of labelled DNA
129
For this experiment the BD4477 strain was used which contains a RecA-
YFP fusion (Kramer et al., 2007). After 15 minutes of incubation with
DyLight650-DNA 7% of the cells show clear RecA-YFP foci and 51% show
Dylight650 foci. After 1hour 44% of the cells have Dylight650 foci and 14%
have RecA-YFP foci. Of the cells showing both RecA-YFP and DyLight650
foci co-localisation occurs in 26% of the cells at 15 minutes and 15% after 1
hour of incubation (S. Img. 3, tables 6&7). RecA is the main protein
responsible for homologous recombination during transformation and
Kidane and Graumann saw filamentous forms of RecA being formed on
addition of exogenous DNA, this form is likely the form RecA takes when
actively searching for homologous regions (Kidane and Graumann, 2005).
We also see the filamentous form of RecA and this form can be seen to co-
localise with the labelled DNA (Img. 6 G-I). Labelled DNA thus successfully
co-localises with competence and recombination proteins, and can be seen
to co-localise with the DAPI stained chromosome.
We were therefore curious if we could also see the labelled DNA co-localise
at a specific locus on the chromosome. Because we used labelled DNA
capable of integrating into the thrC locus on the chromosome it should be
possible to see the labelled DNA co-localising with this locus. A ParB-GFP
or ParB-mKate protein fusion construct with the original parS site in the
parB gene was therefore cloned into the thrC locus of B. subtilis. After 10
min of incubation with DNA and subsequent fixing with 2% formaldehyde
and treatment with DNaseI, Fluorescein-DNA co-localises with ParB-
mKate at 4%. When incubating for 1hr 9% co-localisation can be seen
(Img6 D-F), S.Tables 10 & 11,). Similar co-localisation percentages can be
seen for labelled DyLight650-DNA and ParB-GFP, which shows 3%. co-
localisation at 10min and 7% co-localisation after 1hr incubation (S. Img. 4
tables 8 & 9). The co-localisation of labelled DNA with the thrC locus is
much lower than the co-localisation with ComFC and RecA, although there
is an increase after 1hr incubation. It is possible that the ParB protein is
displaced from the chromosome when homologous recombination takes
place, and this could explain the lower level of co-localisation compared to
localisation with ComFC and RecA.
Chapter 4
130
Discussion
By covalent fluorescent labelling of DNA we developed a method that can
be used to study the interaction of incoming DNA with components of the
competence and replication machinery during transformation.
Img. 6 A-C. Co-localisation of DyLight650 labelled DNA with ComFC-GFP 10min after addition of DNA. (A). Overlay of ComFC-GFP and Dylight650DNA. (B). ComFC-GFP. (C). Dylight650-DNA. Of cells containing both DNA and ComFC foci co-localisation occurs in 23% of the cells. D-F. Co-localisation of ParB-mKate with Fluorescein labelled DNA.(D). Overlay of ParB-mKate and FLuorescein-DNA. (E). ParB-mKate. (F). Fluorescein-DNA. G-I. Co-localisation of the filamentous form of RecA-YFP with DyLight650 labelled DNA. (G). Overlay of RecA-YFP and DyLight650-DNA. (H). RecA-YFP. (I). Dylight650-DNA. This image was changed from the draft of the thesis to improve quality in the print editon.
Uptake of labelled DNA
131
We show that Fluorescein-DNA and DyLight650 labelled DNA are
successfully taken up by competent B. subtilis. Labelled DNA does not bind
to non-competent B. subtilis in a DNaseI resistant manner, confirming
specificity of binding to competent cells. The DNaseI resistance, the
presence of fluorescein-DNA foci inside the cells at pH4 and the formation
of antibiotic resistant colonies after transformation with DyLight650 and
Fluorescein-DNA show that B. subtilis can successfully be transformed
with the modified DNA albeit at a slightly lower efficiency than non-
labelled DNA. It is unknown if the lower transformation efficiency is the
result of reduced uptake, lower integration rates or if the labelled DNA
results in mutations in the resistance cassette/promoter. The observation
that AlexaFluor5-DNA which has the highest label incorporation does bind
to B subtilis in a DNaseI resistant manner, but does not result in resistant
colonies, indicates that it is either the recombination process and/or an
increased mutation rate that causes deficient transformation. If the
presence of foreign nucleotides in the transformed DNA leads to mutations
in the integrated DNA the level of dye incorporation should also be taken
into account as higher label incorporation could result in more mutations
and lower transformation efficiency. Stingl et al. fluorescently labelled
DNA using Cy3, but this labelling method did not result in uptake of
labelled DNA by B. subtilis (Stingl et al., 2010).
We also attempted transformation with Cy3 and Cy5 labelled DNA, using a
different labelling method, but even with the hypercompetent strain only
very few resistant colonies were formed. Our success with Fluorescein,
Dylight650 and Dylight550 labelled DNA is likely not only the result of
differences in structure, but also in the charge of these molecules.
DyLight650 and DyLight550 are negatively charged and have a higher
solubility in water compared to Cy5 and Cy3. During transformation
negatively charged DNA is transported through the water filled ComEC
channel. Therefore, the charge and solubility of the dye along with its size
likely are important factors in the ability of the competence machinery to
take up modified DNA. After determination of successful transformation
we also looked at co-localisation of labelled DNA with ComFC, RecA and
the chromosome.
Chapter 4
132
Localisation of the labelled DNA differs from that of the components of the
competence machinery with a much higher number of cells with foci
localised inside the cells being found for DNA compared to the competence
proteins further indicating successful internalisation. The labelled DNA co-
localises at an average of 22% with the chromosome. Although labelled
DNA is more often localised in the centre of the cell, the labelled DNA can
be seen to co-localise with ComFC with 23% co-localisation after 10min.
Labelled DNA also co-localises with RecA during transformation with 26%
co-localisation after 15 minutes and 15% co-localisation after 1hr. We also
observed formation of the active filamentous form of RecA (Kidane and
Graumann, 2005) in the presence of labelled DNA. The Co-localisation
with specific sites on the chromosome however is lower than co-
localisation with the chromosome and ComFC and RecA. After 10 min of
incubation only 3-4% of co-localisation with the thrC is found. When
cultures are incubated with the labelled DNA for 1hr the percentage of co-
localisation is slightly higher, i.e. 7-9%. The low level of co-localisation with
the specific locus compared to the entire chromosome, could be the result
of displacement of the ParB-GFP or ParB-mKate foci by the recombination
machinery. Use of a time-lapse microscopy in combination with short
imaging times might be a way in which co-localisation and potential ParB
displacement could be visualised. When competent B. subtilis is
transformed with both DyLight650-DNA and Fluorescein-DNA, full co-
localisation of the two is only seen in 8% of the cells and in15 % of the cells
the foci are located close to each other. The majority of the cells have either
only a DyLight650 focus 32% or a Fluorescein focus 46% indicating that
generally DNA is transpored in serial manner rather than in parallel.
Further investigation using super-resolution microscopy can more
difinitively determine how many DNA molecules are in one focus.
Labelling of DNA through incorporation of fluorescent-nucleotides can be
a powerful method to investigate all phases in the process of
transformation. The labelled DNA binds to competent cells in a DNaseI-
resistant manner not only for B. subtilis, but also for competent S.
pneumoniae.
Uptake of labelled DNA
133
The ability of both B. subtilis and S. pneumoniae to bind labelled DNA in a
DNAseI resistant manner combined with the high level of conservation of
the competence machinery and recombination proteins among naturally
competent species makes it likely that these labelling methods can also be
used for studies in other bacteria. Transformation with labelled DNA can
be used to gain further insights into the interactions of DNA with the
transport and recombination proteins. It can also potentially be used to
follow the entire transformation process from uptake to recombination to
expression of the integrated DNA. Not only can labelled DNA be used to
study the transport and integration of homologous DNA, but it can also be
used to study uptake and reconstitution of plasmid DNA. Many fluorescent
dyes can also be used for super-resolution microscopy (Dempsey et al.,
2011) which further opens up possibilities, such as a more accurate
determination of the number of DNA molecules transported during
competence. In short we conclude that labelled DNA is primarily taken up
at the pole as it can be seen to co-localise with ComFC at the pole. Our
results indicate that generally one molecule of DNA is taken u at a time,
and that uptake may occur in a serial rather than parallel manner. The
DNA is rapidly taken up and can be seen to also localise with the (actively
searching) form of RecA. Labelled DNA also co-localises with the
chromosome, with co-localisation with a specific locus increasing over
time.
Experimental procedures
PCR reaction for labelling with Fluorescein
1μl of 1mM fluorescein-12-dUTP (Thermo Fisher Scientific) and 2μl dNTP
mix (1mM dATP, dCTP, dGTP, 0.5mM dTTP (Thermo Fisher Scientific),
0.5 μl DreamTaq DNA polymerase (Thermo Fisher Scientific) 5μl
DreamTaq buffer, 1μM prMB013 and 1μM prMB014, 100ng PDG1664
(Guérout-Fleury et al., 1996) total volume 50μl. 35 cycles of a standard
Dreamtaq PCR protocol was used. A longer extension time of 3min was
used for a 2300bp product. After PCR samples were incubated for 2hrs
with 0.5μl DpnI (FastDigest Thermo Fisher Scientific).
Chapter 4
134
PCR samples were purified using a Machery-Nagel PCR kit. Samples were
stored at -20 ⁰C Samples were protected from light at all times. The label
incorporation of Fluorescein-dUTP lies between 1-3 pmol measured by
nanodrop.
Labelling with Dylight650
1μl dNTP mix (10mM dGTP, dCTP, dATP, 5mM dTTP, 5mM aminoallyl-
dUTP (Thermo Fisher Scientific) 0.25 μl Dreamtaq (Thermo Fisher
Scientific 5μl Dreamtaq buffer, 1μM prMB013 and 1μM prMB014, 100ng
template. Total volume 50μl, to obtain a high enough amount of product, 8
times 50μl reactions are needed. The PCR program was the same as for
Fluorescein. Samples were incubated for 2hrs with 0.5μl DpnI Samples
were purified with a Machery-Nagel PCR kit PCR kit The second wash step
was done with 80% ethanol and the samples were eluted with 60μl 0.1M
NaHCO3 pH9. Samples were incubated for 3hrs with DyLight650 or
DyLight550 (Thermo Fisher Scientific). Samples were purified with a
Machery-Nagel PCR kit. Labelling resulted in an incorporation of 1-3 pmol
as measured by Nanodrop.
Labelling with Alexa Fluor 5
Bioprime total genomic DNA labelling module (Thermo Fisher Scientific)
was used. Labelling with Alexa Fluor5 dNTP was done according to the
manufacturers protocol, but replacing the manufactures primer solution
with specific primers prMB013 and prMB014. pDG1664 was used as
template. Labelling resulted in an incorporation of between 5 and 9pmol as
measured by Nanodrop.
Labelling with Cy5/Cy3
Labelling with Cy3/Cy5-dUTP (Jena Bioscience) was done according to the
manufacturers protocol using pDG1664 as template and prMB013 and
prMB014 as primers. Labelling resulted in an incorporation of 1-2 pmol as
measured by Nanodrop.
Uptake of labelled DNA
135
Growth conditions
For the competence experiments A medium adapted from (Spizizen 1958)
and (Konkol et al., 2013) 18ml demi water, 2ml 10X competence medium
stock (0.615M K2HPO4 . 3H2O, 0.385M KH2PO4, 20% fructose, 10ml
300mM Tri-Na-citrate, 1ml 2% ferric NH4 citrate, 1g casein hydrolysate
(Oxoid), 2g potassium glutamate) 100μl 2mg/ml tryptophan, 67μl 1M
MgSO4.With the exception of BD4477 (Kramer et al., 2007) which was
grown using glucose as a carbon source. For the co-localisation
experiments of ComFC-GFP, RecA-YFP, ParB-GFP and ParB-mKate the
total volume was scaled up to a final volume of 20ml. For these experiment
the following conditions were used. A single colony was diluted 103-105 fold
in PBS or 1X Spizizen solution to ensure that the cultures are in the
exponential growth phase/early stationary after overnight growth. 100μl of
the diluted sc colony solution was added to 20ml medium 5μg/ml
chloramphenicol in 100 ml Erlenmeyer flasks and grown at 37 Celsius
220rpm. The overnight cultures were diluted to an OD600 of 0.05 in 20ml
medium without antibiotics. The Pxyl-comK strains were induced with 0.5%
xylose after 4hrs of growth. The Pspank-parB strains were also induced with
1mM of IPTG after 4hrs of growth.
Sample preparation
Cultures were incubated with DNA. At the desired time point for harvesting
the samples were incubated with 10U DNaseI in 400μl culture (Sigma-
Aldrich) for 10 minutes at 37°C. The samples were spun down (5000g) and
washed with 1X PBS. For fixing cells (20 minutes at room temperature) a
2% formaldehyde solution made from paraformaldehyde dissolved in 1X
PBS (pH7.4) was used. To protect the dyes samples were protected from
light exposure.
Slide preparation
Cells were immobilised using 1.5% agarose in 1X PBS, 10mM
sodiumacetate buffer pH4 or by polyacrylamide. Polyacrylamide slides
were made with 500μl 40% acrylamide, 1.5ml 1X PBS, 20μl 10%
ammonium persulfate and 2μl TEMED.
Chapter 4
136
A gene frame (Thermo Fisher Scientific or Westburg) was stuck on a glass
object carrier and the polyacrylamide was added and covered with another
object carrier. The slide was left to solidify after which the top slide was
removed and the solidified gel was washed 3x with 30 minutes with PBS.
The gel was kept in PBS until needed and cut in smaller pieces when
necessary. Microscopy was performed on a GE-healthcare OlympusIX71DV
or DVelite microscope. Images were deconvolved with the Softworks
imaging software. Analysis, colour assignment and overlay images were
created using ImageJ and saved as RGB Tiff. Images were put to a 300
pixels/inch CMYK format with Adobe photoshop.
Strain construction
The 168 amyE::pxyl-comK-cm_comFC-gfp-tet strain was obtained by
USER cloning. It consists of a fusion of gfp-DSM with a flexible linker from
JWV500 (Kjos et al., 2015) using primers prMB94 & prMB62 to comFC
prMB97 & prMB89 followed by the pBEST309 tetracyclin region (Itaya,
1992) primers prMB93 & prMB100 and the upstream flanking region of
comFC prMB88 & prMB62. The different components of the construct
were obtained by PCR with pfux7 (Nørholm, 2010), treated with USER
enzyme (NEB), ligated overnight at 4°C and transformed directly into 168
amyE::pxyl-comK-cm for integration into the native locus. The strain was
checked for proper integration by PCR and sequenced. B. subtilis
168_amyE::Pxyl-comK _thrC::Pspank-parB-gfp and B. subtilis 168
amyE::Pxyl-comK_thrC::Pspank- parB-mkate2 were created by
amplification of parB-mkate2 from pMK17 and parB-gfp from pMK11
(Kjos et al., 2015; Raaphorst et al., 2016) with primers 133 and 134. parB-
gfp and parB-mkate were cloned into pMB002 using NheI and HindIII
(FastDigest Thermo Scientific) ligated with T4 ligase (Thermo Scientific)
and transformed into E.coli DH5-α and sequenced. B. subtilis 168 amyE::
Pxyl-comK was transformed with pMB002-parB-mkate or pMB002-parB-
gfp. B. subtilis 168 amyE:: Pxyl-comK _Pcomg-gfp was created by
transformation with chromosomal DNA from B. subtilis 168 PcomG-gfp
(Smits et al., 2005).
Uptake of labelled DNA
137
strains genomic context reference
B. subtilis 168 Pxyl-comK amyE::PxylR-PxylA-comK, trpC2
cmr
(Hahn et al., 1996)
B. subtilis 168 Pxyl-comK-PcomG-
gfp
amyE:: PxylR-PxylA-comK -PcomG-
gfp, trpC2 cmr km
r
This study, made by Claudio
Tiecher
B. subtilis 168 Pxyl-
comK_comFC-gfp
amyE::PxylR-PxylA-comK_comFC-
gfp, trpC2 cmr tet
r
This study
B. subtilis 168 Pxyl-comK_Pspank-
parB-gfp
amyE:: PxylR-PxylA-comK_
thrC::Pspank parB-gfp, trpC2
cmrery
r
This study
B. subtilis 168 Pxyl-comK_parB-
mkate2
amyE:: PxylR-PxylA-comK_
thrC::Pspank parB-mkate2, trpC2
cmrery
r
This study
B. subtilis 168 BD4477 recA-yfp_amyE::Pspank-cfp-yjbF,
his leu met cmr, sp
r
(Kramer et al., 2007)
B.subtilis 168 PcomG-gfp PcomG-gfp kmr (Smits et al., 2005)
Primers
ID name sequence
prMB013 PDG1664-ery_F GGGAACGGTTGGAGCTAATG
prMB014 PDG1664-ery-R TTCCGGGAACAGTGACAGAG
prMB62 U-yvyF-R GATTTTAGAAUTGATTCTGTTTTTATGCCGATATAATC
prMB88 U-comFC-R TTAAGCTCGAUTATGGTGTGGAAACTGGAAG
prMB89 comFC-flank-F TGCATGCCTGUCATAGTATCCGGCACTGTTG
prMB93 tetL-R TTCTAAAATCUTTCCTGTTATAAAAAAAGGATCAATTTTG
prMB94 P2-mcherry-F GATCCGGATUCTGGTGGAGAAGCTGCAGCTAAAG
prMB97 P2-U-comFC-mcherry-F ATCCGGATCUGCTTCTGATCAAGGTAAAAG
prMB100 tetL-mcherry-F TAAGAATTCGUATGAACAGCTTATTTACATAATTCAC
prMB108 P3-gfp-dsm-R CGAATTCTTAUTTACTTATAAAGCTCATCCATGCCGTGAGTG
133 GATCAAGCTTGAGTACTGATTAACTAATAAGGAG
134 TACTAGCTAGCGCTATCAAAAGAATCTTGC
Chapter 4
138
References
Baitin, D.M., Gruenig, M.C., and Cox, M.M. (2008). SSB Antagonizes RecX-RecA
Interaction. J. Biol. Chem. 283, 14198–14204.
Chung, Y.S., and Dubnau, D. (1998). All Seven comG Open Reading Frames Are Required
for DNA Binding during Transformation of Competent Bacillus subtilis. J. Bacteriol. 180,
41–45.
Davidoff-Abelson, R., and Dubnau, D. (1973). Conditions Affecting the Isolation from
Transformed Cells of Bacillus subtilis of High-Molecular-Weight Single-Stranded
Deoxyribonucleic Acid of Donor Origin. J. Bacteriol. 116, 146–153.
Dempsey, G.T., Vaughan, J.C., Chen, K.H., Bates, M., and Zhuang, X. (2011). Evaluation of
fluorophores for optimal performance in localization-based super-resolution imaging.
Nat. Methods 8, 1027–1036.
Draskovic, I., and Dubnau, D. (2005). Biogenesis of a putative channel protein, ComEC,
required for DNA uptake: membrane topology, oligomerization and formation of
disulphide bonds. Mol. Microbiol. 55, 881–896.
Dubnau, D. (1999). Dna Uptake in Bacteria. Annu. Rev. Microbiol. 53, 217–244.
Grove, D.E., Willcox, S., Griffith, J.D., and Bryant, F.R. (2005). Differential Single-stranded
DNA Binding Properties of the Paralogous SsbA and SsbB Proteins from Streptococcus
pneumoniae. J. Biol. Chem. 280, 11067–11073.
Guérout-Fleury, A.-M., Frandsen, N., and Stragier, P. (1996). Plasmids for ectopic
integration in Bacillus subtilis. Gene 180, 57–61.
Hahn, J., Luttinger, A., and Dubnau, D. (1996). Regulatory inputs for the synthesis of
ComK, the competence transcription factor of Bacillus subtilis. Mol. Microbiol. 21, 763–
775.
Hahn, J., Maier, B., Haijema, B.J., Sheetz, M., and Dubnau, D. (2005). Transformation
Proteins and DNA Uptake Localize to the Cell Poles in Bacillus subtilis. Cell 122, 59–71.
Inamine, G.S., and Dubnau, D. (1995). ComEA, a Bacillus subtilis integral membrane
protein required for genetic transformation, is needed for both DNA binding and
transport. J. Bacteriol. 177, 3045–3051.
Itaya, M. (1992). Construction of a Novel Tetracycline Resistance Gene Cassette Useful as
a Marker on the Bacillus subtilis Chromosome. Biosci. Biotechnol. Biochem. 56, 685–686.
Kaufenstein, M., Laan, M. van der, and Graumann, P.L. (2011). The Three-Layered DNA
Uptake Machinery at the Cell Pole in Competent Bacillus subtilis Cells Is a Stable Complex.
J. Bacteriol. 193, 1633–1642.
Referencees
139
Kidane, D., and Graumann, P.L. (2005). Intracellular Protein and DNA Dynamics in
Competent Bacillus subtilis Cells. Cell 122, 73–84.
Kidane, D., Ayora, S., Sweasy, J.B., Graumann, P.L., and Alonso, J.C. (2012). The cell pole:
the site of cross talk between the DNA uptake and genetic recombination machinery. Crit.
Rev. Biochem. Mol. Biol. 47, 531–555.
Kjos, M., Aprianto, R., Fernandes, V.E., Andrew, P.W., Strijp, J.A.G. van, Nijland, R., and
Veening, J.-W. (2015). Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging
of Host-Pathogen Interactions. J. Bacteriol. 197, 807–818.
Konkol, M.A., Blair, K.M., and Kearns, D.B. (2013). Plasmid-Encoded ComI Inhibits
Competence in the Ancestral 3610 Strain of Bacillus subtilis. J. Bacteriol. 195, 4085–4093.
Kramer, N., Hahn, J., and Dubnau, D. (2007). Multiple interactions among the
competence proteins of Bacillus subtilis. Mol. Microbiol. 65, 454–464.
Takeno, M., Taguchi, H., and Akamatsu, T. (2011). Role of ComFA in controlling the DNA
uptake rate during transformation of competent Bacillus subtilis. J. Biosci. Bioeng. 111,
618–623.
Vagner, V., Claverys, J.-P., Ehrlich, S.D., and Méjean, V. (1990). Direction of DNA entry in
competent cells of Bacillus subtilis. Mol. Microbiol. 4, 1785–1788.
Viret, J.F., Bravo, A., and Alonso, J.C. (1991). Recombination-dependent concatemeric
plasmid replication. Microbiol. Rev. 55, 675–683.
Yadav, T., Carrasco, B., Myers, A.R., George, N.P., Keck, J.L., and Alonso, J.C. (2012).
Genetic recombination in Bacillus subtilis: a division of labor between two single-strand
DNA-binding proteins. Nucleic Acids Res. 40, 5546–5559.
Yadav, T., Carrasco, B., Serrano, E., and Alonso, J.C. (2014). Roles of Bacillus subtilis DprA
and SsbA in RecA-mediated Genetic Recombination. J. Biol. Chem. 289, 27640–27652.
Londoño-Vallejo, J.A., and Dubnau, D. (1993). comF, a Bacillus subtilis late competence
locus, encodes a protein similar to ATP-dependent RNA/DNA helicases. Mol. Microbiol. 9,
119–131.
Nørholm, M.H. (2010). A mutant Pfu DNA polymerase designed for advanced uracil-
excision DNA engineering. BMC Biotechnol. 10, 21.
Piechowska, M., and Fox, M.S. (1971). Fate of Transforming Deoxyribonucleate in
Bacillus subtilis. J. Bacteriol. 108, 680–689.
Provvedi, R., and Dubnau, D. (1999). ComEA is a DNA receptor for transformation of
competent Bacillus subtilis. Mol. Microbiol. 31, 271–280.
Raaphorst, R. van, Kjos, M., and Veening, J.-W. (2016). Chromosome segregation drives
division site selection in Streptococcus pneumoniae. BioRxiv 087627.
Chapter 4
140
Smits, W.K., Eschevins, C.C., Susanna, K.A., Bron, S., Kuipers, O.P., and Hamoen, L.W.
(2005). Stripping Bacillus: ComK auto-stimulation is responsible for the bistable response
in competence development. Mol. Microbiol. 56, 604–614.
Spizizen, J. (1958). Transformation of biochemically deficient strains of Bacillus subtilis by
deoxyribonucleate. Proceedings of the National Academy of Sciences, 44(10), 1072-1078.
Stingl, K., Müller, S., Scheidgen-Kleyboldt, G., Clausen, M., and Maier, B. (2010).
Composite system mediates two-step DNA uptake into Helicobacter pylori. Proc. Natl.
Acad. Sci. 107, 1184–1189.
Supplementary material Chapter 4
Images
Img. 1. Binding of labelled DNA to competent B. subtilis. (A). DyLight650 labelled DNA. (B) Fluorescein labelled DNA. C: Alexa Fluor 5 labelled DNA. Samples were incubated with 10U of DNaseI for 10minutes and washed to remove unspecific binding.
Supplementary material
141
Img. 2. Fluorescein labelled DNA localisation at pH 7.4 and pH4. (A). Fluorescein labelled DNA at pH7.4 occasionally shows foci at the border of the cells. (B). Fluorescein labelled DNA at pH4 does not show foci at the edge of cells. The chromosome was strained with DAPI.
Img. 3. Co-localisation of RecA-YFP with DyLight650 labelled DNA. A: Overlay of RecA-YFP and DyLight650-DNA. B: RecA-YFP. C: DyLight650-DNA.
Chapter 4
142
Tables
colonies reduction efficiency
Fluorescein-DNA 745 3
DyLight650-DNA 852 2.7
Unlabelled DNA 2340
nr.foci 1 2 3 4
nr.cells 465 110 22 2
percentage 77.6 18.4 3.7 0.3
Img. 4. Co-localisation ParB-GFP with DyLight650 labelled DNA. (A). Overlay of ParB-mKate and Fluorescein-DNA. (B) ParB-mKate. (C). Fluorescein -DNA. This image was changed from the draft of the thesis to improve quality in the print editon.
Table 1. Transformation of B. subtilis Pxyl-comK with Fluorescein-DNA, DyLight650-DNA and unlabelled DNA. The DNA contains the erythromycin marker and thrC flanking regions from pDG1664.
Table 2. Number of DyLight650-DNA foci per cell. Number of DNA foci after 1hr incubation with DyLight650 DNA and incubation with 10U DNaseI.
Supplementary material
143
time pole centre
pole/
chrom.
centre/
chrom. 2pole 2centre
pole/
cent. septum tot foci
tot
cells
15min 63 64 14 56 1 5 4 13 220 371
30min 76 57 5 35 2 4 3 4 186 500
45min 90 64 4 41 4 10 9 9 231 671
60min 58 37 6 39 4 8 8 11 171 578
75min 65 60 11 38 4 12 10 4 204 643
90min 53 65 8 46 4 26 7 14 223 559
120min 74 58 2 49 3 18 5 11 220 510
average 68 58 7 43 3 12 7 9 208 547
% 33 28 3 21 2 6 3 5 100
time pole centre
Pole/
chrom,
Centre/
chrom. 2pole 2centre
Pole/
cent. Sept.
tot
foci
tot
cells
1min 111 77 16 69 4 3 3 15 298 625
15min 112 72 21 72 5 9 10 23 324 817
30min 78 58 11 63 7 12 9 7 245 626
45min 130 80 18 65 9 20 12 15 349 736
60min 73 49 16 48 8 10 12 12 228 592
75min 73 66 43 59 3 6 12 11 273 517
Avrg. 96 67 21 63 6 10 10 14 286 652
% 34 23 7 22 2 3 3 5 100
Table 3. Localisation of Fluorescein labelled DNA. Localisation of DNA foci was followed over time by taking a sample at each time point and the average percentage of foci types during this period were calculated. See image 4 in main text for examples of localisation.
Table 4. Localisation of DyLight650 labelled DNA. Localisation of DNA foci was
followed over time by taking a sample at each time point and the average
percentage during this period was calculated.
Chapter 4
144
total nr. cells: 3369 DNA ComFC co-localisation
total nr. foci 1104 872 197
percentage cells with foci 33 26 6
Percentage co-localisation DNA/ComFC 23
total nr. cells: 1749 DNA RecA-YFP co-localisation
total nr. foci 890 115 30
percentage cells with foci 51 7 2
percentage co-localisation DNA/RecA 26
total nr. cells: 4538 DNA RecA-YFP co-localisation
total nr. foci 1992 631 98
percentage cells with foci 44 14 2
percentage co-localisation DNA/RecA 15
total nr. cells: 1252 DNA ParB-GFP co-localisation
total nr. foci 306 516 13
percentage cells with foci 28 41 1
percentage co-localisation DNA/ParB-GFP 3
Table 5. Co-localisation of DyLight650-DNA with ComFC-GFP after 10min of incubation with DNA. Co-localisation DNA/ComFC was calculated tot. nr. foci co-localistaion/tot. nr foci ComFC
Table 6. Co-localisation of DyLight650 labelled DNA with RecA-YFP after 15min of incubation with DNA. Co-localisation DNA/RecA was calculated tot. nr. foci co-localisation/tot. nr foci RecA
Table 7. Co-localisation of DyLight650 labelled DNA with RecA-YFP after 1hr of incubation with DNA. Co-localisation DNA/RecA was calculated tot. nr. foci co-localisation/tot. nr foci RecA
Table 8. Co-localisation of DyLight650 labelled DNA with ParB-GFP after 10min of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci co-localisation/tot. nr foci ParB
Supplementary material
145
total nr. cells: 1137 DNA ParB-GFP co-localisation
total nr. foci 1137 1110 75
percentage cells with foci 81 79 5
percentage co-localisation DNA/ParB-GFP 7
total nr. cells: 1292 DNA parB-mKate co-localisation
total nr. foci 310 470 36
percentage cells with foci 36 24 1.5
percentage overlap DNA/ParB-mKate 4
total nr. cells: 2200 DNA parB-mKate co-localisation
total nr. foci 1205 1173 107
percentage cells with foci 55 522 5
percentage overlap DNA/ParB-makte 9
Table 9. Co-localisation of DyLight650 labelled DNA with ParB-GFP after 1hr of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci co-localisation/tot. nr foci ParB
Table 10. Co-localisation of Fluorescein labelled DNA with ParB-mKate after 10min of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci co-localisation/tot. nr foci ParB
Table 11. Co-localisation of Fluorescein labelled DNA with ParB-mKate after 1hr of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci co-localisation/tot. nr foci ParB
Top Related