1
The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in Anti-HER2
Antibody-induced G1 Cell Cycle Arrest and Tumor Growth Inhibition*
Xiao-Feng Le§, Francois-Xavier Claret†, Amy Lammayot§, Ling Tian†, Deepa
Deshpande§, Ruth LaPushin†, Ana M. Tari‡, and Robert C. Bast, Jr§¶
From the Departments of Experimental Therapeutics§, Molecular Therapeutics†, and
Bioimmunnotherapy‡, The University of Texas M. D. Anderson Cancer Center, Houston,
Texas 77030, U.S.A.
* This work was supported in part by Grant CA39930 from the National Cancer Institute
(to R.C.B.), by Grant IRG3721206 from the University of Texas M. D. Anderson Cancer
Center (to X.F.L.), Grant CA90853 from the National Cancer Institute (to F.X.C.), and by
by DAMD 17-02-1-0459 from the U.S. Department of the Army (to A.M.T.)
¶ To whom correspondence should be addressed: The University of Texas M. D.
Anderson Cancer Center, 1515 Holcombe Blvd., Box 355, Houston, TX 77030-4009.
Phone: 713-792-77743; Fax: 713-792-7864; E-mail: [email protected]
Running Title: Role of p27Kip1 in anti-HER2 antibody’s anti-tumor effects
Key Words: p27Kip1, HER2, Herceptin, trastuzumab, phosphorylation, G1 arrest.
Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on April 16, 2003 as Manuscript M300848200 by guest on Septem
ber 5, 2020http://w
ww
.jbc.org/D
ownloaded from
2
ABSTRACT
Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2
complex and plays a major role in controlling cell cycle and cell growth. Our group and
others have reported that anti-HER2 monoclonal antibodies exert inhibitory effects on
HER2-overexpressing breast cancers through G1 cell cycle arrest associated with
induction of p27Kip1 and reduction of CDK2. The role of p27Kip1 in anti-HER2 antibody-
induced cell cycle arrest and growth inhibition is, however, still uncertain. Here we have
provided several lines of evidence supporting a critical role for p27Kip1 in the anti-HER2
antibody-induced G1 cell cycle arrest and tumor growth inhibition. Induction of p27Kip1
and G1 growth arrest by anti-HER2 antibody, murine 4D5 or humanized trastuzumab
(Herceptin) are concentration-dependent, time-dependent, irreversible, and long lasting.
The magnitude of G1 cell cycle arrest induced by trastuzumab or 4D5 is well correlated
with the level of p27Kip1 protein induced. Upregulation of p27Kip1 and G1 growth arrest
could no longer be removed with as little as 14-hrs treatment with trastuzumab. Anti-
HER2 antibody-induced p27Kip1 protein, G1 arrest, and growth inhibition persist at least
five days after a single treatment. The magnitude of growth inhibition of breast cancer
cells induced by anti-HER2 antibody closely parallels the level of p27Kip1 induced.
Induced expression of exogenous p27Kip1 results in a p27Kip1 level-dependent G1 cell
cycle arrest and growth inhibition similar to that obtained with anti-HER2 antibodies.
Reducing p27Kip1 expression using p27Kip1 small interfering RNA (SiRNA) blocks anti-
HER2 antibody-induced p27Kip1 upregulation and G1 arrest. Treatment with anti-HER2
antibody significantly increases the half-life of p27Kip1 protein. Inhibition of ubiquitin-
proteasome pathway, but not inhibition of calpain and caspase activities, upregulates
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
3
p27Kip1 protein to a degree comparable to that obtained with anti-HER2 antibodies. We
have further demonstrated that anti-HER2 antibody significantly decreases threonine
phosphorylation of p27Kip1 protein at position 187 (T187) and increases serine
phosphorylation of p27Kip1 protein at position 10 (S10). Expression of S10A and T187A
mutant p27Kip1 protein increases the fraction of cells in G1 and reduces a further
antibody-induced G1 arrest. Consequently, p27Kip1 plays an important role in the anti-
HER2 antibody-induced G1 cell cycle arrest and tumor growth inhibition through post-
translational regulation. Regulation of the phosphorylation of p27Kip1 protein is one of the
post-translational mechanisms by which anti-HER2 antibody upregulates the protein.
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
4
INTRODUCTION
The human epidermal growth factor receptor 2 (HER2, also known as c-neu or
ErbB-2) is a key member in the epidermal growth factor receptor (EGFR) family (1-4).
HER2, as a preferred heterodimer partner for other members in EGFR family, plays a
critical role in EGFR family signaling that is linked to a variety of cellular responses to
growth factors in both normal and abnormal conditions (1-4). When HER2 is over-
expresses in cells, normal signaling pathways are altered and growth control is
deregulated. HER2 is overexpressed in a number of cancers, including breast, ovarian,
gastric, colon, and non-small cell lung carcinomas (4, 5). A humanized monoclonal
antibody trastuzumab or Herceptin has been developed from the murine anti-HER2
monoclonal antibody 4D5. Trastuzumab has been successfully used in clinics to treat
patients with metastatic breast cancers that overexpress HER2 (4, 5). Trastuzumab
treatment can produce a response rate of 10% ~ 15% as a single agent in heavily pre-
treated patients with metastatic breast cancers that overexpress HER2 (6). Trastuzumab
treatment produces a response rate of 25% as a single agent in first-line management of
patients with HER2 positive metastatic breast cancer (7). Trastuzumab has further been
shown to enhance significantly the effectiveness of chemotherapy in patients whose
tumors over-express HER2 (4, 5). The combination of chemotherapy plus trastuzumab
has a much higher rate of response than chemotherapy alone (50% vs 32%) (8). The
combination of trastuzumab and chemotherapy also improve the time to disease
progression (7.4 vs 4.6 months) and the median response duration (9.1 vs 6.1 months)
when compared to chemotherapy alone (8). The mechanisms by which trastuzumab
affects growth of cancer cells and response to chemotherapy are not well understood.
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
5
One of the intracellular growth regulators that are affected by trastuzumab is
cyclin-dependent kinase (CDK) inhibitor p27Kip1. p27Kip1, as one of the most important
CDK inhibitors during cell cycle G1 phase, binds to the cyclin E-CDK2 complex and
plays a major role in controlling cell cycle (9). An increase in p27Kip1 protein causes
proliferating cells to exit from the cell cycle, whereas a decrease in p27Kip1 protein
promotes quiescent cells to resume cell proliferation. p27Kip1 protein is primarily
regulated post-transcriptionally at the level of both protein translation and protein
stability, although transcriptional regulation and non-covalent sequestration may also
occur (9-11). Among the post-transcriptional mechanisms, ubiquitin-proteasome
proteolysis is a major pathway for regulation of p27Kip1 protein (12). Phosphorylation of
p27Kip1 protein on threonine 187 (Thr187) by CDK2 prepares p27Kip1 protein for binding
to ubiquitin ligase SCFSkp2 that leads to 26S proteasome degradation (13-15). In contrast
to the phosphorylation of Thr187, the phosphorylation of p27Kip1 protein on serine 10
(Ser10) by human kinase interacting stathmin (hKIS) stabilizes p27Kip1 protein in G1 (16,
17). p27Kip1 protein has been reported to interact with c-Jun co-activator Jab1 (also known
as CSN5) and this interaction causes nuclear export of the p27Kip1 protein (18) and
modulates c-Jun-dependent trascription (19).
Because of the major impact of p27Kip1 in controlling cell cycle, the role of
p27Kip1 protein in human carcinogenesis has been indicated in a number of studies. Low
expression of p27Kip1 protein is associated with excessive cell proliferation and has been
linked to many types of human tumors including breast cancer (10). Low expression of
p27Kip1 protein is found to correlate reversibly with HER2 overexpression via HER2-
facilitated p27Kip1 degradation (20). Low levels of p27Kip1 protein correlates well with
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
6
higher-grade neoplasms and poor survival rates (10). A striking correlation between the
expression of tumor suppressor PTEN and the level of p27Kip1 protein is observed in
thyroid carcinoma (21). By down-regulating p27Kip1 protein via proteasomal degradation,
oncogenic fusion protein Bcr-Abl forces fibroblasts and hematopoietic cells to divide
under inappropriate conditions (22). Furthermore, targeted disruption of the p27Kip1 gene
increases body size of mice, leads to striking enlargement of multiple organs and the
development of pituitary tumors (23, 24).
In the pre-clinical setting, our group and others have demonstrated that anti-HER2
monoclonal antibodies exert inhibitory effects on HER2-overexpressing breast cancer
through induction of G1 cell cycle arrest associated with induction of p27Kip1 and
reduction of CDK2 (25-31). However, the role of p27Kip1 in anti-HER2 antibody-induced
G1 cell cycle arrest and growth inhibition is still uncertain. Here we have provided
several lines of evidence to support a critical role for p27Kip1 in the anti-HER2 antibody-
induced G1 cell cycle arrest and tumor growth. We have further shown that regulation of
the phosphorylation of p27Kip1 protein is one of the post-translational mechanisms by
which anti-HER2 antibody upregulates the protein.
EXPERIMENTAL PROCEDURES
Cell CultureTwo human breast cancer cell lines, SKBr3 and BT474, were
obtained from the American Type Culture Collection (ATCC, Manassas, VA). SKBr3 cells
were grown in complete medium containing RPMI 1640 medium (Invitrogen, Carlsbad,
CA) supplemented with 10% fetal bovine serum (FBS) (Sigma, St. Louis, MO), 2 mM L-
glutamine, 100 units/ml of penicillin, and 100 µg/ml streptomycin in humidified air with 5%
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
7
CO2 at 37oC. BT474 cells were grown in complete medium containing DEME (GIBCO,
Grand Island, NY) supplemented with 10% FBS, 2 mM L-glutamine, 100 units/ml of
penicillin, and 100 µg/ml streptomycin. For all experiments, cells were detached with 0.25%
trypsin-0.02% EDTA. For cell culture, 2-6 X 105 exponentially growing cells were plated
into 100-mm tissue culture dishes or 3 X 103 into 96-well plates in complete medium. After
culture overnight in complete medium, cells were treated with antibodies at different
concentrations as indicated in each Figure Legend in complete medium at 37oC for the
indicated time intervals.
ReagentsAntibodies reactive with phospho-Thr187 p27Kip1, phospho-Ser10
p27Kip1, and Jab1 were purchased from Zymed Laboratories Inc. (South San Francisco, CA).
An antibody to p27Kip1 was purchased from BD Transduction Laboratories (San Diego,
CA). An antibody to c-Myc was obtained from Upstate Biotechnology Incorporated (Lake
Placid, NY). A monoclonal antibody to β-actin was purchased from Sigma (St Louis, MO).
Anti-HER2 murine monoclonal antibody 4D5 and humanized monoclonal antibody
trastuzumab (Herceptin or HCT) were kindly provided by Genentech (South San
Francisco, CA). Human IgG1 (hIgG) purified from plasma of patients with myelomas was
obtained from Calbiochem (San Diego, CA) and dialyzed against sterile cold PBS in order
to eliminate sodium azide. Hybridoma cells specific for MOPC21, which was obtained from
the American Type Culture Collection (ATCC, Manassas, VA) was used to produce ascites
fluid and the immunoglobin was purified as previously reported (25). A Tet-Off gene
expression system was purchased from BD Biosciences Clontech (Palo Alto, CA).
Cycloheximide was purchased from Sigma (St. Louis, MO). Wild-type p27Kip1 and its
mutants (S10A and T187A) in pcDNA3.0 vector were kindly provided by Dr. Nakayama
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
8
KI (Departments of Molecular and Cellular Biology and Molecular Genetics, Medical
Institute of Bioregulation, Kyushu University, Fukuoka, Japan). A membrane-bound GFP
expression vector pEGFP-F was purchased from BD Biosciences Clontech (Palo Alto,
CA). A calpain inhibitor PD151746, a broad-caspase inhibitor II, and MG132 were
obtained from Calbiochem (San Diego, CA).
Anchorage-Dependent GrowthTwo different methods have been used to
assess the anchorage-dependent growth in this study. The first one was a 96-well
microplate crystal violet mitogenic assay that was modified from previous reports (25, 32).
Briefly, 3 x 103 of SKBr3 cells were plated into 96-well tissue culture plates in triplicate.
The cells were treated with anti-HER2 antibody (trastuzumab or 4D5), or control reagent
(hIgG for trastuzumab; MOPC21 for 4D5). After incubation for 3 days, the cells were
washed with PBS, fixed in 1% glutaraldehyde in PBS, and stained with 0.5% crystal violet
(Sigma, St Louis, MO) in methanol. The dye was eluted with Sorenson’ buffer (0.9%
sodium citrate, 0.02 N HCl, and 45% ethanol) and the eluted dye was measured by a
microplater reader Vmax (Molecular Devices, Sunnyvalle, CA) at lengthwave 540 nm. A
second method, a low-density long-term assay, was performed in 100-mm cell culture
dishes. Low cell density (BT474 cells at 1 x 105; SKBr3 cells at 1.5 x 104) was used when
plating the cells. After overnight incubation, the cells were treated with single dose of
anti-HER2 antibody (trastuzumab or 4D5), or control reagent (hIgG for trastuzumab;
MOPC21 for 4D5) in complete media for up to one week. No medium was changed
during the assay. Cells on day 3 ~ 7 after treatment were then harvested for enumeration
of cells with a Coulter counter (Coulter Electronics LTD, Miami, FL), p27Kip1 protein
detection by Western blotting, and cell cycle analysis by flow cytometry.
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
9
Anchorage-Independent GrowthTo determine the anchorage-independent cell
growth of SKBr3 cells, a colony-forming assay in soft agar was used as reported in our
previous studies (25).
Cell Cycle AnalysisCell cycle distribution was analyzed by flow cytometry.
Cells were trypsinized, washed once with PBS, and fixed overnight in 70% ethanol. Fixed
cells were centrifuged at 300 x g for 10 min and washed with PBS. Cell pellets were
resuspended in PBS containing 50 µg/ml of RNase A and 50 µg/ml propidium iodide and
incubated for 20 min at 37oC with gentle shaking. Stained cells were filtered through nylon
mesh (41 µM) and analyzed on a Coulter flow cytometer XL-MCL (Coulter Corporation,
Miami, FL) for relative DNA content based on red fluorescence levels. Doublets and cell
debris were excluded from the DNA histograms. The percentages of sub-G1 cell population
were determined based on relative DNA content. The percentages of cells in different cell
cycle compartments were determined using the MULTICYCLE software program (Phoenix
Flow Systems, San Diego, CA).
Preparation of Total Cell Lysate and Western Immunoblot AnalysisThe
procedures for preparation of total protein and Western immunoblot analysis were
performed as described previously (25).
Construction and Preparation of Inducible Adenovirus-p27Kip1 (Adp27)A
recombinant adenovirus vector expressing a doxycycline-regulated (Tet-Off) form of
p27Kip1 has been constructed according to the manufacturer’s recommendations
(Clontech, Palo Alto, CA). Briefly, the human full-length p27Kip1 cDNA [obtained
originally from polymerase chain reaction (PCR) and verified by DNA sequencing] was
cloned into pTRE-Shuutle2 vector. Recombinant adenoviral DNA containing myc-
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
10
p27Kip1 (Ad-myc-p27Kip1) was created through ligating pTRE-Shuutle2-myc--p27Kip1 to
Adeno-X viral DNA (Clontech). Large-scale production of high-titer Ad-myc-p27Kip1
was performed by growing HEK 293 cells on improved Eagle’s MEM supplemented with
10% Tet-free fetal bovine serum (Clontech), 4 mM L-glutamine, 100 units/ml penicillin
G sodium, 100 µg/ml streptomycin. The virus was purified twice using cesium-chloride
density gradient centrifugation. The viral vector was then dialyzed for 8 h at 4°C against
a buffer containing 10 mM Tris-HCl (pH 7.5), 1 mM MgCl2, and 10% glycerol and was
stored at -80°C.
Infection with Adp272 x 105 of SKBr3 cells were seeded in 100-mm cell
culture dishes and incubated at 37°C overnight. Cells were then coinfected with a 1:1
ratio of an adeno-X Tet-Off regulatory virus (Clontech) and Ad-myc-p27Kip1 virus
(created as described above) at different multiplicities of infection (MOI) or at an MOI of
20. The cells were cultured with 10% Tet-free fetal bovine serum in presence (+) of
absence (-) of doxycycline (1µg/ml). When applicable, doxycycline was re-added every
48 hrs. After 48 ~ 72 hrs, cells were harvested for enumeration with a Coulter counter,
Western blot analysis, and cell cycle analysis.
Small Interfering RNA (SiRNA) In order to silence p27Kip1 gene expression,
a single transfection of SiRNA duplex was performed using Oligofectamine reagent
(Invitrogen, Carlsbad, California) according to the manufacturer’s protocol. Two dsRNAs
with 21mers and d(TT) overhang were selected for the ability to silence p27Kip1
expression. p27Kip1 SiRNA #1 corresponds to nucleotides 217 to 238 of the human
p27Kip1 coding region (AAGTACGAGTGGCAAGAGGTG). p27Kip1 SiRNA #2
corresponds to nucleotides 139 to 160 of the human p27Kip1 coding region
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
11
(AAGCACTGCAGAGACATGGAA). The SiRNAs were synthesized at HPP grade
purity by Qiagen-Xeragon (Germantown, MD). A non-related control SiRNA, which
targeted DNA sequence AATTCTCCGAACGTGTCACGT with no significant match in
the complete human genome, was purchased from Qiagen-Xeragon that had been purified
under similar condition (Cat. #80-11310).
p27Kip1 Mutants and GFP Co-transfectionSKBr3 cells grown in 60mm
dishes were transfected with the 3.2 µg of appropriate expression plasmids (wildtype
p27Kip1, S10A p27Kip1, or T187A p27Kip1) plus 0.8 µg of pEGFP-F vector using 7 µl of
LipofectAMINE-2000 (Invitrogen) according to manufacturer’s instructions. Cells were
trypsinized and reseeded in two identical dishes after 24 hr transfection. One dish was
treated with anti-HER2 antibody 4D5 and the other was treated with diluent. After
incubation for another 24 hr, cells were collected and subjected to cell cycle analysis or
used to prepare protein. For cell cycle analysis, cells were first fixed in 0.25%
paraformaldehyde for 1.5 hr on ice and then stained with PI solution as described above.
Only the GFP positive population was gated and its cell cycle distribution was assessed.
The GFP positive rate in empty vector pcDNA3.0 was used to normalize other plasmids’
different transfection efficiency.
Statistical AnalysisThe two-tailed Student's t-test was used to compare two
different groups. Values with P<0.05 were considered significant.
RESULTS
Anti-HER2 Antibody Induces a Concentration-dependent Accumulation of
p27Kip1 Protein and a Corresponding Concentration-dependent G1 Cell Cycle
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
12
ArrestIn previous studies, we have shown that the anti-HER2 antibody ID5 induced
G1 cell cycle arrest through inhibition of CDK2 and induction of p27Kip1 (25). In this
study, we have employed the clinically approved anti-HER2 antibody trastuzumab and its
mouse precursor 4D5. Two breast cancer cell lines that overexpress HER2 protein,
SKBr3 and BT474 were used in our experiments. SKBr3 cells were treated for 24 hrs
with anti-HER2 antibody 4D5 at different concentrations or control mouse antibody
MOPC21 at 10 µg/ml. Cells were then divided into two portions: one for cell cycle
analysis and the other for total protein extraction and Western immunoblot analysis. As
shown in Figure 1A, 4D5 induced a dramatic and concentration-dependent increase in the
fraction of cells in G1 phase of the cell cycle. This G1 arrest was associated with a
dramatic and concentration-dependent decrease of cells in S phase. The decrease of cells
in G2/M phase was also concentration-dependent, but less impressive. The control
antibody MOPC21, as expected, did not cause G1 arrest (Fig. 1A). Importantly, G1 arrest
induced by 4D5 correlated closely with the induction of p27Kip1 in the same dose-
dependent manner (Fig. 1B). No p27Kip1 induction was observed in cells treated with
control antibody MOPC21 (Fig. 1B), which correlated well with no G1 arrest observed in
Figure 1A. These results were further confirmed in another HER2-overexpressing breast
cell line BT474. As shown in Figure 1C & 1D, 4D5 treatment resulted in a concentration-
dependent increase in the fraction of cells in G1 and a concentration-dependent induction
of p27Kip1 protein. The control antibody MOPC21 elicited no p27Kip1 protein and did not
cause any G1 arrest (Fig. 1C & 1D). These data demonstrate that anti-HER2 antibody
induces a concentration-dependent p27Kip1 accumulation and a corresponding G1 cell
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
13
cycle arrest, suggesting a role of p27Kip1 protein in anti-HER2 antibody-induced G1
arrest.
Anti-HER2 Antibody Induces a Time-dependent Accumulation of p27Kip1
Protein and a Corresponding Time-dependent G1 Cell Cycle ArrestWe next test
whether the induction of p27Kip1 protein and G1 arrest by anti-HER2 antibody also
behave in a similarly time-dependent manner. BT474 cells were treated with the anti-
HER2 antibody trastuzumab at 10 µg/ml or control human IgG protein (hIgG) for
different time intervals. Cells were then divided into two portions: one for cell cycle
analysis and the other for total protein extraction and Western immunoblot analysis. As
shown in Figure 2A, in BT474 cells trastuzumab induced a dramatic and time-dependent
increase of cells in G1 phase within 48 hrs. This G1 arrest accompanied a dramatic and
concentration-dependent decrease of S phase cells. In BT474 cells, the G1 arrest induced
by trastuzumab peaked around 48 hrs. The control hIgG, as expected, did not cause any
G1 arrest (Fig. 2A). Similar to the results in Figure 1, the trastuzumab-induced G1 arrest
correlated closely with the induction of p27Kip1 in the same time-dependent manner (Fig.
2B). Trastuzumab-induced p27Kip1 protein peaked at 48 hrs in BT474 cells (Fig. 2B),
which was in agreement with the G1 cell cycle arrest observed in Figure 2A. No p27Kip1
induction was observed in cells treated with control hIgG (Fig. 2B), which correlated
well with the level of G1 arrest observed in Figure 2A. These results were further
confirmed in the 4D5-treated SKBr3 cells. As shown in Figure 2C & 2D, 4D5 treatment
resulted in a time-dependent increase in the G1 fraction of cells and a time-dependent
induction of p27Kip1 protein. In SKBr3 cells, both p27Kip1 level and G1 arrest induced by
4D5 peaked around 24 hrs. The control antibody MOPC21 elicited no p27Kip1 protein nor
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
14
did it cause any G1 arrest (Fig. 2C & 2D). These data demonstrate that anti-HER2
antibody induces a time-dependent p27Kip1 accumulation and a corresponding G1 cell
cycle arrest, further suggesting a role of p27Kip1 protein in anti-HER2 antibody-induced
G1 arrest.
Anti-HER2 Antibody Induces an Irreversible Increase in p27Kip1 Protein and a
Corresponding G1 Cell Cycle ArrestTo determine whether anti-HER2 antibody-
induced p27Kip1 protein and G1 cell cycle arrest are reversible or irreversible, BT474 cells
were treated for different intervals with or without 10 µg/ml trastuzumab. At the different
intervals, cells were washed with media that lacked anti-HER2 antibody and were then
replenished with normal media that contained no antibody as illustrated in Figure 3A.
After 48 hrs, cells were harvested for measurement of p27Kip1 protein by Western
immunoblot and of cell cycle distribution by flow cytometry. Our preliminary data and
published data (25) have revealed that: 1) anti-HER2 antibody does not induce significant
p27Kip1 protein and G1 arrest within 8 hours upon antibody treatment; 2) The earliest time
interval for the anti-HER2 antibody to induce significant p27Kip1 protein and G1 arrest is
around 16 hours after treatment. Therefore, we have focused the time intervals between 8
and 16 hours after antibody treatment. As shown in Figure 3B, trastuzumab, as expected,
induced a dramatic expression of p27Kip1 protein and G1 arrest (84.9%) after 48 hrs
treatment compared to the untreated control. Treatment with trastuzumab for 8 hrs
induced little p27Kip1 protein and G1 arrest. Treatment with trastuzumab for 10 hrs and 12
hrs induced greater p27Kip1 protein and G1 arrest, which, however, did not differ
statistically from untreated control. At 14 hrs trastuzumab induced significant p27Kip1
protein and statistically significant G1 arrest (80.4%) when compared to the untreated
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
15
control (67.1%). These data indicate that statistically significant G1 cell cycle arrest and
elevation of p27Kip1 protein level induced by trastuzumab could no longer be removed
after 14-hrs treatment with antibody. Data in Figure 3B have also illustrated the close
correlation of the degree of G1 arrest with the level of p27Kip1 protein induced by anti-
HER2 antibody.
Growth Inhibition Induced by Anti-HER2 Antibody Correlates with the
Induced Level of p27Kip1 ProteinTo investigate whether the level of p27Kip1 protein
induced by anti-HER2 antibody correlates the magnitude of growth inhibition, we have
carried out two experiments. First, a microplate growth assay has been used to test the
correlation between p27Kip1 protein and anchorage-dependent growth as reported
previously (Ref. 32 and see Experimental Procedures for detail). For p27Kip1 protein
detection, BT474 cells at similar cell density to the microplate growth assay were plated
into 100-mm culture dishes and treated for 48 hrs with 4D5 and control antibody at
different concentrations. As shown in Figure 4, 4D5 induced a concentration-dependent
and anchorage-dependent growth inhibition (Fig. 4A) and a concentration-dependent
p27Kip1 accumulation in BT474 cells (Fig. 4B). Under the same conditions, control
antibody MOPC21 did not induce p27Kip1 protein at the highest concentration (Fig. 4B)
and any growth inhibition (Fig. 4A). Second, an anchorage-independent assay has been
employed to test the correlation between p27Kip1 protein and growth in soft agar as
previously reported (25). Again, for p27Kip1 protein determination, BT474 cells were
plated into 100-mm culture dishes under similar conditions to the growth assay and
treated for 48 hrs with 4D5 and control antibody at different concentrations. Anti-HER2
antibody 4D5 was found to induce concentration-dependent and anchorage-independent
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
16
growth inhibition of BT474 cells (Fig. 4C), whereas 4D5 induced a concentration-
dependent increase in p27Kip1 protein (Fig. 4D). Control antibody MOPC21 did not
induce p27Kip1 protein at the highest concentration (Fig. 4D) nor did it increase growth
inhibition (Fig. 4C). Taken together, these results suggest that growth inhibition induced
by anti-HER2 antibody correlates closely with the induced level of p27Kip1 protein in a
concentration-dependent manner.
Anti-HER2 Antibody Induces a Long-lasting Upregulation of p27Kip1 Protein,
G1 Cell Cycle Arrest, and Growth InhibitionAs described above and shown in
Figure 2, anti-HER2 antibodies, trastuzumab and 4D5, induced time-dependent p27Kip1
accumulaiton and a corresponding G1 cell cycle arrest up to 72 hrs in BT474 cells and 48
hrs in SKBr3 cells. To determine how long these anti-HER2 antibody’s effects would
last, we have investigated the effect of anti-HER2 antibody on p27Kip1 protein, G1 cell
cycle arrest, and cell growth over a prolonged period of time. In order to limit cell growth
to less than 75% confluency, low cell densities of cells were plated (BT474 cells at 1 x
105; SKBr3 cells at 1.5 x 104 in a 100-mm culture dish). After incubation overnight, the
cells were treated with single dose of anti-HER2 antibody (trastuzumab or 4D5), or
control reagent (hIgG for trastuzumab; MOPC21 for 4D5) up to one week. Cells on day 3
~ 7 after treatment were then harvested for enumeration of cells with a Coulter counter,
p27Kip1 protein detection by Western immunoblot, and cell cycle analysis by flow
cytometry. As shown in Figure 5A, trastuzumab induced an increase in p27Kip1 protein,
which was above control level on day 3 and day 5 in BT474 cells. Beyond 5 days, the
levels of p27Kip1 protein of trastuzumab- and control hIgG-treated cells were similar (data
not shown). Accordingly, treatment with trastuzumab produced an average of 84.8% of
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
17
BT474 cells in cell cycle G1 fraction on day 3 and 81.3% on day 5, whereas treatment
with control hIgG produced an average of 67.4% of cells in the G1 fraction on day 3 and
68.9% on day 5 (Fig. 5B). Beyond 5 days, the percentage of G1 fraction from
trastuzumab- and control hIgG-treated cells was not significantly different (data not
shown). As the result of the p27Kip1 upregulation and G1 arrest, trastuzumab produced
50% anchorage-dependent growth inhibition on day 3 and day 5 compared with a hIgG
control (Fig. 5C). Significant growth inhibition by trastuzumab was seen on day 6 and
day 7 (data not shown).
Similarly, 4D5 induced an increase in p27Kip1 protein, which was above the
control level on day 3 and day 5 in SKBr3 cells (Fig. 5D). Beyond 5 days, the levels of
p27Kip1 protein in 4D5- and control MOPC21-treated cells were not distinguishable (data
not shown). Accordingly, 4D5 treatment resulted in an average of 71.2% of SKBr3 cells
in the G1 phase of cell cycle on day 3 and 68.3% on day 5, whereas control MOPC21
generated an average of 56.2% of cells in G1 fraction on day 3 and 58.1% on day 5 (Fig.
5E). Beyond 5 days, the percentage of cells in G1 after treatment with 4D5 and with
control MOPC21 was not significantly different (data not shown). As the result of the
p27Kip1 upregulation and G1 arrest, 4D5 generated about 34% anchorage-dependent
growth inhibition on day3 and 50% on day 5 compared to MOPC21 control (Fig. 5F).
Compared to control, significant growth inhibition by 4D5 lasted on day 6 and day 7
(data not shown). Taken together, these data demonstrate that a single dose treatment of
anti-HER2 antibody induces a long-lasting p27Kip1 upregulation, G1 cell cycle arrest, and
growth inhibition in HER2-overexpressing breast cancer cells. These data reiterate the
correlation of G1 arrest induced by anti-HER2 antibody with the level of p27Kip1 protein.
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
18
Above data also indicate, however, that there is no time-dependent correlation of growth
inhibition induced by anti-HER2 antibody with the level of p27Kip1 protein.
Induced Expression of p27Kip1 Produces G1 Cell Cycle Arrest and Growth
Inhibition Similar to That Observed with Anti-HER2 AntibodyTo demonstrate the
important role of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle arrest and
growth inhibition, a recombinant adenovirus vector expressing a doxycycline-controlled
human p27Kip1 (Adp27, Tet-Off form) has been created. Based on our previous
experience (33), we have first tested the Adp27 in SKBr3 breast cancer cells that
overxpress HER2 protein. As expected, Adp27 did not express induced p27Kip1 protein
that was tagged with c-Myc in the presence of doxycycline (Fig. 6A), suggesting there
was no leakage of this inducible system at indicated MOIs. In the absence of
doxycycline, Adp27 was induced to express p27Kip1 protein in a MOI-dependent manner
(Fig. 6A), suggesting effective control of p27Kip1 in this adenovirus system. Accordingly,
induced Adp27 produced an average of 59.6% cells in G1 phase at a MOI of 2 and 79.8%
at a MOI of 20, whereas uninduced Adp27 produced an average of 47.0% in G1 phase at
2 MOI and 48.3% at 20 MOI (Fig. 6B). As shown in Figure 6C, induced Adp27 at 2 MOI
resulted in an average of 16% anchorage-dependent growth inhibition compared to
uninduced Adp27, whereas induced Adp27 at 20 MOI resulted in an average of 40%
anchorage-dependent growth inhibition compared to uninduced Adp27. In addition to
SKBr3 cells, we have also tested Adp27 in another HER2-overexpressing breast cancer
cell line, BT474, and obtained similar results (data not shown). These observations
clearly illustrated that expression of p27Kip1 protein resulted in p27Kip1 level-dependent
G1 cell cycle arrest and growth inhibition. Thus, these data strongly indicate the
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
19
importance of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle arrest and
growth inhibition.
Silencing Expression of p27Kip1 Blocks Anti-HER2 Antibody Mediated
Induction of p27Kip1 Protein and G1 ArrestTo further demonstrate the important
role of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle arrest, we have
employed p27Kip1 SiRNA approach to silence the expression of p27Kip1. If p27Kip1
expression is critical to anti-HER2 antibody-induced G1 cell cycle arrest, the effect of
anti-HER2 antibody on G1 arrest should be dramatically decreased when p27Kip1
expression is impaired. Two p27Kip1 SiRNAs (#1 and #2) that we have selected in this
study were capable of effectively silencing p27Kip1 expression in SKBr3 cells after 48 hr
transfection as shown in Figure 7A. 4D5-induced p27Kip1 protein was completely blocked
in cells treated with p27Kip1 SiRNA #1, whereas 4D5-induced p27Kip1 protein was not
significantly affected in cells treated with control SiRNA (Fig. 7B). A similar effect on
4D5-induced p27Kip1 protein was observed with p27Kip1 SiRNA #2 (Data not shown). In
agreement with the level of p27Kip1 protein, 4D5-induced G1 arrest was also completely
prevented in the cells treated with p27Kip1 SiRNA #1, whereas 4D5-induced p27Kip1
protein was not significantly affected in the cells treated with control SiRNA (Fig. 7C).
Thus, the important role of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle
arrest is further confirmed.
Anti-HER2 Antibody Significantly Increases the Half-life of p27Kip1
ProteinOur preliminary data obtained from Northern blots and reverse transcription-
PCR suggested that anti-HER2 antibody did not increase the amount of p27Kip1 mRNA
(Data not shown). Thus, anti-HER2 antibody may upregulate p27Kip1 protein primarily
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
20
through post-translational mechanisms. To confirm that anti-HER2 antibody-induced
p27Kip1 protein is due to post-translational events, we have measured the half-life of
p27Kip1 protein. BT474 cells were treated with trastuzumab for 48 hrs and then treated
with an inhibitor of protein synthesis, cyclohexamide, at 5 µg/ml, for different time
intervals as indicated in Figure 8A. Cells were harvested for Western blot analysis to
check the level of p27Kip1 protein. As shown in Figure 8A, the level of p27Kip1 protein in
trastuzumab-treated cells declined gradually with time but at a much slower rate than in
hIgG-treated cells. After normalization of p27Kip1 expression with the loading control (β-
actin), the half-life of p27Kip1 protein in trastuzumab-treated cells was about 5.0 hrs,
whereas the half-life of p27Kip1 protein in hIgG-treated cells was about 1.8 hrs (Fig. 8B).
The prolonged half-life of p27Kip1 protein in anti-HER2 antibody-treated cells was also
confirmed by the 35S-labeled pulse-chase experiments (data not shown). Therefore, these
results illustrate that anti-HER2 antibody significantly increases the half-life of p27kip1
protein and suggest the accumulation of p27Kip1 protein induced by anti-HER2 antibody
results from post-translational mechanisms.
Anti-HER2 Antibody Significantly Decreases Threonine Phosphorylation of
p27Kip1 Protein at Position 187 and Increases Serine Phosphorylation of p27Kip1 Protein
at Position 10The results described above support the idea that anti-HER2 antibody
induces p27Kip1 expression through post-translational regulation. Ubiquitin-proteasome
proteolysis plays a major role in regulating p27Kip1 protein (12). We have tested the
importance of this mechanism in SKBr3 cells using an ubiquitin-proteasome inhibitor
MG132. As shown in Figure 9A, treatment with MG132 significantly increased the level
of p27Kip1 protein, whereas the inhibition of calpain or caspase activity did not alter
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
21
p27Kip1 expression. These data support the important role of ubiquitin-proteasome
proteolysis in regulation of p27Kip1 protein in SKBr3 cells. Phosphorylation of p27Kip1
protein has been widely recognized to be one of the major post-translational mechanisms
that regulate the abundance of this protein (10, 12-15). Phosphorylation of p27Kip1 protein
at Threonine 187 (T187) by CDK2 results in the recognition by E3 proteasome complex
for protein degradation (13-15). Phosphorylation of p27Kip1 protein at Serine 10 (S10) has
been shown to increase dramatically the expression of this protein (16,17). Consequently,
we have investigated the phosphorylation status at these two common sites of p27Kip1
protein using site- and phoshpho-specific antibodies against phosphorylated p27Kip1
protein. As shown in Figure 9B, anti-HER2 antibody 4D5 considerably decreased the
T187 phosphorylation of p27Kip1 protein in SKBr3 cells. At the same time, 4D5
considerably increased the S10 phosphorylation of p27Kip1 protein (Fig. 9B). The level of
Jab1, a regulator of p27Kip1 expression (18,19), decreased only slightly. Similarly, anti-
HER2 antibody trastuzumab decreased T187 phosphorylation and increased S10
phosphorylation of p27Kip1 protein in another breast cancer cell line BT474 (Fig. 9C). The
effect of S10 phosphorylation and T187 phosphorylation on anti-HER2 antibody-induced
G1 cell cycle arrest was further investigated using p27 mutants (12) and pGFP co-
transfection as described in Materials and Methods and Figure 10A. The GFP
transfection efficiency for vectors expressing wild-type p27, S10A p27 (Serine 10 was
converted to Alanine 10), and T187A p27 (Threonine 187 was converted to Alanine 187)
ranged from 34% to 50%. Since the ratio of individual gene expression vector to GFP
vector used in the transfection was 4:1, GFP-positive cells were considered to
simultaneously express the individual gene of interest. As shown in Figure 10B, S10A
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
22
p27 expression increased the fraction of cells in G1 and rendered the cells much less
sensitive to 4D5-induced G1 arrest than was observed after transfection of a control
vector or wild-type p27. These results confirm S10 phosphorylation is important to anti-
HER2 antibody-induced G1 arrest. Cells expressing T187A p27 also showed less
sensitivity to 4D5-induced G1 arrest (Fig. 10B). As anti-HER2 antibody decreases T187
phosphorylation, the T187A mutant p27Kip1 protein already lacks phosphorylation and
should not respond to antibody. Taken together, these results showed that regulation of
the phosphorylation of p27Kip1 protein might present one of the post-translational
mechanisms by which anti-HER2 antibody upregulates the protein. The data strongly
suggest the different role of T187 and S10 phosphorylation in regulation of p27Kip1
protein, in which phosphorylation of p27Kip1 protein at T187 promotes protein
degradation, whereas phosphorylation of p27Kip1 protein at S10 stabilizes the protein.
DISCUSSION
Our data demonstrate that p27Kip1 plays a critical role in the anti-HER2 antibody-
induced G1 cell cycle arrest and tumor growth inhibition. p27Kip1 upregulation and
corresponding G1 cell cycle arrest induced by anti-HER2 antibody are not only
concentration-dependent, but also time-dependent. The magnitude of G1 cell cycle arrest
induced by anti-HER2 antibody is correlated well with the level of p27Kip1 protein
induced. The magnitude of growth inhibition of breast cancer cells treated with anti-
HER2 antibody parallels closely the level of p27Kip1 induced. Induced expression of
exogenous p27Kip1 with an inducible system results in a similar G1 cell cycle arrest and
growth inhibition to that obtained with anti-HER2 antibody. Inhibition of
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
23
p27Kip1expression by p27Kip1 anti-sense cDNA significantly impairs, but does not
completely eliminate anti-HER2 antibody-induced p27Kip1 protein, G1 arrest, and growth
inhibition. Our data also illustrate that the majority of G1 arrest induced by anti-HER2
antibody can no longer be removed after 14 hrs of treatment. Anti-HER2 antibody-
induced p27Kip1 protein, G1 arrest, and growth inhibition last at least five days after a
single treatment. Our data further demonstrate that anti-HER2 antibody increases the
half-life of p27kip1 protein. Anti-HER2 antibody is able to decrease threonine
phosphorylation of p27kip1 protein at position 187 and increase serine phosphorylation of
p27kip1 protein at position 10. Therefore, upregulation of p27Kip1 by anti-HER2 antibody
occurs primarily through post-translational mechanisms. Regulation of the
phosphorylation of p27Kip1 protein is identified as one of the post-translational
mechanisms by which anti-HER2 antibody up-regulates the protein.
Definition of the role p27Kip1 in the anti-HER2 antibody-induced G1 cell cycle
arrest and tumor growth inhibition is important. p27Kip1 protein appears to be a critical
downstream target of signaling through HER2 molecule. Elucidation of the role p27Kip1
in the anti-HER2 antibody-induced tumor growth inhibition also indicates that any
factors that affect p27Kip1 level might also influence anti-HER2 antibody-induced tumor
growth inhibition. Modulation of p27Kip1 protein by multiple pathways might be exploited
in the treatment of cancer in animal models and ultimately in clinical trials that include
trastuzumab. At a minimum, levels of p27Kip1 protein observed after trastuzumab therapy
might be an intermediate biomarker for response to the antibody alone.
Expression of p27Kip1 protein is a short event as the protein generally has short
half-life as shown in Figure 8. However, growth inhibition of HER2-overexpressing
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
24
cancer cells induced by the antibody is a long-lasting event as the effect is cumulative.
Therefore, the time-dependent correlation between growth and the level of p27Kip1 protein
could not be established. Recently, Yakes et al reported that antisense ODN of p27Kip1
prevented trastuzumab-induced reduction of cells in S phase and induction of cells in G1
phase (31), confirming our observation in Figure 7.
In this study, we provide data to indicate that anti-HER2 antibody needs at least
14 hrs to exhibit its anti-tumor effects on G1 arrest and p27Kip1 upregulation. After 14 hrs,
90% of the anti-tumor effect of anti-HER2 antibody can no longer be removed. Our data
also indicate that a single dose of anti-HER2 antibody produces a long-lasting p27Kip1
upregulaiton and G1 cell cycle arrest for at least five days and inhibits cancer cell growth
for at least a week. These results are consistent with the administration of trastuzumab to
patients on a weekly basis in clinic. In a severe combined immunodeficient (SCID) mice
model, Tokuda et al also showed that a single dose of trastuzumab inhibited about 50%
tumor growth of HER2-overexpressing 4-1ST human gastric carcinoma (34).
Our data support the notion that p27Kip1 upregulaiton by anti-HER2 antibody is
through a post-translational mechanism. Regulation of p27Kip1 phoshorylation by anti-
HER2 antibody is one of the mechanisms leading to stabilization and accumulation of the
protein. Recent reports have shown that different phoshorylation patterns of p27Kip1
determine its binding to cyclin D1 or to cyclin E (35). Thr187 and Ser10 are two major
sites for p27Kip1 phoshorylation that regulate its abundance in the cell (13-17).
Degradation of p27Kip1 protein depends on: phosphorylation of Thr187 by cyclin E-
CDK2 complex, transportation form the nucleus to the cytoplasm; then ubiquitination
mediated by SCFSkp2, and finally proteolysis by the 26S proteasome (10-15). How
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
25
phosphorylation of Ser10 increases the stability of p27Kip1 protein is still unknown. Two
new phoshorylation sites on p27Kip1 have recently been identified. Three independent
groups have reported that Threonine 157 of p27Kip1 can be phosphorylated by PKB/AKT
(36-38). Fujita et al found that Threonine 198 of p27Kip1 could also be phosphorylated by
PKB/AKT (39). Threonine 157 and 198 phosphorylation have been linked to regulate the
cellular localization of p27Kip1, in that phosphorylation of these two sites blocks nuclear
import of p27Kip1 (16, 17, 36-39). Thus, different phosphorylation events can affect not
only the levels of p27Kip1 protein but also its subcellular localization. It will be worthy to
investigate the impact of trastuzumab treatment on Threonine 157 and 198
phosphorylation of p27Kip1 protein.
AcknowledgementsWe sincerely thank Genentech Corp (South San Francisco,
CA) for providing Trastuzumab (Herceptin) and 4D5 monoclonal antibodies against
HER2; Dr. Nakayama KI at Departments of Molecular and Cellular Biology and
Molecular Genetics, Medical Institute of Bioregulation, Kyushu University (Fukuoka,
Japan) for providing the p27Kip1 wildtype and mutants constructs; and Mrs. Karen
Ramirez at Flow Cytometry Core Laboratory (Smith Research Building) of M. D.
Anderson Cancer Center (Houston, TX) for her expert assistance with flow cytometry
analysis.
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
26
REFERENCES
1. Harari, D., and Yarden, Y. (2000) Oncogene 19, 6102-6114
2. Stern, D. F. (2000) Breast Cancer Res. 2, 176-183
3. Yarden, Y., and Sliwkowski, M. X. (2001) Nat. Rev. Mol. Cell Biol. 2, 127-137
4. Mendelsohn, J., and Baselga, J. (2000) Oncogene 19, 6550-6565
5. Pegram, M. D., and Slamon, D. J. (2000) Cancer Treat. Res. 103, 57-75
6. Cobleigh, M., Vogel, C., Tripathy, D., et al. (1999) J. Clin. Oncol. 17, 2639-2648
7. Vogel, C., Cobleigh, M., Tripathy, D., et al. (2002) J. Clin. Oncol. 20, 719-726
8. Slamon, D., Leyland-Jon, B., Shak, S., et al. (2001) N. Engl. J. Med. 344, 783-792
9. Sherr, C. J., and Roberts, J. M. (1999) Genes & Dev. 13, 1501-1512
10. Philipp-Staheli, J., Payne, S. R., and Kemp, C. J. (2001) Exp. Cell. Res. 264, 148-
168
11. Hengst, L., and Reed, S. I. (1996) Science 271, 1861-1864
12. Pagano, M., Tam, S. W., Theodoras, A. M., Beer-Romero, P., Del Sal, G., Chau,
V., Yew, P. R., Draetta, G. F., and Rolfe, M. (1995) Science 269, 682-685
13. Vlach, J., Hennecke, S., and Amati, B. (2002) EMBO J. 21, 3390-3401
14. Harper, J. W. (2001) Curr. Biol. 11, R431-435
15. DeSalle, L. M., and Pagano, M. (2001) FEBS Lett. 490, 179-189
16. Ishida, N., Kitagawa, M., Hatakeyama, S., and Nakayama, K. (2000) J. Biol.
Chem. 275, 25146-25154
17. Boehm, M., Yoshimoto, T., Crook, M. F., Nallamshetty, S., True, A., Nabel, G.
J., and Nabel, E. G. (2002) EMBO J. 21, 3390-3401
18. Tomoda, K., Kubota, Y., and Kato, J. (1999) Nature 398, 160-165
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
27
19. Chopra, S., Fernandez, D., Mattos S, Lam, E. W., and Mann, D. J. (2002) J. Biol.
Chem. 277, 32413-32416
20. Yang, H. Y., Zhou, B. P., Hung, M. C., and Lee, M. H. 2000; J. Biol. Chem. 275,
24735-24739.
21. Bruni, P., Boccia, A., Baldassarre, G., Trapasso, F., Santoro, M., Chiappetta, G.,
Fusco, A., and Viglietto, G. (2000) Oncogene 19, 3146-5315
22. Jonuleit, T., van der Kuip, H., Miething, C., Michels, H., Hallek, M., Duyster, J.,
and Aulitzky, W. E. (2000) Blood 96, 1933-1399
23. Nakayama, K., Ishida, N., Shirane, M., Inomata, A., Inoue, T., Shishido, N.,
Horii, I., Loh, D.Y., and Nakayama, K. (1996) Cell 85, 707-720
24. Fero, M. L., Rivkin, M., Tasch, M., Porter, P., Carow, C. E., Firpo, E., Polyak, K.,
Tsai, L. H., Broudy, V., Perlmutter, R. M., Kaushansky, K., and Roberts, J. M.
(1996) Cell 85, 733-744
25. Le, X. -F., McWatters, A., Wiener, J., Mills, G.B., and Bast, R.C., Jr. (2000) Clin.
Cancer Res. 6: 260-270
26. Neve, R. M., Sutterluty, H., Pullen, N., Lane, H. A., Daly, J. M., Krek, W., and
Hynes, N. E. (2000) Oncogene 19, 1647-5166
27. Pietras, R. J., Poen, J. C., Gallardo, D., Wongvipat, P. N., Lee, H. J., and Slamon,
D. J. (1999) Cancer Res. 59, 1347-1355
28. Ye, D. W., Fan, Z., and Mendelsohn, J. (1999) Oncogene 18, 731-738
29. Sliwkowski, M. X., Lofgren, J. A., Lewis, G. D., Hotaling, T. E., Fendly, B. M.,
and Fox, J. A. (1999) Semin. Oncol., 26 (4 Suppl 12), 60-70
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
28
30. Lane, H. A., Beuvink, I., Motoyama, A. B., Daly, J. M., Neve, R. M., and Hynes,
N. E. (2000) Mol. Cell. Biol. 20, 3210-3223
31. Yakes, F. M., Chinratanalab, W., Ritter, C. A., King, W., Seelig, S., and Arteaga,
C. L. (2002) Cancer Res. 62, 4132-4141
32. Pegram, M. D., Finn, R. S., Arzoo, K., Beryt, M., Pietras, R. J., and Slamon, D. J.
(1997) Oncogene 15, 537-547
33. Le, X. -F., Marcelli, M., McWatters, A., Nan, B., Mills, G. B., O’Brian, C. A.,
and Bast, R.C., Jr. (2001) Oncogene 20, 8258-8269
34. Tokuda, Y., Ohnishi, Y., Shimamura, K., Iwasawa, M., Yoshimura, M., Ueyama,
Y., Tamaoki, N., Tajima, T., and Mitomi, T. (1996) Br. J. Cancer 73, 1362-1365
35. Ciarallo, S., Subramaniam, V., Hung, W., Lee, J. H., Kotchetkov, R., Sandhu, C.,
Milic, A., and Slingerland, J. M. (2002) Mol. Cell. Biol. 22, 2993-3002
36. Liang, J., Zubovitz, J., Petrocelli, T., Kotchetkov, R., Connor, M. K., Han, K.,
Lee, J. H., Ciarallo, S., Catzavelos, C., Beniston, R., Franssen, E., and
Slingerland, J. M. (2002) Nat. Med. 8, 1153-1160
37. Shin, I., Yakes, F. M., Rojo, F., Shin, N. Y., Bakin, A.V., Baselga, J., and
Arteaga, C. L. (2002) Nat. Med. 8, 1145-1152
38. Viglietto, G., Motti, M. L., Bruni, P., Melillo, R. M., D'Alessio, A., Califano, D.,
Vinci, F., Chiappetta, G., Tsichlis, P., Bellacosa, A., Fusco, A., and Santoro, M.
(2002) Nat. Med. 8, 1136-1144
39. Fujita, N., Sato, S., Katayama, K., and Tsuruo, T. (2002) J. Biol. Chem. 277,
28706-28713
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
29
FIGURE LEGENDS
Fig. 1. Anti-HER2 antibody induces a concentration-dependent
accumulation of p27Kip1 protein and a corresponding concentration-dependent G1
cell cycle arrest. SKBr3 cells (panel A, B) were treated for 24 hrs with anti-HER2
antibody 4D5 at indicated concentrations or control mouse antibody MOPC21 at 10
µg/ml. Cells were then divided into two portions: one for measurement of cell cycle
distribution by flow cytometry (A) and the other for total protein extraction and
quantitation of p27Kip1 protein by Western blotting (B). Similarly, BT474 cells (panel C,
D) were treated for 48 hrs with anti-HER2 antibody 4D5 at indicated concentrations or
control antibody MOPC21 at 10 µg/ml. Cells were then divided into two portions: one for
measurement of cell cycle distribution by flow cytometry (C) and another for total
protein extraction and detection of p27Kip1 protein by Western blotting (D). Results in this
figure are representative of three replicate experiments. For the protein loading control,
the same blot was stripped and re-probed with an anti-ß-actin antibody.
Fig. 2. Anti-HER2 antibody induces a time-dependent accumulation of
p27Kip1 protein and a corresponding time-dependent G1 cell cycle arrest. BT474
cells (panel A, B) were treated for 72 hrs with anti-HER2 antibody trastuzumab at 10
µg/ml for the indicated time intervals or with human IgG protein (hIgG) as a control at 10
µg/ml. Cells were then divided into two portions: one for cell cycle analysis and the other
for total protein extraction and Western blot analysis. A, Measurement of cell cycle
distribution by flow cytometry. B, Quantitation of p27Kip1 protein by Western blotting.
SKBr3 cells (panel C, D) were treated for 48 hrs with anti-HER2 antibody 4D5 at 3µg/ml
for the indicated time intervals or control MOPC21 at 3µg/ml. C, Detection of cell cycle
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
30
distribution by flow cytometry. D, Detection of p27Kip1 protein by Western blotting.
Results in this figure are representative of three replicate experiments. For the protein
loading control, the same blot was stripped and re-probed with an anti-ß-actin antibody.
Fig. 3. Anti-HER2 antibody induces an irreversible increase in p27Kip1
protein and a corresponding G1 cell cycle arrest. A, Schematic illustration of the
experimental design. BT474 cells were treated with or without trastuzumab at 10 µg/ml.
B, Measurement of p27Kip1 protein by Western blotting and of cell cycle distribution by
flow cytometry. Results in this figure are representative of three replicate experiments.
For the protein loading control, the same blot was stripped and re-probed with an anti-ß-
actin antibody. * indicates a statistically significant difference compared to the untreated
control.
Fig. 4. Growth inhibition induced by anti-HER2 antibody correlates with the
induced level of p27Kip1 protein. BT474 cells were treated with 4D5 at the
concentrations indicated. A, Anchorage-dependent growth assay was performed in 96-
well microplates as described in Experimental Procedures. B, Measurement of p27Kip1
protein by Western blot analysis. BT474 cells at similar cell density to the microplate
growth assay were plated into 100-mm culture dishes and treated for 48 hrs with 4D5 or
control antibody at similar conditions. C, Anchorage-independent growth assay was
measured by clonogenic growth in soft agar as described in Experimental Procedures. D,
Measurement of p27Kip1 protein by Western blot analysis. BT474 cells at similar cell
density to the colony-formation assay were plated into 100-mm culture dishes and treated
with 4D5 or control antibody at similar concentrations for 48 hrs. Results in this figure
are representative of three replicate experiments.
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
31
Fig. 5. Anti-HER2 antibody induces a long-lasting upregulation of p27Kip1
protein, G1 cell cycle arrest, and growth inhibition. BT474 cells (panel A, B, C) at cell
density of 1 x 105 per 100-mm cell culture dish were treated with single dose of
trastuzumab or control hIgG for different time intervals. Cells on day 3 and day 5 after
treatment were then harvested and enumerated with a Coulter counter, p27Kip1 protein
was measured, and cell cycle analyzed. A, Detection of p27Kip1 by Western blot analysis.
For the protein loading control, the same blot was stripped and re-probed with an anti-ß-
actin antibody. B, Cell cycle distribution by flow cytometry. HCT represents Herceptin or
trastuzumab. C, Cell growth measured with a Coulter counter. *, P = 0.012 compared
with day3 hIgG control; **, P = 0.001 compared with day5 hIgG control. SKBr3 cells
(1.5 x 104 in a 100-mm culture dish) (panel D, E, F) were treated with single dose of 4D5
or control MOPC21 as described above. D, Detection of p27Kip1 by Western blot analysis.
For the protein loading control, the same blot was stripped and re-probed with an anti-ß-
actin antibody. E, Cell cycle distribution by flow cytometry. F Cell growth measured
with a Coulter counter. † indicates a statistically significant difference from day3
MOPC21 control (P = 0.04); ‡ denote a statistically significant difference from day5
MOPC21 control (P = 0.009). Results in this figure are representative of three replicate
experiments.
Fig. 6. Induced expression of p27Kip1 protein produces G1 cell cycle arrest
and growth inhibition similar to that observed with anti-HER2 antibody. SKBr3
cells (2 x 105) were seeded in 100-mm cell culture dishes and incubated overnight at
37oC. Cells were then coinfected with a regulatory virus (adeno-X Tet-Off) and Ad-Myc-
p27Kip1 virus at different multiplicities of infection (MOI) or at a MOI of 20 in presence
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
32
(+) of absence (-) of doxycycline. After 72 hrs, cells were harvested for enumeration with
a Coulter counter, Western blot analysis, and cell cycle analysis. A, Detection of Myc-
p27Kip1 by Western blot analysis with an anti-Myc antibody. For the protein loading
control, the same blot was stripped and re-probed with an anti-ß-actin antibody. B, Effect
of induced Myc-p27Kip1 on cell cycle distribution. † indicates a statistically significant
difference from 2 MOI uninduced group; ‡ denote a statistically significant difference 20
MOI uninduced group. C, Effect of induced Myc-p27Kip1 on growth inhibition. *
indicates a statistically significant difference from 20 MOI uninduced group. Results in
this figure are representative of three replicate experiments.
Fig. 7. Silencing expression of p27Kip1 blocks anti-HER2 antibody mediated
induction of p27Kip1 protein and G1 arrest. SKBr3 cells seeded on six-well plate were
transfected with p27 SiRNA duplex or with control SiRNA using Oligofectamine reagent
according to the manufacturer’s protocol. A, Both p27 SiRNA #1 and #2 diminished the
level of p27Kip1 protein after 48 hr transfection. A representative Western blot of p27Kip1
expression was shown. For the protein loading control, the same blot was stripped and re-
probed with an anti-ß-actin antibody. B, p27 SiRNA blocked 4D5-induced p27Kip1
expression. SKBr3 cells were transfected with SiRNA for 36 hr and then treated with
4D5 (3 µg/ml) for another 24 hr. Cells were collected for protein blotting and cell cycle
analysis. C, p27 SiRNA blocked 4D5-induced G1 arrest. SKBr3 cells were treated as
described in B. Cell cycle distribution was determined by flow cytometry. Results are
representative of two replicate analyses.
Fig. 8. Anti-HER2 antibody significantly increases the half-life of p27Kip1
protein. BT474 cells at a density of 6 x 105 per 100-mm cell culture dish were treated
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
33
with 10 µg/ml of trastuzumab or hIgG for 48 hrs. Cells were then washed and treated
with 5 µg/ml of cycloheximide (CHX) for the indicated time intervals. Cells were
harvested, subjected to total protein preparation and Western blot analysis with anti-
p27Kip1 and anti-ß-actin antibodies. A, A Western blot is shown that is representative of
three replicate analyses. B, Semi-quantitation of p27Kip1 expression shown in A. Results
were normalized according to the level of ß-actin control. The p27Kip1 expression of both
trastuzumab and hIgG group at 0 hr interval was set as 1 unit.
Fig. 9. Anti-HER2 antibody significantly decreases threonine
phosphorylation of p27Kip1 protein at position 187 and increases serine
phosphorylation of p27Kip1 protein at position 10. A, Only the inhibitor of proteasome
degradation pathway upregulated p27Kip1 expression. SKBr3 cells were treated with a
proteasome inhibitor MG132 (5 µM), or a broad inhibitor of caspases (60 µM), or a
calpain inhibitor PD151746 (5 µM) for 24 hr. Total protein was then prepared for
Western blot analysis. B, 4D5 decreased T187 phosphorylation and increased S10
phosphorylation of p27Kip1 protein in SKBr3 cells. SKBr3 cells were treated for 24 hrs
with 4D5 at different concentration or with diluent and total proteins were prepared as
described in Experimental Procedures. Western blot analysis was performed to detect
different proteins. Filters were first blotted with an anti-phospho-Thr187 p27Kip1
antibody, then stripped and re-probed with different antibodies in the following order:
phospho-Ser10 p27Kip1, Jab1, β-actin, and total p27Kip1. These results were representative
of two independent experiments. C, Trastuzumab decreased T187 phosphorylation and
increased S10 phosphorylation of p27Kip1 protein in BT474 cells. BT474 cells were
treated with or without trastuzumab (10 µg/ml) for 48 hr. Total protein was prepared for
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
34
Western blot analysis using different antibodies in the following order: phospho-Ser10
p27Kip1, phospho-Thr187 p27Kip1, and total p27Kip1.
Fig. 10. Expression of p27Kip1 mutants causes G1 arrest and decreases
sensitivity to anti-HER2 antibody-induced G1 arrest. A, Flow cytometric analysis of
GFP-positive cells. SKBr3 cells were transiently transfected with the appropriate
expression plasmids (p27Kip1 wildtype, p27Kip1 S10A, or p27Kip1 T187A) plus pEGFP-F
vector using LipofectAMINE-2000. Cells were collected after 48 hr transfection and
fixed in 0.25% paraformaldehyde for 1.5 hr and then stained with PI solution. The GFP-
positive population was gated. The numbers shown as an insert in the histogram were
percentage of GFP+ positive cells. B, p27Kip1 S10A and p27Kip1 T187A mutants caused
less sensitivity to anti-HER2 antibody-induced G1 arrest than p27Kip1 wildtype and
control vector. SKBr3 cells were treated as described in A. Cells on individual dish were
trypsinized and reseeded in two identical dishes after 24 hr transfection. One dish was
treated with anti-HER2 antibody 4D5 and the other was treated with diluent for another
24 hr. Cells were then subjected to cell cycle analysis. The cell cycle distribution of GFP-
positive population was determined. The GFP positive rate in empty vector pcDNA3.0
was used to normalize other plasmids’ different transfection efficiency. A representative
data was shown from two separate experiments.
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
Ruth LaPushin, Ana M. Tari and Robert C. Bast ., JrXiao-Feng Le, Francois-Xavier Claret, Amy Lammayot, Ling Tian, Deepa Deshpande,
G1 cell cycle arrest and tumor growth inhibitionThe role of cyclin-dependent kinase inhibitor p27Kip1 in anti-HER2 antibody-induced
published online April 16, 2003J. Biol. Chem.
10.1074/jbc.M300848200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on September 5, 2020
http://ww
w.jbc.org/
Dow
nloaded from
Top Related