The role of amino acids and Gcn4p in the shift of Saccharomyces cerevisiae from
anaerobic to aerobic conditions
A thesis presented for the degree of Doctor of Philosophyby
Bonny Man-Ying Tsoi
College of Health and ScienceSchool of Biomedical and Health Science
University of Western SydneyAustralia
2009
Acknowledgements
To my supervisors
Vince- Many thank you to Vince for teaching me how to prepare a good presentation, which I used to hate and scared of. Now it’s a piece of cake. For all your helps and supports. Thank you very much, Vince.
Ian- There is too many thank you that I want to say to you, from offering me the scholarship all the way to editing my final draft of thesis. Really appreciated for yourguidance advises and helps through my research years. Without you, Dr. B Tsoi would never exist. Thank you so much, Ian.
Peter- Thank you for being one of my supervisors and interested in my project. All yourencouragements over the years are appreciated. Thank you, Peter.
To everyone in Vince lab and Dawes lab
Thank you for all the helps and friendship. It’s great to have some fun besides working on experiments, especially when they didn’t work.
To all those special people
Thank you to the people who gave me helps and let me borrow their stuffs. Anthony Beckouse for all the helps and the ideas on Gcn4p, and of course your discovery on Gcn4p. Mark Raftery for the mass spectrometry works. Cristy Gelling for the advises on one-carbon and your plasmids. Abraham Tsoi for the HPLC. Geoff Kornfeld for all the helps on experimental works. Steven Fai for your advises on the phospholipids. Malcom Noble for the scillination counter. Russell Cail for the freeze drier. Ika Kristiana for the TLC materials. PhaikEe Lim for all your advises and helps. Prof. Gerhard Braus, Georg August University Göttingen for the plasmids. And everyone who had help in many ways in the college of health and science, UWS and the school of BABS, UNSW.
To my family
My dearest parents- your kindness, love and patience. Thank you for supporting me oncome back to do my PhD and always there when I needed you. My brother Abraham- for being helpful and supportive in many ways. Thank you, my brother!
Statement of Authentication
___________________________Bonny M Tsoi
The work presented in this thesis is, to the best of myknowledge and belief, original except as acknowledgedin the text. I hereby declare that I have not submittedthis material, either in full or in part, for a degree at
this or any other institution.
� ��
�
���������������
��������� ���� � � � � � � � �������������
���� �������������������� � � � � � �������������������������
�
��������������������������������������������
���������������������������������������������
������������������������������������������������
�������������������������������������������
���������������������������������������������
���������������������������������������������
� �����������������������������������������������������������������
������� !��"#������������������������������������
� �������� ����� ���� �����������������������������
� ��������������������������� �������������� ������������������
��$�%��&�����������������������������������!�
� ��"������#����������� ��������������������������!�
� ��"���$� ���������%��� ���������������������������������&�
� ��"�����'�����������������������������������&�
� ��"�����(��������������������������������������)�
� � ��"���"���#���������������������������)�
� � ��"���!�*����������������������� ����������������+�
� � � ��"���!�����#������������������������+�
� � � ��"���!���,����� ������������������-�
� � � ��"���!�"�,������ ������������������-�
� � � ��"���!�!�.���� ��������������������/�
� � � ��"���!�0�1��������������������������/�
� � � ��"���!�&�,������2������ 2�#������� �������������������
� ��"�"�� ��������������� �����������������������������
� � ��"�"�������%��� ������� ������������������� ���������������
� � ��"�"��������������� �����������#������������� �����������������
� � ��"�"�"������������ ������������������� ����������������"�
� ��"�!�$�������������������� �����������������������������!�
� � ��"�!���3��������� �����������������������������!�
� � ��"�!���3��������������������������������������!�
� � ��"�!�"������#������������������ ��������������������0�
� � ��"�!�!�������������������������� ��������#�������������&�
� � ��"�!�0�3�������� ���������������������������)�
� ��"�0�,�������#����� ������� ������������������������)�
� � ��"�0���4����������������������������)�
� � ��"�0���3 ���5, ����5�������63,�7�#����� ������������+�
� � ��"�0�"��������������� ���������������������������+�
� ���
� � � ��"�0�"���$���������6�����������7������������-�
� � � ��"�0�"���4��������������������������������/�
� � � ��"�0�"�"�3���������������������������/�
� � � ��"�0�"�!���� ��2������������ ����������������
� � � ��"�0�"�0���#�������������������������
� � � ��"�0�"�&�$����������������������������
� ��"�&�3����������������������������������� �������������������
��'������������(((((((((((((((((((((((((���(���$�
� ��!���$����������������������������������������������"�
� � ��!�����3�����������������������������!�
� � ��!������ �����������%��� ���������������������0�
� � ��!���"�4��������������������������������������������0�
��)��&������#������*�+������#�&��������&(((((((((((((((�,�
� ��0���� ����������#����� �� �6� ���������#� ��7����������-�
� ��0���8������������ ������������� �������#����� �������������""�
� ��0�"�(��������������5�#������9��������������������""�
� ��0�!�4�5������� ������ ���������������������"0�
� � ��0�!���( �������������������������"+�
� � ��0�!����5�����������������������������"+�
� ��0�0���������������������������������"-�
��-��+���"���������.�'/((((((((((((((((((�((((��'��
� ��&������#������#��������������������������!��
� ��&��������#���������������������������������������!��
� ��&�"�:�������������������������������!��
� � ��&�"���;��� ���������� ���������������������!��
� � ��&�"���.���� ����#�����������������������!!�
��0���&(((((((((((((((((((((((((((((((')�
�
���������1������2�����1�� ��3((((((((���('0�����.������&����������#�&��+�#�(((((((((((((((((((�'0�
� ������,��������������������������������!)�
� ������(����#�����������������������������0/�
� ����"����� ��������� ���������������� �����������������2�#�� ��������
� � #�� ����������������������������0��
� � ����"�������� �����������������������������������0��
� � ����"����������������������������������������0)�
� � ����"�"���� �������������������������0)�
� � ����"�!���� ���������������������������&/�
� ����!�,���2�����������������������<'���������� ��������������&/�
� � ����!���:���� ���������������������������������������&/�
� � � ����!������������������������ ���������������&��
� � � ����!������������������������#���������������&��
� � ����!����������� ��������������������������������������&"�
� � ����!�"��������� ���������������������������&"�
� � � ����!�"���.���������������������������#�����������&!�
� � � ����!�"���.���������������������������#�����������&!�
� ����
� � � ����!�"�"�.��������������������������#������������&0�
� � ����!�!�<���� �������������������������������&0�
� ����0(���� �������������������������������������&&�
� � ����0���<'�������������������������������&)�
� � ����0���3������#���#������������#���=�������� ��������������&)�
� � ����0�"��� ����������������������������������&+�
��������/+*�����!*�&��+�#��((((((((((((((((((((�((-4�
� ������<�� ������������������ �������� ���� ����������������&+�
� ������<�� ������������������ � �����������#��#���� ����������������&-�
� ����"��#��������������������������������&-�
��$��������&��+�#�(((((((((((((((((((((((((��-,�
� ��"������������������������β9���������������� ������������&-�
� ��"�������������������������� ���������������������)/�
� ��"�"����� �����β9������������������� ����������������)/�
��'��&������#����*���((((((((((((((((((((((((�0��
� ��!���� ������������ ����� �>��.�������������������)��
��)�����������������������((((((((((((((((((((((��(�0��
� ��0�����#�����������������#��������� ����� � �����#���� �� ������)"�
� ��0���,�����#���� �������� ��������������������������)!�
��-���#���������������!����+�$ 525�����((((((((((((((��((0)�
� ��&������ ���� ��#�� �����������������������)0�
� ��&���*��������������������������������������������)0�
��0��������������������������((((((((((((((((((((��(���0-�
� ��)���*������������������#����������������������)&�
� ��)���*�����������#���#���#����� ���5�� ������������� ���
������������������������� ������#� �6�<5��.7���������������������))�
� ��)�"�.���������������� �����������������������������������)+�
� ��)�!�*��������������������������#���#���#����������������)+�
�
������$���+����2���%���������� ��6��3����3���3���
������������3�3((((((((((((((((((��(�0,�$�������#"������#���&((((((((((((((((((((((��(0,�
$���������"��&��������*�#����������#���������������*�����(((((((��(0,�
$�$��������/��������������������&������#�����*�+����(��(4$��
� "�"���(��!#������ �������������#�������������������� ������������� ��� �������
� �������������� ��������������������������������+"�
� "�"������������ #�����������������#���������� ��������������������� �
� ��������������������������������������������������������+0�
� "�"�"������������������������������������������#����������������
� �����������������������������������������������������+&�
� "�"�!� !�"����� !������������������������������������������+-�
� "�"�0�<�����������������������������#���������������������������-��
� "�"�&����#�$�∆�������������#���������������������������� ������##������� ��������� ���������������������������������-"�
$�'�%"��+������*��������+���������*�����+��!�������������/��+��*�����������������������������������
�����������(((((((((((((((((((((((((((��,-�
� ���
$�)�25���������!�*�����##�����&�� �#�*���#"��#��+���7��#�#���!�/+�����
����������+������∆∆∆∆��&"����#"��!������������((((((((((((((�(,0�
$�-�1"������������#�������*�+��������25���������!�*����#��/��*�����&�����
/+���*/������+������∆�&"����#"��!������������((((((((((��8��
� "�&���3���������#�������#�$�∆� ��������������������������������������
� �����������������#�����%��� ����������;:!)!"������������������/&�
� "�&���.��������%��� �������5���������� ������������������������������
� #�$�∆� �������������������������������/-�
$�0�����"����(((((((((((((((((((((((((((�����$�
�
������'��������3���9�29���������5���������������������������������������
1�����2�31����������������3�3((�(���)�'�������#"������#���&(((((((((((((((((((((����������)�
'���%��&��������"����+��#���*�#���!�/+�����������∆∆∆∆�&"������������������#�����((((((((((((((((�(((�((((((((����0�
'�$�����/��#�������+*#��7*&��+*�������������������*�������:"���#������
���������������!����+���&��&���&�#�"&(((((((((��((((((����8�
'�'�1"�������������#������5������&��������&�+������������������������
!����+((((((((((((((((((((((((((���((����$�
'�)�������������������/��#�.�'/�#"��!��+���+������������������(((���((��-�
'�-���������"��������������25������#��������#"��!��#�/�������������������
������!����+��#�.�'/������:"���#�/�����������&/�������������25�����((((�$��
'�0�����������25�+�������+�������7��#�#���!�/+����������#5�*/���������
������"#��������������(((((((((((((���((((((((((���$)�
'�4�����7/�����������#"��#�#"��!��������������#����#�/�#������+��
�����������*����25�������#�.�'/((((((((((((((((((�(�$0�
'�,�����"����((((((((((((((((((((((((((�(���$,�
�
������)��� ���3�3��%�253������������������3�3(����'��)�������#"������#���&(((((((((((((((((((((���(��'��
)�������*�+��������25�*�������#�!�"���+������:"���#�25�����((((((��'$�
� 0�����;��� �����������5� �������������������������!"�
� 0�����;��� ���������������������������������������!0�
� 0���"���������������%��� �������5����������������������� �����������5��
� ���������� ���������������������������������������!+�
)�$�����*�+��������/+��/+���/�#�(((((((((((((((((��((�)8�
� 0�"���8��������������?��� �#����� �����������������0��
� 0�"�������#����� ������ ���������������������������0!�
)�'�3/���������:"���&�������25����������/�������*�+����(((((((���(��)0�
� 0�!����5������%��� ��������� ����� #�����������������0-�
� 0�!����5����������#�������������#���#���#�������������������&/�
� 0�!�"��5���������%���������������� ���������������#�������������&"�
)�)�����*�+������������������&��/���������:"�������+�!+��&�"�����25��������-)�
)�-�����"����((((((((((((((((((((((((((���(�0��
� ��
� 0�&�������������������������������#��������8'��������5������� ��
� ������������� ��������������������������������)��
�
������-����3�33���((((((((((((((((���0'�-���%"�"���#���������((((((((((((((((((((((((���00�
�
��%�����((((((((((((((((((((((���0,�
�
�������;�
� ���
2��������������
�����������*��������������������������� 5���� �������� �����������
������������������������������������������������������������������)�
����������(������������#��#������ � ���������������������������� ���������
��������������� ��������� �������� ���� ������ ����������
�����������������������������#���������������������������������+�
��������$��#������� ��������������������������������� ���������#� �������"��
��������'�(�������������������� �(��!#���� ���� �������� ����� ������"0�
����������,��������������������������#���� ��������#�� ����������!)�
��������������� ������������������������������� ���������������0��
��������$�4����������������������������������������� �������������0)�
��������'���� ������������������� ����������������������0+�
��������)���� �������������������� ��������������������&/�
��������-���## �������������<� ��� �����������������&��
������$���$����������������#5���������������������� ������� �����������+��
������$���(�������5������������������������������������������������+��
������$�$���������������������������������������5����� ��������������������++�
������$�'�3���������������� �����������������#���2����������� �����������
������������������� ������������5� #�����#�$�∆ �����������������������
������������������������������������������������������������--�
������$�)����������������������������� ����������������#���� �����������
������������������<.� �����������������������������/��
������$�-����������������������������������� ��������������������������
��������������������������#�����������������#����;:!)!"�������++���
�����������������#�������#������������������������������������/&�
������'���3������������������5������� �����������������#���2����������� �
���������������������������� ������������5� #�����#�$�∆� �����������������
���������������������������������������������������������������������������+�
������'���������#���2����������� ������������ ������������ �����������
�������������������5��������������������<.� ������������������������
������������������������������������������������������������&�
������'�$�3���������5�����������������#�������������5� #�����#�$�∆��
����������������� ������������������������������������������������������������"&�
������)���������#����2����������� ������������� ����������������
������������������������������������� ���������������<.� �����������## ���������
��������������������0/�µ,���������������������������������������������������������������������!)�
������)������������������������������������������������������������
������������������������#���� ����������<.� �����������## ����������������2��
������������������5�����������������!+�������������������������0��
������)�$�3�����������������������#��������������#���������� ��������
��������������������������5� #�����#�$�∆� �������������������������������������������
���������������������!+�������������������������������0"�
������)�'�@���������������#������������� �������������������������������&&�
� ����
������)�)�,�����#���� �� ���� ��������������##����������������5� #��������������������������������������������������
#�$�∆� ������������������� �#������������������������������)/�
�
�
� �����
2�������%�!"����
�%�!"����������������������5������� ������ ������� ���2��5����������
��������������������� ��������������������������������������� ������������
������������������� ��#�� ����� �������������������������������")�
%�!"���$���������������������������������5� #�;:!)!"�����#�$�∆� �������
������������������������!+���#���������������������������+)�
%�!"���$���<�� �����������������������������������������������#���������
� ������!+���������������������������������-/�
%�!"���$�$�(��������������������������������� ���������������������������������-��
%�!"���$�'�.�������� ������������ �����������������5� #��������������������������
������������������������������������������-0�
%�!"���$�)�(�����������������������������������������������������������������
������������������ ����������#��������!+�������������������������//�
%�!"���$�-��������������������������������� ∆�����#��∆� ���������� �����
��## ���������� �������A����5�����������������/0�
%�!"���$�0�������������������������������������������������#����6;:!)!"7�������
#�������#����6��++.7�����������������������������/+�
%�!"���$�4���������������������������������#���� ���������## ����������
��������������������������������������������� ��������5�����������������/�
%�!"���$�,�4#������������������������������� �#�������#����������������
����������������� ��������5�������## ���������� ��������������
%�!"���$��8����������������������������#�$�∆� ��������� ������## �����
�������������������������� ��������5����������������������������
%�!"���'����������������4�5.������ ������ ���� ����������������&�
%�!"���'���������������������������������#�$�∆� ����������<.� ��� ��
��## �����������5�����������������������������-�
%�!"���'�$���������������������������� ���������������� �����������<.��
������������������ ��� ���## ����������������� ���������������������
%�!"���'�'�(���������������5������� ������ �������� ��������� ����������0�
%�!"���'�)�3�#�����������������������������5� #�����#�$�∆�����%�∆��
������������������ ������������������������������������������������� ��� ��
��������������������## �������������������5����������������������������-�
%�!"���'�-�3�#�����������������������������5� #����� �������������������
��������������������������������������� ��������������������5���������������������"/�
%�!"���'�0�;��� �������#����� �������5����2�� ���2��5�������2��5��#�������
�����������������������5� �������������� �<5�������������� ���������������"��
%�!"���'�4�*���������������������������5����2�� ���2��5� ����2��5�������2��
�������������������5��#�����������5��#�������������5� #��������!� ���������������
���������������������������������������������������������������"!�
%�!"���'�,�3�#����������������������������5� #2�#�$�∆�����%�∆� ��������
������������������������������������������ ��� ���## ���������
����������5����������������������������������"+�
�
%�!"���)���;��� �������#����� �����5� ������������� �����������������!!�
� ���
%�!"���)���;��� �������#����� ���������������������� ����������������!0�
%�!"���)�$�.�������������������������6µ �A�/+���7����������5� #������
������������������#�$�∆� ��������������������������������������������� �������
������������������� �>��.����������������������������!-�
%�!"���)�'�������������#���#���#������� �������5� #��������#�$�∆� ������
����������#������������.� �������������������0&�
%�!"���)�)�">5�5����������� ��� ���������.��#���#����� ������������5� #�����
����#�$�∆� �����������������������������������������������������0+�
%�!"���)�-���������������� ���������������#�����������">������5���������
���������������������������������������������������5� #�;:!)!"�����#�$�∆� �������
����������������������0������!��������������������������������������������������&��
%�!"���)�0���������������� ���������������#�����������">������5���������
���������������������� �B���#���#���#�����������5� #�;:!)!"�����#�$�∆� ����������
�������������������0������!���������������������������������������������������&!�
%�!"���)�4������������ !��##����������������5� #��������#�$�∆� �������
������������������������/2��!�����!+������������������������������������������������&-��
�
�
�
�
�
�
�
�
�
� ��
�������������
�
�02��/5�.>�5�>!����� 02��/5 �� ������� ��������
�#� ����#����
.<�5<(� � ������0C5��#���#���5���� � ����
(.83� �����������5��#������ ���
>��.� �����#�������%�������� ������#� �
�;� �����5;������6 ��� 7�
,�� �����#���� �� �
4<&//� �#���������� � ���������&//� �
48$� �#������������ �
�;�� #���#���5������������
�.8� #� ������������������
�.� #���#����� ������
�3� #���#����� ������ ���
�*� #���#����� ��������
��� #���#����� �����
�..� � ��������� #��6 ��� 7�����������## ��������
�<� � �������������6 ��� 7�
�<.� � ��������� #��6 ��� 7������������ �����������
,�A,�� ���� �,��
>!����� ����� ��������
��.� ����5� ������ ������#� ��
:3�<� �����������##�����������6�� #�� ��� 7��
�
���� ��������� ������������������������ ������5���� � ����2�������� �
���� ���� �(���� ����� ������D�2��� �����������#����D�����������������
����� ��� ���� ����� � <����� ��� ��������� � � ∆�� � ������� ��� #������� ��� �� ��
��������������������� 2����8� ���� #2���������������������#����D���������������
9#����
� ���
�"������������
�
����<� ���1�<�;������2����(�2�(���2�.�� ��2�8���� 2�,�� E�2�.���2� E�2�����2����,�2�
���������2���2�8����2����E�2�>������2�F��E�2�<���2�*��G��6�//-7��3���������������5
������� ������ �����(��!#�����;���#���������#�������������������������#����������
��������� ������� ��� ���� ������� �� �������� &�' $�� �(� �����#���� ������) �2�
�+!6�)7=���/05����0���
�
�
��������/�����������
�
����<����1�2�;������2����(�2�.���2�E�2�8����2����E�2�>������2�F��E�2�<���2�*��G�����
������(��!#�������#��������������������������������� ��������� ��������HH***���
*����������� .������� ��� :���� (������ ���� ,������ ;���� 2� ,�����2�
���������6/�5/&�E� 2��//)7��
�
����<����1�2�;������2����(�2�.���2�E�2�8����2����E�2�>������2�F��E�2�<���2�*��G�����
��� ��� (��!#� ��� ���#������� ��� ��������� ������� ��� ���� ������� �� ��������
.� ;���//)�6��;,;72�� �� 2�����������6��5�)��#� ��2��//)7���
�
����<����1�2�;������2����(�2�.���2�E�2�8����2����E�2�>������2�F��E�2�<���2�*��G�����
������� ��������������(��!#�������������������� ��������� ���������� ����������
��� ������� ������������IG��8������ ������� #����������� ���� 2� � �� 2� ����������
6�//&5��//-7����
� ����
�����������;������ ����������� ���� �� ����� ������ #���������� ���� ��� ������ � �������
���� �#�� �D�J� �� ��� ��� ������ ������ ��� ������ � ������� ������� �� �������
����� ������� ������������ *�� ������2� ��������� � ������ ���� ��� #������ �����
������������������������������������%������������� ��������������� ������ J�
�����2���������#������� ��������� � ���������� ����������#������������� �����
������� ������������#����������������(��!#���������������� ����������������� ����
����� ������ � ��� ��� �� ������� ���� ��� �%����� ���� ��� ��������#������ ��#���� ���
� ���������������������>�������������������(��!#�#� ����#������ ��������������
��� ��������� ���#������� ��� ��������� �������� � �� #�$�� ������ �������� �� ���� �
���������#�����������������������������������������������������5������#�������
*�� ��������2� ;���#2� ��� ��������#������ �������� ��� ��� ��5������� ������ � ����
#����� ���� ����������� ������ � �%����� ���� ��������� ������� ���� ��������� �� ��� �
��� ����5����� � �������� ���%�� �������� ���� ���������� ��� ��5������� ������ �
������������������� ������� ��� ������� ��� ��## �����5����� ��� � ���� ��������
��������#����� ����I��������� �������#�� �����##������2���� �������������
������������#��������������#� ���������� �������������5��������� ������� ������
���� ��� �������� � ���� ������� ���#������� ��� ������������� ����� �������� �5�����
�%��� ��� ��� ���� �� ���� ������������ � ��������� �������2� ���������*��
$����� ������������������ �������� �����5����� ����#������������������������
���������������������������������*�������� 2���������������������������������5
����2�������������� ������������#������� ������������������2���������������
������������������� � ������ ������������ #����������� ��������
� 1
������������� ������
�����������
��������������� � is widely used as a model eukaryotic organism for research
studies due to the ease of molecular manipulation and the fact that its genome has
been sequenced. This organism, also known as baker’s yeast, has been part of human
life since 2000-6000 BC (Walker, 1998b), when it was first used to leaven bread
dough and produce alcoholic beverages, such as beer and wine. However, the earliest
record on the usage of alcoholic fermentation of plant saps and fruits juices was
around 3000 BC (Hardwick, 1994) or even back to 7000 BC (McGovern ������, 2004).
��� ��� � ferments sugars to ethanol and carbon dioxide under anaerobic
conditions and therefore is a useful tool for studying the anaerobic process. The aim
of this thesis is to determine the role of amino acids on yeast growth in anaerobic
conditions, and to determine the role of the ���� transcriptional activator under
anaerobiosis.
��������������
������ !��"�� ��#� ��!$���""!��
About 75-80% of the yeast cell is water, however, on a dry weight basis a growing
yeast cell is composed of around 40% protein. These proteins are mostly in the form
of enzymes, and are usually situated in the cell wall and bound to the cell membranes
(Hammond, 1993; Hornsey, 1999). The cell wall contains approximately 35%
polysaccharides; followed by 7% minerals; 5% phospholipids; 3% triglycerides and
0.5% DNA, vitamins and fibre (Hornsey, 1999; Walker, 1998b). The yeast cell is
bounded by a cell wall which protects the delicate plasmalemma which is located
� 2
immediately inside the cells. The plasmalemma controls the flow of compounds
going into and out of the cell. The endoplasmic reticulum (ER) connects both the
plasmalemma and the nuclear membrane. Many organelles are located within the
cytoplasm; these include vacuoles, mitochondria, and polyribosomes. Glycogen
accumulates in the cytoplasm and this is a source of reserve food for the cells
(Algranati and Cabib, 1960 ).
Membrane structures play an important role in the organization of the yeast
cell such that up to 85% of the cell wall dry weight is attributed to two structural
polysaccharides, β-glucans and mannoproteins (Hornsey, 1999). β-glucans are the
glucose polymers that hold the inner layers of the cell wall and have major functions
in determining the cell shape and wall rigidity (Qadota� ������, 1996). On the other
hand the mannoproteins, also known as the α-mannans, are the mannose polymers
that are linked covalently to peptide chains, and constitute the outer layer of the cell
wall which is involved in porosity and environmental reception (Dagger�������, 1997).
Proteins (8%), hexosamine (2-4%), and inorganic materials (3%) are also present
inside the cells (Hornsey, 1999; Wainwright, 1971). The proportion of the cell
constituents varies according to the strain of yeast as well as the growth medium and
conditions. For example supplementation of anaerobic cells with a high level of D-
glucose leads to a greater β-glucan content in the cell walls (McMurrough and Rose,
1967; Morris, 1958).
�
���������!����#����$���"���#� ��!$��������!$� �
��� ��� � has been used in brewery fermentation processes for centuries; this is
due to their high tolerance of ethanol and sugars, as well as the low oxygen
requirement during the fermentation process (Egli� ��� ���, 1998; Fleet� ��� ���, 1984;
� 3
Hansen� ��� ���, 2001; Schqtz and Gafner, 1993). In present times yeast is not only
being used in the fermentation and food industries, but also industrial and
biotechnological processes. These diverse uses of yeast include their studies in
environmental technology such as bioremediation, utilization of waste, crop
protection and biosorption of metals; in the health-care industries, such that
pharmaceuticals, vaccines, probiotics and hormones can now be synthesized from
yeast; studies in drug metabolism; and in biomedical research on human diseases or
disorders such as cancer, AIDS and human genetic disorders. Yeast has been widely
used as a tool for fundamental biological researches and in studies involving cell
biology, biochemistry, genetics and molecular biology (Walker, 1998b).
At the commercial scale, the brewing conditions using yeast have been
extensively studied to optimise alcohol production in a cost-effective manner to
maximise profit. Although brewing is one of the oldest forms of biotechnology in
existence; little is known about the physiology and metabolism of ������ � under
these conditions. Brewing begins when anaerobically stored yeast cells are pitched
into aerated wort. Aeration is vital for biomass and metabolite production for
subsequent fermentation. Oxygen becomes limiting when the biomass has increased
significantly. In order to keep up with the energy demand for cellular processes, yeast
cells continue to generate ATP by the fermentative pathway under anaerobic
conditions. However, fermentation typically takes days to complete. The
requirement of cell metabolites for the production of alcohol and flavour in brewing
can be varied from batches.
� 4
�%�&��'��$�$����
�%������(����!!��#�#��'��$�$�����
The process of fermentation can be classified into several stages, however, these
stages may overlap in time and the functions of the yeast are different in any of the
stages. During the initial stage, processes such as cell wall preparation, and the
uptake of nitrogen, sugars and oxygen can take place. It is interesting to note that the
permeability of the yeast cell is very important for the uptake of nitrogen and sugars
from the wort, since this is required for the synthesis of sterols (Higgins�������, 2003).
The uptake of nitrogen is very crucial; lack of nitrogen can inhibit the growth of yeast,
and this may lead to lengthy and disordered fermentation (Mendes-Ferreira� ��� ���,
2004). The duration of the initial period depends on the viability of yeast, such that
well-fed, vigorous yeast cells are able proceed through this stage quickly (Fix, 1996).
In addition, irregular behaviour occurring at the initial stage can be an indication of
cells starvation (Fix, 1996). Once the cells are well prepared, each individual cell can
start taking in the amino acids, elementary peptides and sugars in a particular order.
The energy requirements for growth must be satisfied prior to the fermentation
process. The Embden-Meyerhof-Parnas (EMP) pathway begins with glucose and
produces pyruvate, even when oxygen is plentiful (Dickinson, 1999). However, the
cells become gradually derepressed when the levels of D-glucose decline, which
results in the induction of respiratory enzyme synthesis. This results in oxidative
consumption of ethanol, when the cells enter a second phase of growth known as a
"diauxic shift". These cells switch to a fully respiratory metabolism by catabolizing
the carbon compounds via the tricarboxylic acid (TCA) cycle and oxidative
phosphorylation in the mitochondria (Dickinson, 1999). This pathway not only
� 5
enables the oxidation of the accumulated fermentation products, it is also a highly
efficient way for generating ATP.
The growth cycle of yeast can be divided generally into three stages; lag phase,
exponential growth phase and stationary phase (Munroe, 1994). Most of the yeast
activity occurs during the lag phase of the fermentation, yeast cells need to adjust
themselves both physiologically and metabolically in order to adapt to the new
environment even when provided with a full set of nutrient supplementation. This
adjustment is mainly for the syntheses of the essential enzymes that are required for
utilizing nutrients, as well as for supporting cell growth (Munroe, 1994).
After the lag phase, there is a short transition into the exponential growth
phase. In the exponential phase, the cell population increases logarithmically in the
presence of rich substrate and cell proliferation can occur by cell budding (Munroe,
1994). The mass and volume of individual cells increases to a definite size when new
buds are formed, hence a maximum growth rate of the yeast cells can be reached
during this phase (Hornsey, 1999; Munroe, 1994). The maximum fermentation rate
depends on the cell population but not the cell growth rate (Fricker, 1978). The pools
of unsaturated fatty acids and sterols can be distributed among the increasing cell
population, and can slow down the growth rate (Hornsey, 1999; Munroe, 1994). As
the sugar concentration falls and flocculation begins, the yeast will gradually shift to
the stationary part of the growth phase (Hornsey, 1999). An increased amount of
glycogen can be detected since it acts as the energy supply during this period of
fermentation when there is a high demand of ATP for synthesis of sterols and fatty
acids (Murray�������, 1984; Walker, 1998b). The yeast total dry weight can increase
throughout the fermentation process, and should slightly decrease approaching the
end of the process (Stassi�������, 1987). It is interesting to note that acetyl coenzyme
� 6
A (acetyl-CoA) is the first fermentation product that contains sulphur, which is
important for the biosynthesis of esters (Lilly�������, 2000). It plays an important role
in the Krebs cycle, which mainly generates the source of metabolic energy and
provides carbon dioxide as the end product.
The overall growth requirement of yeast in brewing processes include: the
carbon and energy sources, which provide the resources such as the fermentable sugar.
Nitrogen source is also required as the growth factors (vitamins; inorganic ions; other
elements and water). Oxygen is needed for the biosyntheses of sterols and fatty acids,
especially during the early stage of the fermentation process for the growth of the
cells (Hornsey, 1999; Rosenfeld�������, 2003). Towards the end of the fermentation,
flocculation occurs and this is related to the increases in the proportion of β-glucan in
the cell wall (Jin and Speers, 1998). The depletion of growth factors, such as the level
of inositol in the wort can occur at this stage, and cause the increase in the β-glucan
formation (Wainwright, 1971).
�%���&��'��$�$������)����'��$!�
�%������$������!������
Yeast grows on ammonia as the sole nitrogen source, but can be grown faster with
supplementation of suitable mixtures of amino acids. Nitrogen is required for the
synthesis of essential cell constituents which are derived from amino acids. Thus, it is
important to monitor the amino acid concentration of the wort. Amino acids are taken
up and utilized sequentially, according to the presence of amino acids and the
appropriate transport enzymes located in the membrane (Hornsey, 1999). The cell
itself produces amino acids by transamination and/or by synthesis from various acids
in the keto acid pool. It has been found that in some yeast strains, amino acids such as
� 7
L-arginine, L-histidine and L-lysine are produced by the cells themselves rather than
from the supplemented medium (Hornsey, 1999). �
�
�%�����*���$��#��$��!�
In the brewing process, growth factors such as vitamins are available from the wort
and yeast strains vary widely in their requirements of these for growth (van Iersel����
���, 1999). Biotin, thiamine, nicotinic acid, riboflavin, calcium pantothenate, inositol
and pyridoxine, pyridoxal and pyridoxamine are available in the wort during
fermentation (Bartnicki-Garcia and Nickerson, 1961; Ough�������, 1989; Taherzadeh�
��� ���, 1996). Biotin is a member of the B-complex family that is needed for the
metabolism of amino acids and essential fatty acids. In many fermentations,
pantothenate and inositol are required, since inositol is essential in the biosynthesis of
phospholipids required in membrane synthesis (Rosenfeld�������, 2003).
�%���%�+�(��!�
The cell membrane commonly contains a mixture of phospholipids, which include the
cardiolipin, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, and
phosphatidylinositol. The lipid compositions in the cell and membrane varies
depending on several factors, such as temperature (Okuyama� ��� ���, 1979), carbon
source (Jakovcic�������, 1971), and lipid precursor supplement (Ratcliffe�������, 1973).
Biosyntheses of sterols, fatty acids and phospholipids occur in the cytoplasm,
microsomal membrane and mitochondrion. Lipids are critical under aerobic
conditions, and unsaturated fatty acids are essential for growth under anaerobiosis.
However, the syntheses of unsaturated fatty acids and sterol in yeast can only occur in
the presence of oxygen. Thus, the supplementation of ergosterol as a source of sterol
� 8
is required for growth of the anaerobic cells (Andreasen and Stter, 1953; Andreasen
and Stter, 1954 ). One study has suggested that the unsaturated alkyl side chain in the
sterol has a role in ethanol tolerance, as well as being a property of the plasma
membrane (Thomas�������, 1978). Nevertheless, the synthesis of membrane depends
on unsaturated fatty acids, sterols and oxygen (Hough, 1985).
�%���,�������������!������$�����"�'��$!�
There are a number of inorganic ions that are required for the growth of yeast cell
during the fermentation process. Phosphate (Archer and Castor, 1956); sulphate
(Yamauchi� ��� ���, 1995); essential cations (Conway and O'Malley, 1946); and
metallic elements such as zinc, iron, or copper ions (Agte�������, 1999; Mrvčić�������,
2007) are crucial for supporting the structure of the cells and enzymatic purposes.
� �%���,��-�"(����
Sulphur is a component of the amino acids, methionine and cysteine, therefore it is an
important factor in determining protein structure. Within the cells, the other most
critical sulphur-containing compounds are coenzyme A, lipoic acid, thiamine
pyrophosphate (TPP) and glutathione. A metabolic by-product derived from sulphur
utilization during fermentation is hydrogen sulphide (H2S). It is generated in the most
significant noticeable quantities during the exponential phase of cell growth. The
concentration of H2S is usually low at 5 ppb and this level is below its flavour
threshold. A detectable smell of H2S in beer is one of the indications of bacterial
infection. The mercaptans (thio-alcohols), thio-aldehydes and thio-ketones are the
major sulphur by-products of yeast metabolism which all greatly contribute to the
flavour of the beer.
� 9
� �%���,���.�$�""����"�'��$!�
There are three major groups of metallic ions that play important roles in the brewing
process. The macro-elements, which are required in a concentration between 0.1 and
1.0 mM, include K+, Mg2+, Ca2+, Zn2+, Fe2+, Fe3+, and Mn2+. The next group is the
micro-elements with required concentrations of between 0.1 and 100 mM and these
are Co2+, Cd2+, Cr3+, Cr6+, Cu2+, Mo2+, Ni2+, and V2+. The group classified as the
inhibitors need to have concentrations as low as possible in the fermentation system
(i.e. between 10-100 mM); these inhibitors are Ag+, As3+, Hg+, Li+, Os2+, Pd2+, Se4+,
and Te4+ (Hornsey, 1999). The concentrations of Mg2+, Zn2+, K+ and Co2+ have the
greatest effect on the system. However, the optimum concentration of any one of
these elements is related to the concentration of other ions, such that it is critical to
maintain the correct ratio of zinc and manganese, as well as for calcium and
magnesium (Hornsey, 1999).
�
� �%���,�%�.����!��'�
Magnesium plays a role in the regulation of pyruvate metabolism; with the glycolytic
enzymes hexokinase, phosphofructokinase, endolase and pyruvate kinase being
activated by magnesium (Hornsey, 1999). It has been suggested that magnesium is
fundamental to the metabolic and physiological functions of the cell (Pironcheva,
1998; Walker, 1994; Walker, 2004; Walker and Maynard, 1997). Magnesium has
other functions: in ethanol tolerance (Ciesarová� ��� ���, 1996); protection against
temperature and osmotic stress (Birch and Walker, 2000; Walker, 1998a); membrane
stabilisation of nucleic acids, ribosomes, lipids and polysaccharides (Walker, 2004);
stimulation of fermentation of high-gravity worts (Walker, 1998a); ribosome structure;
� 10
neutralization of electrostatic forces in polyphosphate, DNA, RNA and proteins
(Walker, 2004); as well as participating in cell growth and cell division (Duffus and
Patterson, 1974; Hornsey, 1999; Walker, 2004; Walker and Duffus, 1980).
� �%���,�,���"���'�
Calcium is an important element required for the structure and function of the yeast
membrane (Ciesarov������, 1996). Calcium stimulates the growth of cells; even if it
is not a critical growth requirement. The calcium concentration requirement is very
specific and the minimum requirement is between 0.25-0.5 mM, but not exceeding 25
mM. Excess calcium results in its acting as an inhibitor in the fermentation process
(Hornsey, 1999). Calcium is mainly important for the extracellular needs such as the
maintenance of the membrane and for the cell wall integrity (Klotz� ��� ���, 1993).
Accordingly, the relative amount of calcium ions and magnesium ions are known to
be critical during cell growth, and increases in the ratio of magnesium to calcium
levels in the cell can provide rapid initial fermentation rates (Ree and Stewart, 1997)
as well as increase the level of alcohol production at the end of the fermentation
process (Hornsey, 1999).
�
� �%���,�/�0����
Zinc is stored in the vacuole of the cells. It has numerous functions and some of these
can not be replaced; these include: stimulation of the uptake of maltose and
maltotriose (Walker, 2004); the enhancement on the synthesis of growth factors, such
as riboflavin; stabilization of the membrane; the activation of acids and alkaline
phosphatases (Walker, 2004); and acting as a catalytic centre for several important
enzymes such as aldolase, acetaldehyde dehydrogenases and alcohol dehydrogenases
� 11
(Hornsey, 1999; Walker, 2004). However, the concentration of zinc also needs to be
monitored carefully during the fermentation process, since an excess leads to an
inhibitory affect on growth (Hornsey, 1999).
� �%���,�1�.������!�2�!����'2�(�$�!!��'������$���!�
Other metallic ions such as manganese are required as regulators of several key
intracellular enzymes (Walker, 1998b). Cells do not accumulate sodium ion inside
the cells, and the cation is being continually excreted from the cytosol to maintain a
very low level in the cells (Wikén�������, 1962). Potassium ions are taken up actively
by the cells, and are required for D-glucose and other fermentable sugar metabolism.
Decreases in potassium concentration can result in the failure to metabolize available
glucose or fructose causing a stuck fermentation (Kudo�������, 1998). The K+ uptake
system is closely related to the excretion of hydrogen ions from the cells (Hornsey,
1999; Wikén�������, 1962). The ratio of potassium to hydrogen ion does not affect the
rate of growth or formation of maximal cell biomass, but has a slight impact on the
maintenance of cell viability, which could became a contributing factor to the arrest of
fermentation (Kudo� ��� ���, 1998). Overall, a distinct affinity for divalent cations
uptake can be observed during fermentation, with the order of the metal uptake being
Mg2+, Co2+, Zn2+, Mn2+, Ni2+, Ca2+, followed by Sr2+ (Hornsey, 1999).
�
�
�
�
�
� 12
�%�%��'��������!����#��'��$�$����
�%�%���'��������!���)����'��$!��������#��'��$�$����
The nitrogen requirements of brewer’s yeast are very simple - only needing
ammonium salts as the sole nitrogen source, although in wort, the requirements for
nitrogenous nutrients are supplied by amino acids and low molecular weight peptides.
�%�%��������������#��'��������!��($�����������#��'��$�$����
The uptake of amino acids during fermentation follows an unique sequence, such that
groups of amino acids have been identified in ale fermentation. The first group of
amino acids are those classified as the rapidly absorbed and assimilated during the
first twenty hours of brewing where biomass production dominates. This group
includes L-arginine, L-lysine, L-aspartate, L-asparagine, L-glutamate, L-glutamine,
L-serine, and L-threonine (Jones and Pierce, 1964). The second group of amino acids
which are gradually absorbed during fermentation include L-leucine, L-isoleucine, L-
valine, L-methionine, and L-histidine (Jones and Pierce, 1964). The third group of
amino acids which are absorbed after the lag phase include L-alanine, glycine, L-
phenylalanine, L-tryptophan and L-tyrosine (Jones and Pierce, 1964). L-proline is
grouped as a hardly absorbed amino acid (Hough, 1985; Pierce, 1982). The uptake of
different amino acids taken at various phases indicates that yeast cells have specific
requirements for amino acids at different stages of the fermentation process. In the
fermentation of lager, the order of amino acid uptake is similar, although L-arginine,
L-aspartate and L-glutamate tend to be taken up more slowly from the fermentation
broth compared to ale fermentation (Palmqvist and Ayrapaa, 1969).
Amino acids which are classified in the first two groups are transported into
yeast by specific permeases; and once ammonium ion has been used up, the third
� 13
group of amino acids are taken up via the general amino acid permease (GAP) (Pierce,
1982). The presence of ammonia in the wort represses the synthesis of GAP, such
that GAP cannot be synthesized at the early stage of brewery fermentation (Jauniaux
and Grenson, 1990).
�
�%�%�%�������"�!��#��'��������!��������#��'��$�$����
The quality of beer is affected by amino acid metabolism. Amino acid metabolism
can be linked not only to yeast growth but also to the production of sulphur
compounds, fusel alcohols and esters, which are all important determinants of beer
flavour (Hammond, 2000). At the initial phase of fermentation of wort, amino acid
absorption by brewer’s yeast is deficient for protein synthesis, which may be due to
peptides in the wort being hydrolysed by the cells.
Simultaneously, there are a number of amino acids such as glycine, L-alanine
and L-proline that are excreted from the cells and released into the medium (Marquis�
��� ���, 1993). During the fermentation of wort, amino acids are a main source of
nitrogen. But towards the end of the fermentation, polypeptides are assimilated
despite the fact that some amino acids, and particularly the imino-acid proline are
present in the wort (Hough� ��� ���, 1971 -b). Of the amino acids, L-glutamate, L-
aspartate and L-asparagine act as effective sources of nitrogen, whereas glycine, L-
lysine, and L-cysteine are scarcely used (Christensen, 1990). Growth can be
increased by about 10% when pairs of amino acids are provided instead of
individually. However, if a mixture of glycine, L-lysine and L-cysteine is given, a
further 8% increase in the growth yield can be achieved (Hough�������, 1971 -b).
�
� 14
�%�,�&��$��!�$��$��##��$�#��'��$�$�����
�%�,���##��$��#��'��������!��
The rate of uptake of amino acids is important since they can influence the aroma of
the fermentation products. Amino acids are selectively absorbed from wort, and
different patterns of amino acid removal are found in different fermentations. In
almost all cases, L-proline is hardly removed from wort, even though it can serve as
the sole nitrogen source for yeast (Large, 1986).
Peptides and proteins are either hydrolysed or synthesized from amino acids.
All of the amino acids can be synthesized from carbohydrate and ammonium salts,
and their synthesis during brewing is extensive (Taillandier�������, 2007; Wainwright,
1971). However, amino acids are essential for protein biosynthesis and have
important roles in the formation of permeases and other enzymes. The addition of
amino acids can accelerate the fermentation process and shorten the lag phase if the
wort does not contain adequate α-amino nitrogen in suitable compounds.
The amino acid composition of wort does have an effect on fermentation, and
is reflected in the flavour of the beer rather than the rate of fermentation (Wainwright,
1971). Furthermore, the relative rate of amino acid uptake can influence the aroma of
the fermentation products.
�%�,����##��$��#����3���!����!��
The ability to ferment D-glucose, maltose and maltotriose can be diminished when
cells are starved of amino acids, which commonly happens towards the end of the
fermentation. Therefore, yeast usually grows on sucrose, glucose and fructose until
the permeases have been synthesized (Thevelein�������, 2005).
� 15
In commercial brewing fermentation, the major carbon energy sources are the
sugars which are a mixture of maltose, dextrin, maltotriose, glucose, fructose and
sucrose (Hornsey, 1999). It is interesting to note that these sugars behave differently;
glucose and fructose tend to be taken up by the cell and rapidly consumed; unlike
sucrose which is hydrolysed and broken down outside the cell prior to absorption.
Sugars like maltose and maltotriose are transported across the cell membrane and are
hydrolysed in the cell cytosol (Hornsey, 1999; Hough, 1985). D-glucose is
commonly the only source of energy supplied in the anaerobic medium for a
laboratory strain. D-Glucose is broken down via the glycolytic pathway in order to
produce ATP as the energy source, and the pyruvate formed will then be further
metabolised to ethanol as one of the fermentation products. Conversely, some sugars
are converted into other metabolites, when D-glucose is utilised under anaerobic
conditions, for example, the triose phosphate glyceraldehyde 3-phosphate reacts with
NADH to yield glycerol (Compagno�������, 1996).
High concentrations of D-glucose can have the effect of inhibition of
respiration in brewing. Under anaerobic conditions, the enzymes involved in the
citric acid cycle and the glyoxylate cycle have lower activity, and these low enzymatic
activities can also been observed aerobically when the medium contains 10% D-
glucose (Chapman and Bartley, 1968; Rodrigues�������, 2006; Wainwright, 1971).
�%�,�%�����!(��$�$�����������#��'��$�$����
Under fermentation, most components of the wort diffuse freely through the yeast cell
wall to the plasmalemma, although the hop resins, proteins and polyphenols tend to
absorb onto the outer surface of the cell wall (Hough, 1985). Substances present at
the plasma membrane penetrate readily if they are lipid soluble, but much more
� 16
slowly if they are water-soluble or not fat-soluble (Hough, 1985). There are three
methods of entry; simple diffusion of un-dissociated organic acids, catalysed diffusion
for some sugars, and active transport which uses the transport of amino acids (Hough,
1985). Simple diffusion and catalysed diffusion are both dependent on the presence
of a concentration gradient, but catalysed diffusion involves a rapid entry since it is
catalysed by enzymes. Expenditure of energy in the form of ATP is required for
active transport, and the specific transport enzymes or permeases are known as part of
the mechanism (Hough, 1985). Some of the substances that have been taken up from
the medium may not be used immediately, but may survive for a short time in the
storage pools before they are consumed (Hough, 1985).
�
�%�,�,������##��$��#��$����"����$���#��'��$�$����(����!!�
The determination on whether a strain is suitable for fermentation is judged by the
level of ethanol tolerance and the number of times the yeast could be re-pitched into
later fermentations (Lentini� ��� ���, 2003). The major goal of brewing yeast in the
fermentation process is to produce ethanol, carbon dioxide and flavour-active
compounds. It is the flavour from the by-products of fermentation that distinguish
specific beer products from other alcoholic products. Although ethanol is a desirable
product of fermentation, its accumulation during fermentation can result in a
significant stress on the cells. It can act as a stressor and trigger an impact to the cells
both physiologically and metabolically. These impacts include: inhibition of cell
growth and impairment of cell viability; alteration in the metabolic pathways;
increases in the duration of the fermentation process; modification of the cell wall and
membrane structure and function; as well as modifications in the gene expression,
� 17
such as the genes that are related to the induction of stress response (Lentini�������,
2003).
Highly ethanol-tolerant yeast contain a higher percentage of unsaturated fatty
acids, mainly higher acyl chain fatty acids, in their cells (Chen, 1981). Thus, the
fluidity of the cell membrane in response to the physical effect of ethanol tightening
the membrane is increased in the presence of a high level of unsaturated fatty acids.
The changes in the ratio of the saturated to unsaturated fatty acid indicates that the
cells may remove the saturated fatty acids in order to enable a greater proportion of
unsaturated fatty acids to be accommodated by the membrane causing an increase in
ethanol tolerance (Lentini�������, 2003).
�%�,�/��##��$��#� ��!$���""���""��
The cell wall of yeast has certain important properties in the brewing industry. Some
brewing yeasts rise to the surface of the fermenting wort towards the end of
fermentation (top yeasts) while others sediment to the bottom (bottom yeasts). This
distinction is a reflection of the differences in composition of the yeast cell walls
(Hough�������, 1971 -a).
�%�/��.�$�3�"���(�$��� !����#��'��$�$����
�%�/�����������
The minium requirements for yeast to grow are simple sugars, amino acids, salts and
vitamins. The sugars provide for the energy production as well as for biosynthesis of
required metabolites, the amino acids are for the biosynthesis of proteins, while the
salts and vitamins play important metabolic roles. In addition, the yeast also needs
sterols, unsaturated fatty acids and dissolved oxygen (Hough, 1985). �
� 18
The pathway of alcohol formation from an amino acid can be divided into
three steps. Firstly, an amino acid is converted into its α-keto analogue,
decarboxylated to an aldehyde, and then reduced to an alcohol with one less carbon
atom than the original amino acid (Wainwright, 1971). These events can occur with
amino acids such as L-phenylalanine, L-tyrosine, and L-tryptophan.
�
�%�/����'3���4.� ����#4�����!�5�.�6�(�$��� �
The main energy-generating process for the yeast is through the glycolytic or
Embden-Meyerhof-Parnas (EMP) pathway, which was discovered by Ehrlich in the
early 1900 (Ehrlich, 1907). This pathway has been reviewed several times since then,
most recently by Hazelwood ������(Hazelwood�������, 2008). In the presence of D-
glucose, the cells can efficiently generate ATP molecules via glycolysis by substrate
level phosphorylation, and subsequently the carbon source is oxidized completely into
carbon dioxide and water in the TCA cycle. Many species of Yeast, such as
����������� ���� will oxidize pyruvate completely to carbon dioxide and water
(respiration) under aerobic conditions; and will ferment only under anaerobic
conditions. However, ��� ��� � prefers fermentation to respiration even in the
presence of oxygen and produce ethanol aerobically when the right carbon sources are
supplemented (Fix, 1996).
�%�/�%�������$!��#�#��'��$�$����
In the excessive supplementation of D-glucose, the major product is ethanol; however
a small part is converted to acetyl-CoA. The acetyl-CoA is important for cell
metabolism. It is involved in the syntheses of sterols, fats and esters, as well as amino
acids (Hough, 1985). Under anaerobic conditions, mitochondria are not fully
� 19
developed in the presence of D-glucose, but will begin to develop once the
concentration of the D-glucose is reduced to a low level. This is also known as
substrate inhibition (Hough, 1985). On the other hand, aerobic metabolism is
obviously more effective in terms of energy yield than anaerobic metabolism, and
therefore less glucose is required to fulfil the requirements of growth and maintenance.
However, if the yeast can metabolise ethanol under aerobic condition, this will yield
energy almost equivalent to the difference between aerobic and anaerobic metabolism
of D-glucose. Not all D-glucose is metabolised via the EMP pathway, some goes
through the pentose phosphate pathway which yields not only energy but also pentose
sugars that are important for the syntheses of nucleotides and nucleic acids as well as
the formation of NADPH for biosynthetic reactions (Caubet�������, 1988).
In addition, there are number of minor products of fermentation produced
beside ethanol and carbon dioxide. Examples of these are including fusel alcohols,
acids, esters, aldehydes, ketones, glycerol, sulphur, and flavouring products.
� �%�/�%��&�!�"��"����"�5��������"����"6
Fusel alcohols are higher alcohols whose production is largely governed by the amino
acid composition of the wort and a plentiful availability of sugar (van Iersel� ��� ���,
1999; Willaert and Nedovic, 2006). These higher alcohols can be produced in two
different pathways. The Ehrlich pathway is one of the pathways whereby higher
alcohols can be produced: amino acids are taken up from wort and transaminated in
the cell to α-keto acids (Sentheshanmuganathan, 1960). These acids are subsequently
decarboxylated to aldehydes which are reduced to alcohols with one less carbon atom
than in the initial amino acid (Sentheshanmuganathan, 1960). High levels of an
amino acid can lead to enhanced levels of the fusel alcohol analogue. For example,
� 20
excess L-valine promotes the production of isobutanol during fermentation through a
pathway from oxo-acid to α-oxoisovaleric acid and then to the aldehyde
isobutyraldhyde (Yamauchi�������, 1995). An alternative route in the penultimate step
of the amino acid biosynthetic pathways is the formation of α-keto acid which is
transaminated to form an amino acid. If the α-keto acids are decarboxylated and then
reduced as in the Ehrlich pathway then higher alcohols are liberated (Guymon, 1964).
Nevertheless, in both pathways the final reduction of aldehyde to alcohol involves
NADH, and it is thought that the production of higher alcohols by yeast is partly
aimed at maintaining redox balance (Sentheshanmuganathan, 1960).
�
� �%�/�%���������������!�
A broad range of organic acids is generated during fermentation, and some of these
make critical contributions towards the flavour of the product (Willaert and Nedovic,
2006; Yamauchi�������, 1995). Two groups of acids can be found in the fermentation;
one is comprised of the volatile organic acids which are produced by the hydrolysis of
acetyl-CoA. The other group of acids is the non-volatile organic acids. These include
the oxo-acids, such as pyruvic acid and products of the Krebs cycle such as succinic
acid (Richardson�������, 1989). The production of oxo-acid is closely related to the
composition of amino acid in the wort (Yamauchi�������, 1995).
� �%�/�%�%��!$��!
Esters are by-products in any fermentation process, and are produced by the
interaction between alcohols and carboxylic acids, they range from C3, (ethyl acetate)
to C17 (3-methylbutyl dodecanoate)] (van Iersel� ��� ���, 1999; Yoshioka and
Hashimoto, 1981). Carboxylic acid is activated by coenzyme A (CoA) prior to
� 21
esterification, and ester synthesis requires acyl-CoA, the formation of which is a
cytosolic process and is dependent on the supply of acetyl-CoA as a precursor
(Nordstrom, 1962). They are derived from oxo-acids which are produced either from
carbohydrate metabolism, such as pyruvic acid, oxoglutaric acid or from amino acids
by transmination with existing oxo-acid. From oxovalerate, it can be aminated or
transaminated enzymically to produce L-valine. Alternatively, oxovalerate will
enzymically decarboxylate to produce isobutyraldehyde, followed by reduction using
NADH and alcohol dehydrogenase, to produce isobutanol. This is analogous to
pyruvate that will give ethanol and carbon dioxide as products. Diketones such as
diacetyl are known as powerful flavour substances produced during fermentation
which arises from the excretion of the compound acetolactate and confers a toffee
taste.
Esters play a crucial role in determining of beer flavour. Their presence,
especially in excessive quantities, leads to an “off-flavour”. Acetic acid is a by-
product of fermentation and ethyl acetate can be formed by its direct esterification
with ethanol (Yoshioka and Hashimoto, 1983).
� �%�/�%�,��"��� ��!2���$���!������" ����"
Aldehydes and ketones are by-products of fermentation and contribute to flavour.
One of the most flavour-active compounds produced during fermentation is diacetyl
which gives a toffee or butterscotch taste (Russell, 2006).
Glycerol is function as a compatible solute in osmoregulation which enable to
cells to grow in high sugar or salt environments. Many yeast can use glycerol as a
sole carbon source under aerobic conditions, but glycerol is a non-fermentable carbon
source for ������ �. Glycerol is produced at the early stages of fermentation and
� 22
as a result of a mechanism to prevent the build-up of NADH which occurs during the
early stages of fermentation. NADH is used to reduce dihydroxyacetone phosphate to
glycerol phosphate which is subsequently de-phosphorylated to glycerol.
�
� �%�/�%�/�-�"(�����
Sulphur compounds are potent flavouring and aromatic substances. They arise
primarily from organic sulphur compounds in wort, such as the amino acid L-
methionine or sulphur-containing proteins. In the absence of organic sources of
sulphur, flavour compounds can be derived from sulphate. Hydrogen sulphide is the
simplest form of the sulphur volatiles and is produced particularly during active yeast
growth (Hough, 1985).
� �%�/�%�1�&"������
In industrial fermentations, amino acids are important not only for yeast biomass
production but are catabolized in the Ehrlich pathway where they are deaminated and
decarboxylated to produce higher alcohols like isobutanol and isopentanol. These
higher alcohols are the metabolites that produce flavours in fermented beverages and
are derived from the α-keto acid intermediates accumulated from biosynthetic
pathways of amino acids when they are not utilized due to the shortage of amino
groups from transamination.
�%�1��!!��$��"�#��$��!����$���3�����������!$� �
The expression of genes up-regulated during fermentation has been studied to give
insight into methods of maximising the production and profile of aroma and flavour
compounds produced in brewing processes. Genes that participate in the glycolytic
� 23
pathway have been found up-regulated for the generation of ethanol from D-glucose
under anaerobiosis (Wu�������, 2004).
On the other hand, studies such as the over-production of the exoglucanase
gene (����) in yeast has been used to enhance the production of aroma during
fermentations in order to improve the flavour profile of the products (Gil�������, 2005).
Alternately, enhancing the activity of yeast alcohol acetyltransferase (����) can
increase the level of flavour production (Fujii�������, 1994; Lilly�������, 2000). More
than 1000 volatile compounds have been identified and of these, more than 400 are
produced by yeasts during fermentation (Nyka¨nen, 1986). The characteristic fruity
odours of the fermentation bouquet are primarily due to a mixture of hexyl acetate,
ethyl caproate (apple-like aroma), isoamyl acetate (banana-like aroma), ethyl
caprylate (apple-like aroma), and 2-phenylethyl acetate (fruity, flowery flavor with a
honey note) (Lilly� ��� ���, 2000). The major volatile products of yeast metabolism,
ethanol and carbon dioxide, have a relatively small contribution to flavor. Conversely,
organic acids, higher alcohols and esters and to a lesser extent acetaldehyde constitute
the main group of compounds that form the fermentation by-products (Rapp and
Versini, 1991; Romano�������, 2003).
�
�,�������3��!�!�
�,��&��$��!�#���������3�������$���
Yeast is a facultative organism which can survive and grow in either the presence or
absence of oxygen. However, when cells are shifted from one condition to the other,
the physiology and metabolism of the cells are altered so that the cells can adjust for
adapting to the new condition in order to survive. There are some essential
requirements and factors for anaerobic growth of yeast cells.
� 24
Major changes in gene expression occur during fermentation as was observed
in a gene expression study on wine yeast (Rossignol�������, 2003). More than 2000
affected genes were found as the yeast cells adapted to the changing nutritional,
environmental and physiological conditions. The observed patterns of regulation
were found consistent and suggested a complex interplay of signalling and regulatory
networks under these changing conditions (Rossignol� ��� ���, 2003). Expression of
genes that code for the involvement of critical metabolic pathways such as glycolysis
and ergosterol uptake were strong throughout the entire fermentation process. A
significant number of the strongly expressed genes are regulated by anaerobiosis,
these include genes that are involved in sterol uptake, trafficking, cell wall proteins,
fatty acid desaturation (Rossignol�������, 2003). Nevertheless, it is necessary for the
cells to change their gene expression patterns in order to adapt the changing
environment.
�,�������!$���"��
Sterols are integral structural components of the cell membrane. In yeast, ergosterol
is crucial for maintaining the fluidity of plasma membrane in cellular functions (Nes�
������, 1978). However, ergosterol can only be synthesized in the presence of oxygen
therefore supplementation of ergosterol is crucial in the medium for anaerobic
growing yeast (Andreasen and Stter, 1953; Reiner�������, 2006). A microarray study
found that genes involved in the biosyntheses of ergosterol were highly induced
during the initial stages of a lager fermentation (Higgins�������, 2003) and indicated
the importance of ergosterol requirement for protection against oxidative stress.
�
�
� 25
�,�����'��������!���)����'��$!��
Compared to mammalian cells, yeast cells can synthesize all 20 amino acids and can
grow in the medium without any supplementation of these nutrients in most
conditions. One of the ways to interfere with the ability of yeast to synthesize an
amino acid is by mutating or inhibiting a biosynthetic enzyme; or by culturing yeast in
an imbalanced medium where an amino acid present in excessive can inhibit an
enzyme involved in biosynthesis of a second amino acid lacking in the medium
(Dever and Hinnebusch, 2005). During starvation of amino acids, yeast cells induce
the transcription of over 70 genes encoding enzymes that function in the biosynthesis
of all 20 amino acids (Natarajan and Hinnebusch, 2002).
Genes that are involved in the biosynthesis of L-serine (��������������� ��
and� ��� ) have been found to be up-regulated in wine yeast during fermentation
(Rossignol� ��� ���, 2003), as well as in a laboratory strain during anaerobiosis (de
Groot�������, 2007). A similar study was performed by Varela ������, 2005 with wine
yeast under winemaking conditions (Varela� ��� ���, 2005), and found that !���
(encoding for 3-phosphoglycerate kinase) was highly expressed. !��� is involved in
the metabolic pathway of D-glucose to L-serine biosynthesis. Also, a mutant lacking
���� was unable to grow anaerobically (Reiner� ��� ���, 2006), even with the
supplementation of ergosterol and unsaturated fatty acids (Tween 80) in a rich
medium (YPD). These results suggested that there may be some role for L-serine
biosynthesis under anaerobic conditions.
�,��%��$�����!!��$��"�����!�#���������3�������$��
Several differences between aerobic and anaerobic growth are evident, for example
the energy yield is much lower under anaerobic conditions. These differences may be
� 26
due to the requirement for oxygen in several biosynthetic pathways. Under anaerobic
conditions, the plasma membrane contains more saturated fatty acids, less total sterol,
less ergosterol and less squalene. This may be due to the inability of the cell to
synthesize these specific sterols in the absence of oxygen (Nurminen� ��� ���, 1975).
The synthesis of heme is highly dependent on oxygen, such that there is no other
alternative pathway that can eliminate this requirement (Kwast� ��� ���, 2002).
Moreover, the biosynthesis of sterols is another pathway which requires oxygen. In
the absence of oxygen, the cells lose the ability to synthesis sterols and instead need to
take it up from the medium (Andreasen and Stter, 1953) and hence supplementation
with a sterol such as ergosterol is essential for anaerobic growth (Higgins�������, 2003;
Reiner�������, 2006), and Tween 80 is also required as a source of unsaturated fatty
acids whose synthesis is also oxygen-dependent.
Numerous studies have employed genome-wide screen technology to
investigate the groups of genes which are induced when cells are under anaerobic
conditions (James�������, 2003; Kwast�������, 2002; Lai�������, 2005; van den Brink����
���, 2008). Genome-wide transcriptional adaptations to aerobiosis and anaerobiosis
have been studied as well (Alimardani�������, 2004; Lai�������, 2006; ter Linde�������,
1999). Table 1.1 illustrated that genes within the functional groups of transcription,
protein folding and degradation, transport, oxidative responses, stress responses, cell
wall biogenesis, sterol and fatty acid metabolism, and metabolism were differentially
expressed in transcriptional studies involving anaerobic/aerobic shifts.
� 27
��3"��� Induced genes within the functional groups found in several genome-wide
microarray studies of anaerobiosis or shifts between aerobic and anaerobic conditions.
James1 Kwast2 Lai3 van den Brink4 Alimaedani5 Lai6 ter Linde 7
Transcription √ √ √ √ √ √ √
Protein
folding,
degradation
√ √ √ √ √ √
Transport √ √ √ √ √ √
Oxidative
Responses √ √ √ √ √ √ √
Stress
responses √ √ √ √ √ √ √
Cell wall
biogenesis √ √ √ √ √ √ √
Sterol and
fatty acid
metabolism
√ √ √ √ √ √ √�
Metabolism √ √ √ √ √ √ √
1. (James� ��� ���, 2003) – dextrose medium, bottom-fermenting lager (Guinness 6701),
beginning vs. end of fermentation phase (Day 8). 2. (Kwast�������, 2002) – galactose medium,
JM43 (MATα), aerobic vs. anaerobic conditions. 3. (Lai� ��� ���, 2005) – glucose medium,
JM43 (MATα), aerobic vs. anaerobic conditions. 4. (van den Brink�������, 2008) – glucose
medium, CEN.PK113-7D (MAT�), aerobic vs. anaerobic conditions. 5. (Alimardani�������,
2004) – glucose medium, FY1679α (MATα), aerobic vs. anaerobic conditions. 6. (Lai�������,
2006) – galactose medium, , JM43 (MATα), aerobic vs. anaerobic conditions. 7. (ter Linde����
���, 1999) - glucose-limited medium, CEN.PK113-7D (MAT�), aerobic vs. anaerobic
conditions.
Transcript levels of the cell wall mannoprotein genes �"!� and �"!� were
found to be decreased in a study of gene expression in anaerobic cells (Klis� ��� ���,
2002). Table 1.2 illustrates that almost all of the cell wall mannoprotein genes, such
as #��, �$� and !�% were found to have increased expression during the studies
� 28
(Kwast, 2002; Lai, 2005; Lai, 2006) and some of the others genes were identified in
other studies (Alimardani, 2004; James, 2003; ter Linde, 1999; van de Brink, 2008).
��3"�� �� Genes in the cell wall mannoproteins that are involved in cell wall
biosynthesis found in the genome widescreen microarray analyses from the same
research groups listed in Table 1.1.
*����� James1 Kwast2 Lai3 van den Brink4 Alimaedani5 Lai6 ter Linde 7 �$�� √ √ √ √ √ �$�� √ √ √ √ √ √ �$� √ √ √ √ √ �$�� √ √ √ √ √ √ √ �$!� √ √ √ √ √ √ #��� √ √ √ √ √ √ #��� √ √ √ √ √ #�� √ √ √ #��� √ √ √ √ !�%� √ √ √ √ !�%� √ √ √ √ √ !�% √ √ √ √ !�%� √ √ √ √ !�%& √ √ √ √ !�%' √ √ √ √ √ !�%( √ √ √ √ !�%)*�� √ √ √ 1. (James� ��� ���, 2003) – dextrose medium, bottom-fermenting lager (Guinness 6701),
beginning vs. end of fermentation phase (Day 8). 2. (Kwast�������, 2002) – galactose medium,
JM43 (MATα), aerobic vs. anaerobic conditions. 3. (Lai� ��� ���, 2005) – glucose medium,
JM43 (MATα), aerobic vs. anaerobic conditions. 4. (van den Brink�������, 2008) – glucose
medium, CEN.PK113-7D (MAT�), aerobic vs. anaerobic conditions. 5. (Alimardani�������,
2004) – glucose medium, FY1679α (MATα), aerobic vs. anaerobic conditions. 6. (Lai�������,
2006) – galactose medium, , JM43 (MATα), aerobic vs. anaerobic conditions. 7. (ter Linde����
���, 1999) - glucose-limited medium, CEN.PK113-7D (MAT�), aerobic vs. anaerobic
conditions.
The inability of anaerobic cells to synthesise sterols and unsaturated fatty
acids greatly influences the structure and regulation of the cell wall and the cell
� 29
membrane and does lead to a greater requirement for these sterols and fatty acids, as
well as increased efficiency of their uptake from the supplemented medium (Snoek
and Steensma, 2007).
�/���'��������!�3��! �$��!�!�����'�$�3�"�!'�
�/���'����������($����! !$�'�5�'���������(��'��!�6�
Amino acids are essential for cell growth. Yeast cells can either synthesize their own
amino acids or take them up from the medium. Two types of amino acid uptake
system can be found in yeast (Cooper, 1982). The first system is a low specificity
general transporter that can uptake all naturally occurring amino acids. This is the
general amino acid permease (GAP). The other system involves transporters that
display specificity for one or a small number of related amino acids (Large, 1986).
The regulation of amino acid uptake by GAP is controlled by level of expression level
of the ��! protein, which is strongly dependent on the nature and availability of a
nitrogen source. Thus, ��! is not synthesized when yeasts are grown in nitrogen-
rich media such as ammonium ions (Grenson�������, 1970; Rytka, 1975), and hence
the presence of ammonium ions may inhibit the uptake of the amino acids. Gap1p is
subjected to ammonium catabolic repression, and the specific amino acid transport
systems in yeast are not considered to regulate by repression mediated by the
metabolite. By regulating the expression of amino acid transporters, the cells are able
to adapt to fluctuations on amino acid availability (Bungard and McGivan, 2004).
The membrane transport efficiency in yeast cells can be greatly affected by the
relative availability of amino acids and the concentration of ammonium ions which
may therefore lead to an influence on the brewing process. In industrial fermentations,
the type and the amount of amino acids present have an impact on the spectrum of
� 30
metabolites produced by cells. However, the addition of mixtures of amino acids or
just L-glutamate to fermentation media can stimulate yeast growth so that the duration
of the fermentation can be reduced (Thomas and Ingledew, 1990). Furthermore, the
supplementation of amino acids to defined growth medium can increase the yield of
ethanol and diminish the production of glycerol (Albers�������, 1996). The amount of
higher alcohols produced is dependent on the availability of amino acids from
metabolism (Albers�������, 1996). For some yeast strains, the presence of ammonium
salts may enhance cell growth (Mendes-Ferreira�������, 2004), however, for brewer’s
yeast, the addition of an amino acid mixture is preferred for rapid cell growth. On the
other hand, the presence of ammonium ions can inhibit the uptake of amino acids and
lead to delayed growth. A list of amino acid permeases is provided in Table 1.3,
which shows the specificity of each amino acid permease for the uptake of different
amino acids. The genes encoded for permeases such as ��!�, +�!�, ����, ��!�,
��!�, ,-!� and .%! are all under the regulation of the general control of nitrogen
metabolism control system mediated by the transcription factor Gcn4p (Ahmad and
Bussey, 1986; Grauslund� ��� ���, 1995; Isnard� ��� ���, 1996; Jauniaux and Grenson,
1990; Schreve�������, 1988; Sychrova and Chevallier, 1993; Zhu�������, 1996).
� 31
��3"���% Specificity and regulation of the genes encoding amino acid permeases
*����
��'��
�'��������!�$���!(��$��� ����"�$���� ��#�������
�,!�� Arg, Lys (Cationic amino acid) (Regenberg�������,
1999)
��!�� Ala, Arg, Asn, Asp, Gln, Glu,
Pro, Phe, Ser, Trp, Tyr
Gcn4p, Stp1p, Stp2p (Schreve�������,
1988)
��!�� Ile, Leu, Met, Thr, Val Osmotic stress (Aouida�������,
2005; Schreve
and Garrett, 2004)
��! � Ile, Leu, Met, Thr, Val Sulphur limitation (Boer�������,
2003; Schreve
and Garrett, 2004)
+�!�� Cys, Ile, Leu, Met, Phe, Trp,
Tyr, Val
Gcn4p, Stp1p,
Stp2p, Leucine
(Grauslund�������,
1995)
+�!
(!�!�)
Cys, Ile, Leu, Met, Phe, Trp,
Tyr, Val
Abt1p, Stp1p, Stp2p,
Leucine
(Regenberg�������,
1999)
����� Arg, Lys (Cationic amino acid) Gcn4p, Gln3p (Ahmad and
Bussey, 1986)
#$!&� Ala, Asn, Asp, Gln, Glu, Gly
Ser, Thr
Arg80p, Arg81p (Regenberg�������,
1999; Regenberg�
������, 1998)
��!�� All 20 amino acids Gcn4p, Gln3p,
Leu3p
(Jauniaux and
Grenson, 1990;
Springael and
André, 1998)
��!�� Asn, Cys, Glu, Gln, Leu, Lys,
Met, Ser, Thr
Grr1p, Gcn4p,
Stp1p, Stp2p
(Regenberg�������,
1999; Zhu�������,
1996)
/$!�� His (Farcasanu�������,
1998; Tanaka and
Fink, 1985)
,-!�� Arg, Lys (Cationic amino acid) Gcn4p (Sychrova and
Chevallier, 1993)
� 32
*����
��'�
�'��������!�$���!(��$�� ����"�$��� ��#������
.�!�,
.�!�,
.�!
NH3 NCR (Lorenz and
Heitman, 1998;
Marini�������,
1997; Marini����
���, 1994)
.%! � Met Met4p, Met28p,
Met31p, Met32p,
Cbf1p, Gcn4p
(Isnard�������,
1996)
.%!�� Met Stp1p, Stp2p (Isnard�������,
1996; Kosugi����
���, 2001)
!%��� Ala, Gly, Pro, GABA* Gln3p (Jauniaux�������,
1987; Vandenbol�
������, 1989)
��.�� S-adenosylmethionine (Thomas, 2000;
Thomas and
Surdin-Kerjan,
1991)
..!�� S-methylmethionine (Rouillon�������,
1999)
�����
(��!�)
Cys, His, Ile, Leu, Trp, Tyr, Val, Stp1p, Stp2p,
leucine induction
(Bajmoczi�������,
1998; Schmidt����
���, 1994)
�����
(��.�)
Cys, Phe, Trp, Tyr (Regenberg�������,
1999; Schmidt����
���, 1994)
%���� GABA* (Andr������,
1993; Correa
García�������,
1997)
*GABA = gamma-aminobutyric acid
� 33
�/�������"�$�����#��'���������3��! �$��$���(�$��� !�
The regulation of amino acid biosynthesis by the general control system has been
comprehensively researched by the Hinnebusch group at both the transcriptional and
translational level (Hinnebusch, 1984; Hinnebusch, 1990; Hinnebusch, 1997;
Hinnebusch, 2005; Hinnebusch and Fink, 1983; Hinnebusch and Natarajan, 2002).
These studies elucidated the mechanism of regulation based on Gcn4p ( General
Control Nonderepressible ) that include how cells coordinate the repression and
derepression of the amino acid biosynthetic pathway enzymes in regard to amino acid
availability. �
�
�/�%�*�����"����$��"����4��(��!!�3"��4������
In yeast, Gcn4p (General Control Nonderepressible) is a principle transcriptional
activator that directly activates over 30 amino acid biosynthetic genes and regulates
the synthesis of 19 out of 20 amino acids. The Gcn4p-binding motif is located
upstream of many genes which are induced during amino acid starvation (Large,
1986; Natarajan� ��� ���, 2001). However, it also directly or indirectly regulates the
expression of genes for the biosynthesis of purine, biosynthesis of organelles,
autophagy, glycogen homeostasis, and several multiple stress responses (Hinnebusch
and Fink, 1983). Gcn4p has been shown to bind the consensus sequence TGACTC,
located upstream of many genes induced during amino acid starvation (Large, 1986;
Meimoun� ��� ���, 2000; Natarajan and Hinnebusch, 2002; Natarajan� ��� ���, 2001).
Apart from the activation of amino acid biosynthesis during cell starvation, Gcn4p
also regulates the expression of genes that are responsible for several environmental
stress stimuli (Natarajan�������, 2001).
� 34
Natarajan ��� ���� (Natarajan� ��� ���, 2001) have employed microarray
technology for the genome-wide analysis of genes whose expression is regulated by
Gcn4p. Table 1.4, summarises functions of the 543 genes that are targets of Gcn4p.
� 35
��3"�� �,� *���� #���$���!� ����"�$��� 3 � *��,(� #��'� $��� '�������� � !$�� � �#�
��$���7��������2��88�
*����#���$���!� ��'3��!� �#� ����!�
#�������"�$���
Amino acids biosynthetic genes 73
Vitamin/ cofactor biosynthetic genes 16
Mitochondrial carrier protein genes 8
Amino acid precursor biosynthetic genes 4
Purine biosynthetic genes 5
Peroxisomal genes 6
Regulatory molecules: Protein kinases, Phosphatase
regulatory subunits, Transcription factors
11, 4, 26
Energy metabolism: Glycogen and trehalose homeostasis 10
Salvage pathway: Autophagy, Vacuolar protease 3, 2
Other known genes or genes of unknown function 375
Repressed genes: Ribosomal proteins and translation
factors
Data not shown
�/�,����4���3���'�$�3�"�!'�
Gcn4p has been shown to regulate genes involved in one-carbon metabolism when
cells are under aerobic conditions (Sudhakar �����, 1999, Garcia-Barrio �����, 2002).
Glycine and L-serine are the two amino acids which are involved in one-carbon
metabolism. They donate their one-carbon units for the synthesis of tetrahydrofolate
(THF) in the cytoplasm and mitochondria. Formate is another metabolite which
donates its carbon unit in one-carbon metabolism. �
� One-carbon metabolism encompasses the reactions whereby one-carbon units
are transferred from the donors L-serine, glycine or formate via THF derivatives to
essential biosynthetic processes including methyl group biogenesis and the synthesis
� 36
of nucleotides, vitamins and some other amino acids (Cook, 2000; Piper�������, 2002).
This metabolism plays an important role in several metabolic pathways in yeast,
plants and mammals (Christensen and MacKenzie, 2006). In many organisms, L-
serine is the main one-carbon donor and its conversion to glycine via cytoplasmic
serine hydroxymethyltransferase (encoded in ��� ��� � by �/.�) leads to the
formation of the key intermediate 5,10-methylene tetrahydrofolate (5,10-CH2-
H4folate). Figure 1.1 provides an overview of one-carbon metabolism in yeast.
Cytoplasmic 5,10-CH2-H4folate is reversibly converted to other H4folate derivatives
at different oxidation states by the trifunctional enzyme encoded by �#� � and the
dehydrogenase encoded by .�#�. These reactions are duplicated in the
mitochondrion, catalysed via the mitochondrial serine hydroxymethyltransferase
(encoded by �/.�) and the mitochondrial trifunctional C1-H4folate synthase
(encoded by .$��)�
� 37
�������
�������
��� � ��� �
������ � ������ �
����
����
����
��
����
���
����
�������� � ����
��������
���
���� ����
�
���
������������
��� ���
������������
����
������� � �
����
�������� �
�����������
�����
������
��������� �
���
!������ "����������
����
��
����
&������ � An overview of one-carbon metabolism with glycine, L-serine and
formate as the three one carbon donors that can move between the cytoplasm and
mitochondria (Piper�������, 2000).
� 38
�/�,��*" ������
Glycine is a one-carbon donor via the action of the strictly mitochondrial glycine
decarboxylase complex encoded by ��0�����and� and ,!#�. Formate is activated
to 10-formyl-H4folate via the synthetase activity encoded by �#� in the cytoplasm
or .$�� in the mitochondrion. One-carbon units can be transferred between the
mitochondrion and the cytoplasm via formate as an intermediate. The interconversion
of one-carbon donors and intermediates is highly regulated at the level of enzyme
activity as well as at transcription (Cook, 2000; McNeil�������, 1996). In ������ �,
many of the genes involved form a regulon that responds to the cytoplasmic level of
5,10-CH2-H4folate (Gregory�������, 2000; Hong�������, 1999; Pasternack�������, 1996;
Piper�������, 2000).
�/�,���+4-�������
L-serine is the main source of the single carbon pool required for the syntheses of
purine nucleotides, thymidylate, and L-methionine. It also donates the carbon chain
to L-tryptophan and phospholipids. The two carbons of its chain are thus
incorporated into purines and heme though glycine.
Two of the three known metabolic pathways to L-serine and glycine have been
shown to be present in prototrophic yeast strains; the phosphorylated pathway from
glycolytic intermediates and the glyoxylate pathway using intermediates from the
TCA cycle. Two L-serine-glycine auxotrophs (��∆ and ��∆) were found to be
blocked in the phosphoglycerate pathway (Ulane and Ogur, 1972). The ���� gene
encodes 3-phosphoserine aminotransferase, and the ���� gene phosphoserine
phosphatase. Another pathway to glycine from isocitrate, is repressed by growth in
media are supplemented with D-glucose. This pathway is derepressed by growth to
� 39
stationary phase in D-glucose media yielding high activity of these enzymes (Ulane
and Ogur, 1972). Hence, the phosphoserine pathway appears to be the principal
biosynthetic pathway to L-serine and glycine during growth on sugar media (Ulane
and Ogur, 1972).
�/�1��� �
The transcription factor Bas1p regulates purine and histidine biosyntheses (Piper� ���
���, 2000). It is also involved in regulating the expression of genes related to the one-
carbon regulon (Daignan-Fornier and Fink, 1992; Gelling�������, 2004; Piper�������,
2000; Piper� ��� ���, 2002; Subramanian� ��� ���, 2005; Zhang� ��� ���, 1997). It is
interesting to note that Bas1p binds to the same binding site as Gcn4p with the
consensus sequence TGACTC.
However, both Bas1p and Bas2p are required for the regulated expression of
the �#� genes under adenine limited conditions (Arndt�������, 1987; Daignan-Fornier
and Fink, 1992; Pinson�������, 2000; Zhang�������, 1997). The derepression of Gcn4p
stimulates +��� expression under amino acid starvation (Natarajan� ��� ���, 2001).
Recent studies from Joo ��� ��� demonstrated that Gcn4p and Bas1p maintain the
expression of �#� gene at a basal level, while derepressed Gcn4p stimulates the
transcription which is capable of overcoming the stress conditions by activating
amino acid biosynthetic genes such as �#� �(Joo�������, 2009).
� /$�( is an important gene and its gene product is required for the biosyntheses
of L-histidine and purines (Kunzler�������, 1993). The activation of the expression of
/$�(� can be triggered by the limitation of purines or starvation of amino acids
(Springer� ��� ���, 1996). However, under amino acid starvation Gcn4p binds at the
two binding sites (Gcn4p-recognition elements) GCRE1 and GCRE2 which activates
� 40
/$�(. Whereas, Bas1p and Bas2p (required both at the same time) share a common
binding site GCRE2 (Springer� ��� ���, 1996; Valerius� ��� ���, 2003) under purine
limitation. Nevertheless, under amino acids and purine starvations, the /$�(
promoter can simultaneously targeted by both Gcn4p and Bas1p/Bas2p that activates
its transcription (Springer�������, 1996; Valerius�������, 2003).
� These two transcriptional factors (Bas1p and Bas2p) can activate the /$����
/$����and�/$�(�genes (Devlin�������, 1991; Springer�������, 1996), which are needed
for the biosynthesis of L-histidine, as well as �,�����/.���.�#� that are involved
in the biosynthesis of L-glutamine, glycine and 10-formyl tetrahydrofolate (Arndt����
���, 1987; Denis and Daignan-Fornier, 1998).
Conversely, the promoter of the ���� gene contains a potential Bas1p binding
site (TGACTC), which is also a possible target for Gcn4p binding. The
transcriptional regulation of one carbon metabolism regulon by Bas1p and Gcn4p
under aerobic condition has been studied by Subramanian ������ (Subramanian�������,
2005). Shm2p plays an important role in one-carbon metabolism by regulating the
levels of tetrahydrofolate in response to glycine concentration. The Regulation of
�/.� promoter by glycine requires Bas1p, but not Bas2p (also known as Pho2p) or
Gcn4p. In addition, Bas1p has a role in the activation of adenylate biosynthetic genes
when cells are under adenine depletion (Koehler�������, 2007; Som�������, 2005).
�
� 41
�1�����#���$���!��#�*��,(�
�1�����($������!(��!�!�
Gcn4p plays numerous roles in cellular responses such as the adaptation to new
environments and to starvation of amino acids. One example of the adaptive property
of ���� is shown in its response to methylglyoxal (Nomura� ��� ���, 2008).
Methylglyoxal is 2-oxo-propanal (CH3-CO-CH=O), a reactive aldehyde that is
derived as a by-product of glycolysis. It is an endogenous metabolite, but at high
concentrations, it can have deleterious effects on cellular functions. Nomura ����.,
(Nomura�������, 2008) demonstrated that a mutant which lacks ���� loses its ability
to respond to methylglyoxal, whereas a high tolerance adaptive response was
observed in the wild-type cells under the same conditions.
�
�1���+�#��!(�������������
Furthermore, Gcn4p has recently been found to be related to lifespan and aging.
Studies (Chiocchetti�������, 2007; Steffen�������, 2008) have shown that a reduction in
60� ribosomal subunit levels slows down aging in yeast. A significant increase on the
replicative life span was also observed when 60� subunit biogenesis was inhibited.
Gcn4p reduces 60� subunit abundance and hence acts as a potential longevity and a
nutrient-responsive transcription factor by diminishing the 60�� subunits (Steffen� ���
���, 2008). This finding suggests that reduced 60� subunit abundance and Gcn4p
activation extend yeast life span.
�
�
�
� 42
�1�%�9��!$���""���""�
�1�%�����! �$��!�!��#� ��!$���""���""��
The cell wall of yeast comprises 15-30% of the dry weight of the cell. The main
structural constituents of the yeast cell wall are polysaccharides which are made of
three sugars, D-glucose, mannose, and N-acetylglucosamine which accounts for 80-
90% (Cabib� ������, 1982; Sentandreu and Northcote, 1969). Proteins present in the
cell wall have a high content of L-glutamic acid and L-aspartic acid (McMurrough
and Rose, 1967). Figure 1.2 illustrates an overview of the yeast cell wall (Pitarch����
���, 2008), and identifies several methods for the yeast cell fractionation based on a
distinctive property of each component. The cell walls of yeast are principally β*
linked glucans and mannans with a minor proportion of chitin. β(1→3)glucan is one
of the glucose polysaccharides which provide the structural and strength component
of the cell wall whereas β(1→6)glucan plays an essential role in cross-linking.
However, the amount of β(1→6)glucan is relatively less than β(1→3)glucan (Bacon�
������, 1969). Mannose polysaccharides are linked to the proteins to form a layer of
mannoproteins which are located at the external surface of the cell (Lesage and
Bussey, 2006). This mannoprotein layer makes the inner layer less accessible to cell
wall-degrading enzymes and acts as a filter for large molecular weight compounds
(Zlotnik�������, 1984). It is also involved in cell-to-cell recognition events (Snoek and
Steensma, 2007). Chitin in yeast has a central role in septation which is important for
cell survival (Bulawa, 1993).
It is crucial for the cell to maintain cell wall integrity at all times. This
includes the stages of the cell cycle which involve extensive remodelling of the cell
wall, including budding, cell division, sporulation and pseudohyphal formation. It
also includes situations of stress that may occur in extreme conditions such as heat
� 43
shock, osmotic shock and pH changes (Cabib, 2001; Horie, 2001; Klis, 2006; Lesage,
2006). The cell wall has numerous roles in cell survival by protecting the cell
contents. It is necessary for the cell wall to constantly change its pattern in order to
adapt to any dramatic environment and conditions. Therefore, the role of cell wall
synthesis is not only for cell protection but also for cell growth and division.
�
� 44
�1�%�����""���""�'����(��$���!�
As the major component of the cell wall, mannoproteins comprise 40% of the cell
mass and they determine the permeability of the cell wall (Zlotnik� ��� ���, 1984).
Mannoproteins are glycoproteins with 1-linked oligomannoses and �-linked high-
mannose-type oligosaccharides which have highly branched outer chain of mannose
(Klis, 1994). The mannoproteins contain many L-serine and L-threonine residues
which carry short oligomannosyl chains and provide the polypeptide backbone of the
cell wall. Glycosylphosphatidyl-inositol (GPI) -anchored mannoproteins made up one
of the major cell wall components of eukaryotic microorganisms including yeast and
fungi. Some GPI-anchored proteins are localized at the plasma membrane but others
are processed at the plasma membrane and are covalently linked to β(1→6)glucan of
the cell wall through the GPI portion. However, certain mannoproteins have
important roles in mating and during the transition to hyphal growth (Roy� ��� ���,
1991). Cwp2 mannoprotein is one of the most abundant proteins in the cell wall and
along with Cwp1 has a role in stabilise the cell walls (van der Varrt� ��� ���, 1995).
Interestingly, Cwp1 and Cwp2 are expressed under normal growth conditions whereas
other mannoproteins tend to be expressed and are triggered by environmental stress.
Genes that are related to the #��2�$� group (#����� #����� #�� �� #����� �$����
�$�����$� ���$����34��$!�) are induced during anaerobic growth (Abramova�������,
2001b). These genes are required for anaerobic growth and the expression of �"!�
and �"!� is switched off during anaerobiosis (Abramova� ��� ���, 2001b) as
summarised in Table 1.2. An essential requirement for adaptation to anaerobiosis is
having one group of proteins replacing another group. Hence, the expression of
#�����#��� and the �$� genes was found largely induced within the first hours of
anaerobiosis (Abramova�������, 2001b), such that these genes are required to switch
� 45
on in order to adapt to the anaerobic condition for cell survival and growth. On the
other hand, �"!� and �"!� were down-regulated more than 10-fold within the first
2.5 hours following the shift to anaerobiosis (Abramova�������, 2001b). Nevertheless,
#���, �$�� and �$�� are not essential for anaerobiosis (Cohen�������, 2001), while
�$� and �$�� are crucial since mutants lacking �$� or �$�� are unable to grow
anaerobically (Abramova�������, 2001a).
The genes and enzymes responsible for cell wall assembly are potential targets
of anti-fungal reagents (Tsukahara� ��� ���, 2003). The gene encoding GPI-anchored
wall protein transfer (Gwt1p) was identified as a new anti-fungal drug candidate
target. �"�� is involved in the acylation of the inositol during the GPI synthetic
pathway (Umemura�������, 2003). The composition, structure and function of the cell
wall in ��34 4����5 ��3 and ������ � have been reviewed by several groups and
there are similarities (Bishop�������, 1960; de Groot�������, 2004; Fleet, 1991; Klis����
���, 2006; Lesage and Bussey, 2006; Shepherd, 1987). The mannoproteins of the
pathogenic yeast �����5 ��3 have been determined as the mediator of cell adhesion to
the host tissues and virulence (Sundstrom, 2002).
�
�:���'�
This thesis was initiated by Anthony Beckhouse (PhD, UNSW 2008) who reported
that cells lacking Gcn4p transcription factor regulating genes involved in amino acid
metabolism have a growth defect under anaerobic conditions indicating that there may
be an altered requirement for some Gcn4p-dependent aspect of amino acid
biosynthesis in anaerobic cells compared to aerobic. The aim of this thesis study was,
to identify the role of Gcn4p transcription factor in the adaptation of cells to
anaerobiosis, and to determine which processes regulated by Gcn4p were involved.
� 46
The phenotype of a mutant lacking Gcn4p was found to result from an altered cellular
requirement for L-serine and/or glycine when cells adapt to anaerobic conditions.
Therefore the aim was extended to explore the link between one-carbon metabolism
and the adaptation of cells to anaerobic conditions. Results show a remarkable shift
in metabolic networks as cells adjust to anaerobic conditions.
The synthetic medium used in the previous anaerobic study by Anthony
Beckhouse (Beckhouse, 2006) was purchased from a commercial source and is
composed of D-glucose, inorganic nitrogen source, 12 amino acids and other growth
supplements. There were eight amino acids that were not included in the culture
medium for anaerobiosis; these are L-alanine, L-asparagine, L-cysteine, L-glutamate,
L-glutamine, glycine, L-proline and L-serine. The absence of these eight amino acids
provided the opportunity to investigate which amino acids were essential for
adaptation to anaerobic growth, their importance for anaerobiosis, as well as their
roles in metabolism. HPLC analysis was employed to provide us a better insight of
how the metabolic system is influenced by the lack of oxygen and an understanding of
one-carbon metabolism, Bas1p, L-serine and glycine.
An additional aim was to determine the basis for the additional requirement
for L-serine of cells entering anaerobiosis. This was traced to alterations of cell wall
proteins and hence another aim of this work was to identify changes in cell wall
mannoproteins as cells entered anaerobiosis.
47
CHAPTER 2. MATERIALS AND METHODS
2.1 General materials and methods
2.1.1 Materials
Table 2.1 Materials and reagents used for performing the experiments
Material/Reagent Source
Acetic acid Ajax FineChem, NSW
Agar type 1 Oxoid Ltd., NSW
Agarose (DNA grade) Progen Industries, QLD
Ammonia solution (28% w/w) APS Chemicals Ltd., NSW
Ammonium bicarbonate (NH4HCO3) Sigma-Aldrich, NSW
Ammonium sulphate Difco, NSW
Ampicillin (sodium salt) ICN Biomedicals, NSW
Anaerobic sachet (AnaeroGenTM
) Oxoid Ltd., NSW
Anaerobic jar indicator (BR0055B) Oxoid Ltd., NSW
Bacteriological peptone Oxoid Ltd., NSW
-mercaptoethanol BDH Laboratory Supplies, Poole, England
Bovine serum albumin (BSA) Sigma-Aldrich, NSW
Bradford reagent BioRad, NSW
Calcium chloride APS Chemicals Ltd., NSW
Chloroform APS Chemicals Ltd., NSW
Choline Sigma-Aldrich, NSW
ClonNAT (nourseothricin) Werner BioAgents, Jena, Germany
D-glucose Ajax FineChem, NSW
Diethyl pyrocarbonate (DEPC) Sigma-Aldrich, NSW
48
Di-sodium hydrogen orthophosphate Ajax FineChem, NSW
Dithiothreitol Astral, NSW
Ergosterol 75% Sigma-Aldrich, NSW
Ethanol (EtOH) Ajax FineChem, NSW
Ethidium bromide Sigma-Aldrich, NSW
Ethylene glycol Sigma-Aldrich, NSW
Ethylenediaminetetra-acetic acid di-sodium salt APS Chemicals Ltd., NSW
Formic acid (90% w/w) Ajax FineChem, NSW
Geneticin (G418) Sigma-Aldrich, NSW
Glycerol APS Chemicals Ltd., NSW
Herring sperm DNA Boehringer Mannheim GmbH, Germany
Hydrochloric acid (HCl) Ajax FineChem, NSW
Hydrogen peroxide Ajax FineChem, NSW
Iodine (crystal) Sigma-Aldrich, NSW
Iodoacetamide Sigma-Aldrich, NSW
Isoamyl alcohol (3-methyl-1-butanol) Sigma-Aldrich, NSW
Lithium acetate Sigma-Aldrich, NSW
Magnesium chloride (MgCl2) APS Chemicals Ltd., NSW
Magnesium sulphate BDH Laboratory Supplies, Poole, England
Manganese chloride BDH Laboratory Supplies, Poole, England
Methanol (MeOH) APS Chemicals Ltd., NSW
Media supplements (amino acids) Sigma-Aldrich, NSW
Nitrogen (high purity) BOC gases, NSW
o-Nitrophenyl ß-D-galactopyranoside (ONPG) Sigma-Aldrich, NSW
Peptone Oxoid Ltd., NSW
49
Perchloric acid (70% v/v) Ajax FineChem, NSW
Phenol Sigma-Aldrich, NSW
Phenylmethylsulfonylfluoride (PMSF) Sigma-Aldrich, NSW
Phosphatidylcholine (PC) Sigma-Aldrich, NSW
Phosphatidylethanolamine (PE) Sigma-Aldrich, NSW
Phenylisothiocynanate (PITC) Sigma-Aldrich, NSW
Proteinase inhibitor Roche, NSW
Phosphatidylserine (PS) Sigma-Aldrich, NSW
Polyethylene glycol 3350 (PEG) Sigma-Aldrich, NSW
Potassium acetate APS Chemicals Ltd., NSW
Potassium chloride (KCl) APS Chemicals Ltd., NSW
Potassium hydroxide (KOH) APS Chemicals Ltd., NSW
Potassium phosphate APS Chemicals Ltd., NSW
Resazurin Sigma-Aldrich, NSW
Ribonuclease A (RNase A) Sigma-Aldrich, NSW
Scintillation solution –AQUASOL-2 PerkinElmer, USA
Sodium acetate Sigma-Aldrich, NSW
Sodium carbonate Sigma-Aldrich, NSW
Sodium chloride Ajax FineChem, NSW
Sodium di-hydrogen orthophosphate Ajax FineChem, NSW
Sodium dithionite Sigma-Aldrich, NSW
Sodium dodecyl sulphate (SDS) Sigma-Aldrich, NSW
Sodium formate Sigma-Aldrich, NSW
Sodium hydrogen carbonate Ajax FineChem, NSW
Sodium hydrogen phosphate Ajax FineChem, NSW
50
Sodium hydroxide (NaOH) APS Chemicals Ltd., NSW
Sulfuric acid (98%, w/w) APS Chemicals Ltd., NSW
Trichloroacetic acid (TCA) May and Baker Ltd., UK
3H-L-(G)-Serine PerkinElmer, USA
Tris-HCl Merck Pty Ltd., NSW
Tri-sodium citrate Ajax FineChem, NSW
Tryptone Oxoid Ltd., NSW
Tween80 (Tw80) Sigma-Aldrich, NSW
Yeast extract Oxoid Ltd., NSW
Yeast nitrogen base (without amino acids or
ammonium sulphate)Difco, NSW
Zinc acetate Merck Pty Ltd., NSW
Purified water from a MilliQ system (Millipore, NSW) was used in the
production of all buffers, solutions and media.
2.1.2 General procedures
Sterilisation of media, heat-stable solutions, glass-ware and non-disposable plastic-ware
were autoclaved for 15 min at 120°C (125kPa). Sterilisation of heat-labile solutions
was filtered using 0.22 m sterile filters (Millipore, NSW).
RNase were deactivated in solutions by adding DEPC (0.1% v/v) to the MilliQ
water (MQ water) prior to autoclaving for 15 min at 120°C (125kPa). DNases were
inactivated by autoclaving. All biological materials and waste were autoclaved prior to
disposal using approved methods.
51
2.1.3 Saccharomyces cerevisiae and Escherichia coli strains, plasmids
and primers
2.1.3.1S. cerevisiae strains
Table 2.2 summarises the strains used in the studies. Unless otherwise stated, the
majority of the strains used are in the BY4743 background. All strains were subject to
genotype confirmation using PCR or phenotypic characteristics or a combination of
both.
Table 2.2 S. cerevisiae strains used in this study
Strain Genotype SourceBY4741 MATa; his3; leu20; lys20; MET15; ura30 Euroscarf
BY4742 MAT; his31; leu20; LYS2; met150; ura30 Euroscarf
BY4743 MATa/; his31/his31; leu20/leu20;
lys20/LYS2; MET15/met150; ura30/ura30
Euroscarf
S288c MATa, Sul2, gal2, mal, mel, flol, flo8-1, hap1 (Mortimer
and
Johnston,
1986)
BY4743 arg4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
arg4::kanMX4/arg4::kanMX4
Euroscarf
BY4743 arg5,6 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
arg5,6::kanMX4/arg5,6::kanMX4
Euroscarf
BY4743 asn1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
asn1::kanMX4/asn1::kanMX4
Euroscarf
BY4743 asn2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
asn2::kanMX4/asn2::kanMX4
Euroscarf
BY4743 bas1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
bas1::kanMX4/bas1::kanMX4
Euroscarf
BY4743 bap2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
bap2::kanMX4/bap2::kanMX4
Euroscarf
BY4743 cho1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
cho1::kanMX4/cho1::kanMX4
Euroscarf
52
BY4743 cys3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
cys3::kanMX4/cys3::kanMX4
Euroscarf
BY4743 cys4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
cys4::kanMX4/cys4::kanMX4
Euroscarf
BY4743 fun12 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
fun12::kanMX4/fun12::kanMX4
Euroscarf
BY4743 gcd1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcd1::kanMX4/gcd1::kanMX4
Euroscarf
BY4743 gcd6 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcd6::kanMX4/gcd6::kanMX4
Euroscarf
BY4743 gcd7 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcd7::kanMX4/gcd7::kanMX4
Euroscarf
BY4743 gcn1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcn1::kanMX4/gcn1::kanMX4
Euroscarf
BY4743 gcn2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcn2::kanMX4/gcn2::kanMX4
Euroscarf
BY4743 gcn3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcn3::kanMX4/gcn3::kanMX4
Euroscarf
BY4743 gcn4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcn4 ::kanMX4/gcn4::kanMX4
Euroscarf
BY4743 gcn20 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcn20 ::kanMX4/gcn20::kanMX4
Euroscarf
BY4743 gln1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gln1::kanMX4/gln1::kanMX4
Euroscarf
BY4743 gln3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gln3kanMX4/gln3kanMX4
Euroscarf
BY4743 gly1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gly1::kanMX4/gly1::kanMX4
Euroscarf
53
BY4743 his2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
his2::kanMX4/his2::kanMX4
Euroscarf
BY4743 his3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
his3::kanMX4/his3::kanMX4
Euroscarf
BY4743 his4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
his4::kanMX4/his4::kanMX4
Euroscarf
BY4743 his5 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
his5::kanMX4/his5::kanMX4
Euroscarf
BY4743 ilv1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ilv1::kanMX4/ilv1::kanMX4
Euroscarf
BY4743 ilv2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ilv2::kanMX4/ilv2::kanMX4
Euroscarf
BY4743 ilv3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ilv3::kanMX4/ilv3::kanMX4
Euroscarf
BY4743 ilv4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ilv4::kanMX4/ilv4::kanMX4
Euroscarf
BY4743 ilv6 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ilv6::kanMX4/ilv6::kanMX4
Euroscarf
BY4743 leu1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
leu1::kanMX4/ leu1::kanMX4
Euroscarf
BY4743 leu2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
leu2::kanMX4/ leu2::kanMX4
Euroscarf
BY4743 leu4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
leu4::kanMX4/ leu4::kanMX4
Euroscarf
BY4743 leu9 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
leu9::kanMX4/ leu9::kanMX4
Euroscarf
BY4743 met3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
met3::kanMX4/met3::kanMX4
Euroscarf
54
BY4743 leu12 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
leu12::kanMX4/ leu12::kanMX4
Euroscarf
BY4743 leu20 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
leu20::kanMX4/ leu20::kanMX4
Euroscarf
BY4743 leu21 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
leu21::kanMX4/ leu21::kanMX4
Euroscarf
BY4743 met2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
met2::kanMX4/met2::kanMX4
Euroscarf
BY4743 met3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
met3::kanMX4/met3::kanMX4
Euroscarf
BY4743 met6 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
met6::kanMX4/met6::kanMX4
Euroscarf
BY4743 met10 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
met10::kanMX4/met10::kanMX4
Euroscarf
BY4743 met14 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
met14::kanMX4/met14::kanMX4
Euroscarf
BY4743 met16 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
met16::kanMX4/met16::kanMX4
Euroscarf
BY4743 pro1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
pro1::kanMX4/pro1::kanMX4
Euroscarf
BY4743 pro2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
pro2::kanMX4/pro2::kanMX4
Euroscarf
BY4743 ser1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ser1::kanMX4/ser1::kanMX4
Euroscarf
BY4743 ser2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ser2::kanMX4/ser2::kanMX4
Euroscarf
BY4743 ser3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ser3::kanMX4/ser3::kanMX4
Euroscarf
55
BY4743 ser33 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ser33::kanMX4/ser33::kanMX4
Euroscarf
BY4743 shm1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
shm1::kanMX4/shm1::kanMX4
Euroscarf
BY4743 shm2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
shm2::kanMX4/shm2::kanMX4
Euroscarf
BY4743 sit4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
sit4::kanMX4/sit4::kanMX4
Euroscarf
BY4743 sui1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
sui1::kanMX4/sui1::kanMX4
Euroscarf
BY4743 sui2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
sui2::kanMX4/sui2::kanMX4
Euroscarf
BY4743 thr1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
thr1::kanMX4/thr1::kanMX4
Euroscarf
BY4743 thr4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
thr4::kanMX4/thr4::kanMX4
Euroscarf
BY4743 tip1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
tip1::kanMX4/tip1::kanMX4
Euroscarf
BY4743 tir1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
tir1::kanMX4/tir1::kanMX4
Euroscarf
BY4743 tir2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
tir2::kanMX4/tir2::kanMX4
Euroscarf
BY4743 tir3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
tir3::kanMX4/tir3::kanMX4
Euroscarf
BY4743 trp1 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
trp1::kanMX4/trp1::kanMX4
Euroscarf
BY4743 trp2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
trp2::kanMX4/trp2::kanMX4
Euroscarf
56
BY4743 trp3 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
trp3::kanMX4/trp3::kanMX4
Euroscarf
BY4743 trp4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
trp4::kanMX4/trp4::kanMX4
Euroscarf
BY4743 trp5 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
trp5::kanMX4/trp5::kanMX4
Euroscarf
S288c gcn4 MATa, Sul2, gal2, mal, mel, flol, flo8-1, hap1;
gcn4 ::kanMX4/gcn4::kanMX4
This study
S288c gcn2 MATa, Sul2, gal2, mal, mel, flol, flo8-1, hap1;
gcn2 ::kanMX4/gcn2::kanMX4
This study
S288c gly1 MATa, Sul2, gal2, mal, mel, flol, flo8-1, hap1;
gly1 ::kanMX4/gly1::kanMX4
This study
BY4743;
SHM2::lacZMATa/; his31/his31; leu20/leu20;
lys20/LYS2; MET15/met150; ura30/ura30
SHM2::lacZ
This study
BY4743 gcn4;
SHM2::lacZ
MATa/; his31/his31; leu20/leu20;
lys20/LYS2; MET15/met150; ura30/ura30
gcn4 ::kanMX4/gcn4::kanMX4
SHM2::lacZ
This study
BY4743 bas1;
SHM2::lacZ
MATa/; his31/his31; leu20/leu20;
lys20/LYS2; MET15/met150; ura30/ura30
bas1::kanMX4/bas1::kanMX4;
SHM2::lacZ
This study
S288c; GCRE::lacZ MATa, Sul2, gal2, mal, mel, flol, flo8-1, hap1;
GCRE::lacZ
This study
S288c gcn4;
GCRE::lacZ
MATa, Sul2, gal2, mal, mel, flol, flo8-1, hap1;
gcn4 ::kanMX4/gcn4::kanMX4
GCRE::lacZ
This study
S288c bas1;
GCRE::lacZ
MATa, Sul2, gal2, mal, mel, flol, flo8-1, hap1;
bas1::kanMX4/bas1::kanMX4;
GCRE::lacZ
This study
BY4743;
GLY1::lacZMATa/; his31/his31; leu20/leu20;
lys20/LYS2; MET15/met150; ura30/ura30
GLY1::lacZ
This study
BY4743 gcn4;
GLY1::lacZ
MATa/; his31/his31; leu20/leu20;
lys20/LYS2; MET15/met150; ura30/ura30
gcn4 ::kanMX4/gcn4::kanMX4
GLY1::lacZ
This study
BY4743 bas1;
GLY1::lacZ
MATa/; his31/his31; leu20/leu20;
lys20/LYS2; MET15/met150; ura30/ura30
bas1::kanMX4/bas1::kanMX4;
GLY1::lacZ
This study
57
BY4743
shm1gcn4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
shm1::natMx/gcn4::kanMX4
This study
BY4743
gcn4shm2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
gcn4::natMX/shm2::kanMX4
This study
BY4743
shm1shm2 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
shm1::natMX/shm2::kanMX4
This study
BY4743
ser2gcn4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ser2::natMx/gcn4::kanMX4
This study
BY4743
ser3gcn4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ser3::natMX/gcn4::kanMX4
This study
BY4743
ser33gcn4 MATa/; his31/his31; leu20/leu20;
lys20/LYS2;MET15/met150;ura30/ura30
ser33::natMX/gcn4::kanMX4
This study
2.1.3.2E. coli strains
Table 2.3 was routinely used for propagation of plasmids.
Table 2.3 Outlined the E. coli strains used in this study
Strain Genotype
JM109
recA1, endA1, gyrA96, thi, hsdR17,
supE44, relA1, Δ(lac-proAB)/F'
[traD36, proAB+, lacIq, lacZΔM15]
2.1.3.3 Primers
The primers listed in Table 2.4 were used for confirmation of EUROSCARF knock-out
strains, construction of deletion mutant in different background or construction of
double mutants.
58
Table 2.4 Primers used in this study
Primer name
Sequence 5' to 3' Notes
BAP2F CAGGGTGAAATGCCACTTCTTTGATGAConfirmation of
strain
BAP2R GAATCCGACGTGATAGACTCAACGCCConfirmation of
strain
BAS1F GGGTCCAGTCACAGAATAAAGCCCCAGG
Confirmation of
strain and making
new background
BAS1R GCAAACACATCCTCTAGGGCATCGCGC
Confirmation of
strain and making
new background
GAC1 GATCGGATGACTCATTTTTTConfirmation of
strain
GAC2 GATCAAAAAATGAGTCATCCConfirmation of
strain
KANB CTGCAGCGAGGAGCCGTAAT
Confirmation of
strain and making
new background
GCN4A ATGGCTTGCTAAACCGATTATATTT
Confirmation of
strain,
construction of
double mutant
and making new
background
GCN4D TTTAAAGTTTCATTCCAGCATTAGC
Confirmation of
strain,
construction of
double mutant
and making new
background
GCN4NATFACCAATTTGTCTGCTCAAGAAAATAAATTAAATA
CAAATAA AATGCGTACGCTGCAGGTCGAC
Construction of
double mutant
and making new
background
GCN4NATRAAATAAAAGGTAAATGAAATCAGCGTTCGCCAAC
TAATTTCTTTAATCGATGAATTCGAGCTCG
Construction of
double mutant
and making new
background
GCN2F GTTGGAAAGCCTCGTTGTCT
Confirmation of
strain and making
new background
GCN2R CTGATGCCTTATAGCGCCG
Confirmation of
strain and making
new background
GLY1F CTCCATGTGTCCTTCTCGTCTATCTT
Confirmation of
strain and making
new background
GLY1R CAGCGCACCTAGCGACTAACTAC
Confirmation of
strain and making
new background
59
NATMX CCTCGATGTCCTCGACGGTCAG
Confirmation of
strain and making
new background
SHM1F AGCCGACATTTCCACATCGAGTCConfirmation of
strain
SHM1R CGATAGGTGCGGCGTTCATCACConfirmation of
strain
SHM2F CGCTGTACAGAGGATCCGTTTCACAGT
Confirmation of
strain,
construction of
double mutant
and making new
background
SHM2R TTGGACGTTAACACCCCATTTGTCTGGA
Confirmation of
strain,
construction of
double mutant
and making new
background
SIT4F ACGTAATGGAGCATTGAAGAGCTACAGACConfirmation of
strain.
SIT4R CCACGATCCACGTAATCACCGAGConfirmation of
strain.
SUI1F GTATTATCACCAATAACGGGTCGGGTAACAConfirmation of
strain.
SUI1R TTGGTCATCCCTGCAACTGAATAATCTCCConfirmation of
strain.
SUI2F TCTGCTGCCTCACGCACCTTCTATAATAConfirmation of
strain.
SUI2R ACACGAAGAACAACGGCGACATCATConfirmation of
strain.
60
2.1.3.4 Plasmids
Table 2.5 Plasmids used in this study
Plasmid Name Notes Constructed by
pCG1 Construction of SHM2::lacZ Cristy Gelling
pME1112 Construction of GCRE6::lacZProfessor Braus G.H.
lab, Germany
pME1108 Construction of UAS::lacZProfessor Braus G.H.
lab, Germany
p4339Construction of (pCRII-
TOPO::natMX4) for double mutantsCristy Gelling
pLL1 Construction of GLY1::lacZ reporter Cristy Gelling
pFA6a-
natNT2Construction of double mutant Anita Ayer
2.1.4 Media, growth conditions and DNA transformations
2.1.4.1 Yeast media and growth conditions
Yeast was routinely propagated on YEPD medium containing 2% (w/v) glucose, 2%
(w/v) bactopeptone, 1% (w/v) yeast extract. S. cerevisiae was grown in SD medium
contained 2% (w/v) glucose, 0.5% (w/v) ammonium sulphate, 0.17% (w/v) Yeast
Nitrogen Base, or in SDC medium which is SD medium contains all the amino acids
outlined in Table 2.6, or in or in SCC, which was SDC with the addition of L-alanine,
L-asparagine, L-cysteine, L-glutamine, L-glutamate, glycine, L-proline, and L-serine
(76 mg/l). Supplements were added to SD media for selection of strains according to
their auxotrophic requirements or transformants containing plasmids in the
concentrations.
61
Table 2.6 Supplements added to SD medium
Supplement Final concentration (mg/l)
Ade 10
L-Arg 50
L-Asp 80
L-His 20
L-Ile 50
L-Leu 100
L-Lys 500
L-Met 20
L-Phe 50
L-Thr 100
L-Trp 50
L-Tyr 50
Ura 20
L-Val 140
Solid media was prepared with 2% (w/v) agar technical type 1. For selection of
strains containing the KanMX4 marker, Geneticin (G418) (200 g/ml) was added to
YEPD solid medium. ClonNAT (100 g/ml) was used to select for NatMX marker.
Yeast cells were incubated at 30C with shaking to allow adequate aeration
when in liquid media. For short term storage, cells were propagated on either on a
YEPD plate or SD plate with amino acids supplemented prior their storage at 4C.
Long term storage at -80C was undertaken in 15% (v/v) glycerol.
2.1.4.1.1 Anaerobic growth in media
Anaerobic growth was performed using modified methods of (Panozzo et. al., 2002;
Skoneczny and Rytka, 2000). S. cerevisiae was grown in SD medium, or in SDC
62
medium, or in SCC medium depend on the experiment. These media were produced
(pH 4.5) with 0.1 M NaOH and supplemented with the redox-indicator dye resazurin (2
mg/l). The medium was then aliquoted into 100 ml penicillin bottles and purged with
high purity nitrogen gas for 20 minutes. Bottles were plugged with butyl-rubber
stoppers and sealed with aluminium cap seals (Wheaton Science, Millville, NJ) prior to
autoclaving. Prior to inoculation, 500 l of a fresh stock solution of ergosterol (4
mg/ml) and Tween 80, 40% (v/v) in ethanol was added to each 100 ml bottle of SDC
medium via a syringe through the rubber stopper. The reducing agent, sodium
dithionite was added to a final concentration of 100 mg/l to remove any traces of
oxygen. Cultures were incubated at 30C with shaking at 250 rpm. Growth of the
culture was measured by spectrophotometry at an absorbance of 600 nm. Anaerobic
bottle were pre-inoculated at OD600 of 0.2.
2.1.4.1.2 Anaerobic growth on plates
Agar technical type 1, 2% (w/v) was used for the preparation of solid YEPD or SD with
amino acids supplemented media. Prior to inoculation, 100 l of a fresh stock solution
of ergosterol (4 mg/ml) and Tween 80, 40% (v/v) in ethanol was added to each plate.
These plates were then placed in anaerobic jar (2 litres Anaerobic jar, OXOID, N.S.W.)
along with anaerobic sachet and anaerobic indicator, for the removal of any trace of
oxygen in the anaerobic jar.
63
2.1.4.2E. coli media and growth conditions
E. coli strains were grown at 37C with shaking at 250 rpm in Luria-Bertani (LB)
medium which contains 1% (w/v) tryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl,
and supplemented with ampicillin (50 g/ml) when selecting for growth of cultures
containing plasmids. Strains were also grown on LB plates (2% (w/v) agarose) and
ampicillin (50 g/ml) was added where necessary. These plates were stored at 4C, for
up to four weeks. Long-term storage was stored in LB medium:glycerol (1:1) at -80C.
2.1.4.3 Transformations
Yeast was transformed using the lithium acetate method described by (Gietz et. al.,
1992). YEPD medium was used to culture competent cells for transformation and
sheared, denatured herring-sperm DNA was used as carrier DNA. Transformed yeast
were grown on SD drop-out selective plates or on antibiotic plates and grown for up to
3 days.
E. coli competent cells were prepared by the calcium chloride method described
by (Sambrook et. al., 1989). Cells were stored at -80C and thawed on ice when
required. For transformation, cells (50-100 l) were mixed with DNA, incubated on ice
for 30 min, heat shocked at 42C for 90 s, recovered in 1 ml LB for 1 h and then plated
onto selective plates.
64
2.1.4.3.1 Construction of the SHM2::lacZ reporter
The pCG1 reporter was constructed by PCR amplification of SHM2 using the primers
(5’-CGCTGTACAGAGGATCCGTTTCACAGT-3’ and 5’-TTGGACGTTAACACCC
ATTTGTCTGGA-3’), which resulted in the introduction of a BamHI restriction site at
position -1527 of SHM2. The PCR product was digested with BamHI and HindIII and
ligated into plasmid YEP356 (Myers et. al., 1986) generating an in-frame fusion of
SHM2 (-1527 to +1289) to the E. coli lacZ gene. This construct was transformed into
appropriate strains under uracil selection and the identity of all resultant clones were
confirmed by PCR.
2.1.4.3.2 Construction of the GCRE::lacZ reporter
Plasmids pME1112 and pME1108 (Albrecht et. al., 1998) were kindly provided by
Professor Braus G.H. from Georg-August-Universität, Göttingen, Germany. The
pME1112 and pME1108 were constructed by using the yeast integration vector pLI4
(Sengstag and Hinnenbach, 1988) containing the CYC1::lacZ reporter gene (Guarente et.
al., 1982). pME1112 (GCRE6::lacZ) was used to integrate a Gcn4p regulated lacZ
gene carrying six general control responsive elements (GCRE) in the CYC1 promoter
region into the genome. And pME1108 ( UAS::lacZ) was constructed without the
GCRE which was used as a control. Replacement of the upstream activation site (UAS)
of the CYC1::lacZ with GCREs was achieved by first cutting out the XhoI fragment
containing the UAS. Re-ligation of the XhoI site resulted in pME1108. Then, two
synthetic oligonucleotides (GAC1, 5'-GATCGGATGACTCATTTTTT-3' and GAC2,
5'-GATCAAAAAATGAGTCATCC-3') were annealed to form an optimal double-
65
stranded GCRE (Hope and Struhl, 1985). For the production of multimeric GCRE
DNA probes T4 was prepared with the addition of DNA ligase. The products were then
blunt ended with Klenow and inserted into the blunt ended XhoI site of pME1108. The
resulting plasmid pME112 contains six GCRE sites as determined by nucleotide
sequence analysis (Tabor and Richardson, 1987).
2.1.4.3.3 Construction of the GLY1::lacZ reporter
The GLY1::lacZ reporter pLL1 was constructed by ligation of an XbaI-PstI fragment
spanning positions -1109 to +77 relative to the GLY1 start codon into the integrative
vector YIP358 (Myers et. al., 1986). This was converted into a centromeric construct
by exchanging the 2.5 kb BsaI digestion product for the CEN6/ARS4-bearing BsaI
fragment from the plasmid pYLZ-6 (Hermann et. al., 1992).
2.1.4.4 Double mutant generation
The double mutants shm1gcn4, shm2gcn4 and shm1shm2 were constructed via
mating of MATa haploids with MAT haploids of the deletion mutants as described by
(Tong et. al., 2001). The geneticin-resistance marker (KanMX) within the shm1 MATa
and the gcn4 MATa haploids was replaced with the nourseothricin-resistance marker
(NatMX) by transforming each respective haploid with the p4339 plasmid (pCRII-
TOPO::natMX4) and selecting on clonNAT. The MATa deletion mutants harbouring
the NatMX-resistance gene were then crossed with MAT deletion mutants containing
the geneticin-resistance marker (KanMX). Resultant heterozygous diploids were
selected on media containing both antibiotics. Diploid strains were then sporulated to
66
form haploid meiotic spore progeny. The genotype of each derived strain was
confirmed using PCR. The confirmed MATa and MAT haploid double mutants were
then crossed to generate homozygous diploid double mutants.
The double mutants ser2gcn4, ser3gcn4 and ser33gcn4 were
constructed as described by Janke et. al., (Janke et. al., 2004). The specific pairs of
primers 5’-ACCAATTTGTCTGCTCAAGAAAATAAATTAAATACAAATAAAATG
CGTACGCTGCAGGTCGAC-3’ and 5’-AAATAAAAGGTAAATGAAATCAGCGT
TCGCCAACTAATTTCTTTAATCGATGAATTCGAGCTCG-3’ are used to amplify
the GCN4 deletion cassette (KanMX). These PCR amplified fragments were then
transformed with the pFA6a-natNT2 plasmid which consists of NatNT2 marker. Each
successful transformant should contain both KanMX and NatNT2 cassettes.
2.1.5 General methods and reagents
Composition of buffers, as well as methods for agarose-gel electrophoresis and DNA
quantification were performed as described (Sambrook et. al., 1989). DNA marker
standards were from MBI fermentas (QLD). Recovery of DNA fragments from agarose
gels was performed using the Qiagen Gel extraction Kit (NSW), according to the
manufacturer's instructions. Otherwise, double precipitation of nucleic acid with 70%
(v/v) ethanol was used. Enzymatic manipulation and cloning of DNA were performed
as described by (Sambrook et. al., 1989).
67
2.1.5.1 DNA isolation
Small scale purification from E. coli grown in liquid culture was performed using the
Qiagen (NSW) mini-plasmid purification kit according to the manufacturer's
instructions.
Yeast genomic DNA extraction was as described by Breeden Lab, Fred
Hutchinson Cancer Research Centre. USA. Genomic DNA was extracted from 5 ml of
overnight culture of yeast in YEPD medium. Cells were initially washed with sterile
water, followed by resuspension of cells with lysis buffer which contained 100 mM Tris
pH 8.0, 50 mM EDTA and 1% SDS. Acid-washed glass beads (0.25-0.50 mm) were
added prior to the 3 min of beating with the glass beater (Mini-glass beater, Biospec.).
Liquid phase was collected and transferred to a new tube with 7 M Ammonium acetate
pH 7.0. Samples were then heated at 65ºC for 5 min, followed by another 5 min on ice.
Chloroform was added prior a 2 min vortex and DNA was separated by centrifugation.
Supernatant was collected and followed by double precipitation with ethanol. Genomic
DNA was resuspended with sterile water and stored at -20C.
2.1.5.2 Ethanol precipitation and phenol:chloroform extraction
Ethanol precipitation was employed to desalt and/or to concentrate DNA samples
(Sambrook et. al., 1989). When necessary, phenol:chloroform:isoamyl alcohol (25:24:1)
extractions was performed to remove proteins from DNA samples.
68
2.1.5.3 Polymerase chain reaction
Polymerase chain reaction (PCR) was used for DNA amplification. The standard
reaction (50 l volume) contained template DNA (1g – 100ng), dNTPs (10 M of
each of dATP, dTTP, dGTP and dCTP), forward and reverse primers (1 M), MgCl2
(2.5 mM), 1 buffer and 1 U AmpliTaq™ DNA polymerase (Applied Biosystems,
NSW). Typical cycling conditions were 95C, 3 min; 30 cycles of denaturation step at
95C for 30 s, annealing step for 30 s (45-58C), extension step at 72C for 1 min per 1
kb final product; followed by 5 min extension at 72C. A DNA Engine Tetrad Peltier
Thermal Cycler (MJ Research, Minnesota) was used. Annealing temperatures for each
primer pairs were varied for optimisation of each reaction. The desired size of the PCR
product was confirmed via agarose gel electrophoresis.
2.2 Cell Physiology methods
2.2.1 Determination of viability as colony formation
100 l culture samples were serially diluted (10 fold) in YEPD and suitable dilutions
plated on YEPD plates. Plates containing colony numbers between 30 - 300 were
counted after 2 – 3 days of growth. Survival was determined as colony-forming units
present to the initial culture.
69
2.2.2 Determination of viability measured with propidium iodide
exclusion
Cells were harvested and washed twice with phosphate buffered saline PBS (sodium
chloride (18 g/l), potassium chloride (0.2 g/l), di-sodium hydrogen phosphate (1.44 g/l)
and potassium dihydrogen phosphate (0.24 g/l) and pH 8 with HCl. 200 l of
propidium iodide (50 g/ml) was added in the dark and was covered with foil, prior the
examination of cells using a fluorescence microscope (Olympus BX60) (Krishan, 1975).
2.2.3 Spot tests
Cultures of yeast strains were grown to exponential phase in YEPD medium and then
diluted to an optical density (OD600) of 2.0 and 0.2. Dilutions were then spotted (2 l)
onto YEPD agarose plates. Spots were allowed to dry and plates were incubated at
30°C for 2-3 days. The presence or absence of spots on the agar plates was recorded.
2.3 Protein methods
2.3.1 Protein extraction for -galactosidase assays
Cultures were grown anaerobically and aerobically to exponential phase (OD600 of 1.0).
Anaerobic samples (20 ml) were taken via a syringe from the anaerobic cultures and
centrifuged (3,350 g, 4C, 2 min) whilst the remaining culture was aerated for the
indicated period of time. Each time-point sample (20 ml volume) was then harvested
identically and treated as described by (Rose and Botstein, 1983) with some
70
modification. All sampling was performed in triplicate. Harvested cells were washed
in 1 ml of cold breakage buffer which contained 100 mM Tris-HCl (pH 8.0), 20% (v/v)
glycerol, 1 mM -mercaptoethanol and transferred to a 1.5 ml screw-cap tube prior
resuspending in 250 l cold breakage buffer. The suspension had 12.5 l of 40mM
PMSF added along with acid-washed glass beads (0.25-0.50 mm) prior to cell breakage
in a mini-bead beater (Biospec. NSW) at 4C for 40 seconds. An additional 200 l of
breakage buffer was added to each sample and was vortexed to mix. Cell debris and
glass beads were removed by centrifugation (14,000 g, 4 C, 15 min). Cell extracts
were stored at -20C.
2.3.2 Protein concentration estimation
Concentration of proteins was determined using the method described in Bradford
(Bradford, 1976). Cell extracts were diluted 1:10 with breakage buffer and then 10 l
of the cell suspension was added to a 1.5 ml tube containing 790 l H2O and 200 l
Bradford reagent. Protein concentration was then estimated by measuring the
absorbance at 595 nm and comparing to a standard curve prepared with known
concentrations of bovine serum albumin (BSA).
2.3.3 Assay for -galactosidase activity
Enzyme activity was assayed essentially as outlined by (Rose and Botstein, 1983).
Tubes containing 100 l crude cell extract and 900 l Z buffer (60 mM Na2HPO4.7H2O,
40 mM NaH2PO4.H2O, 10 mM KCl, 2 mM MgSO4, 34 mM -mercaptoethanol, pH 7.0)
71
were equilibrated to a temperature of 28C. The reaction was initiated by addition of
200 l ONPG (4 mg/ml in Z buffer). Reactions were allowed to proceed until a pale
yellow colour developed and incubation time was recorded once the addition of 500 l
1M Na2CO3 was used as a stop reagent. The optical density at 420 nm was measured
for calculation of specific activity using the following formula:
OD420 Total reaction volume (ml)
0.0045 time (min) extract volume (ml) protein concentration (mg/ml)
where OD420 is the optical density of the product, o-nitrophenol (o-NP) at 420 nm;
0.0045 is the optical density of a 1 nmol/cm solution of o-NP. The specific activity is
expressed as nmol hydrolysed ONPG per mg protein per min.
2.4 Amino acid analysis
An overnight culture was inoculated into a 250 ml anaerobic bottle with 100 ml of
medium to an OD600 of 0.2. Cultures were harvested immediately (time 0), at 15, 30, 60,
120, 240 and 360 min after inoculation and the cells density measured. Upon
harvesting, 50 ml of culture was filtered through a glass fibre pre-filter (Sartorius) and
immediately washed with 50 ml of chilled (4°C) SD medium without amino acids. The
pre-filter was immersed in 30 ml cold 5% (v/v) perchloric acid for 5 min to lyse the
cells and the lysate was adjusted to pH 7.0 with cold 5 M potassium hydroxide. The
volume of the lysate was recorded and 10 ml of the supernatant and 1 ml of the medium
filtrate stored for subsequent HPLC analysis.
72
2.4.1 Amino acid analysis by HPLC
Amino acid composition of each sample was analysed using a modified Pico-TAG
amino acid analysis method (Waters, Milford, MA). An aliquot of cell lysate (2 ml) or
diluted growth medium (900 l) was added to a glass vial, frozen at -80C for 2 h and
freeze-dried overnight at -50C. The samples were resuspended in 200 l of 0.2 M
methionine sulfone (internal standard) and 50 l was transferred to a glass sampling
tube. The sample was dried under vacuum, resuspended in 10 l of drying solution
(2:2:1 methanol: 1 M sodium acetate: triethylamine) and dried again. The dry sample
was resuspended in 10 l of derivatisation reagent (7:1:1:1 methanol: triethylamine:
water: phenylisothiocynanate (PITC)), mixed by vortex and kept at room temperature
for 20 min in the dark. The samples were dried under vacuum and resuspended in 100
l of Pico-TAG sample diluent (Waters, Milford, MA) and transferred to a sealed vial
for HPLC analysis. Chromatographic separation of derivatised amino acids was
achieved using Pico-TAG eluent 1 and Pico-TAG eluent 2 as described in the Pico-
TAG amino acid analysis operator’s manual (Waters, Milford, MA). Amino acids were
quantified by measuring peak area in comparison to standard curves obtained using pure
standards.
2.5 Isolation of Cell Walls
Cell wall isolation was performed using the procedures described in De Groot et. al. (de
Groot et. al., 2004), and Yin et. al.(Yin et. al., 2005). Cells from anaerobic cultures
were harvested by centrifugation at various time points, and were washed with cold
water, then washed with 10 mM Tris-HCl, pH 7.5. Acid-washed glass beads (0.25-0.50
73
mm) were added along with protease inhibitor (Complete EDTA-free) for cell wall
extraction using mini-glass beater (Biospec., N.S.W.). Isolated cell walls were then
washed extensively with 1M NaCl, and extracted twice with 2% (w/v) SDS, 100 mM
Na-EDTA, 40 mM -mercaptoethanol, and 50 mM tris-HCl, pH 7.8, for 5 min at 100°C.
SDS-extracted cell walls were then washed three times with water. Samples were
aliquoted, freeze-dried, and stored at -20°C until needed.
2.5.1 Preparation for cell wall protein analysis by mass spectrometry
Freeze-dried cell walls (2 mg) were measured by weight and resuspended in 500 l of
100 mM NH4HCO3 containing 10 mM dithiothreitol, and incubated for 1 h at 56°C.
After centrifugation, the pellet was S-alkylated in 500 l of 100 mM NH4HCO3
containing 55 mM iodoacetamide for 45 min at room temperature in the dark. Cell
walls were then washed three times with 100 l of 50 mM NH4HCO3 and dried under
vacuum.
Cell walls were digested proteolytically with a modification of the method of
Yin et al. (Yin et. al., 2005) using their assumption that cell walls accounted for
approximately 2% (w/w) of the cell wall dry weight. Cell walls were resuspended in 50
mM NH4HCO3 and digested with trypsin (using a CWP/enzyme ratio of 50:1, Promega,
Madison, WI, USA) overnight at 37°C. In this study, proteolytic digestion with trypsin
did not reveal significant differences between aerobic and anaerobic cell walls. Hence,
the samples were digested further with AspN (~100:1, Roche, NSW) overnight at 37°C.
74
2.5.2 Mass spectrometric analysis of cell walls
Digested samples were centrifuged and the solubilized peptides were separated by
nano-LC using an Ultimate 3000 HPLC and autosampler system (Dionex, Amsterdam,
Netherlands). Samples (2.5 µl) were concentrated and desalted onto a micro C18
precolumn (500 µm x 2 mm, Michrom Bioresources, Auburn, CA) with H2O:CH3CN
(98:2, 0.05 % HFBA) at 20 µl/min. After a 4 min wash the pre-column was switched
(Valco 10 port valve, Dionex) into line with a fritless nano column (75µ x ~10cm)
containing C18 media (5µ, 200 Å Magic, Michrom) manufactured according to Gatlin
(Gatlin et. al., 1998). Peptides were eluted using a linear gradient of H2O:CH3CN (98:2,
0.1 % formic acid) to H2O:CH3CN (55:45, 0.1 % formic acid) at 350 nl/min over 30
minutes. High voltage (1800 V) was applied to low volume tee (Upchurch Scientific)
and the column tip positioned ~ 0.5 cm from the heated capillary (T=200°C) of a LTQ
FT Ultra (Thermo Electron, Bremen, Germany) mass spectrometer. Positive ions were
generated by electrospray and the LTQ FT Ultra operated in data dependent acquisition
mode (DDA). A survey scan m/z 350-1750 was acquired in the FT ICR cell (resolution
= 100,000 at m/z 400, with an accumulation target value of 1,000,000 ions). Up to the 7
most abundant ions (>2500 counts) with charge states of +2 or +3 were sequentially
isolated and fragmented within the linear ion trap using collisionally induced
dissociation with an activation q = 0.25 and activation time of 30 ms at a target value of
30,000 ions. M/z ratios selected for MS/MS were dynamically excluded for 30 seconds.
Peak lists were generated using Mascot Daemon/extract_msn (Matrix Science,
London, England, Thermo) using the default parameters, and submitted to the database
search program Mascot (version 2.2, Matrix Science). Search parameters were:
75
Precursor tolerance 4 ppm and product ion tolerances ± 0.6 Da; Met(O) and Cys-
carboxyamidomethylation specified as variable modification, enzyme specificity was
trypsin, 1 missed cleavage was possible and the NCBInr database (Jan 2008) searched.
Scaffold (version Scaffold-2_00_01, Proteome Software Inc., Portland, OR) was used to
validate MS/MS based peptide, protein identifications and estimate relative protein
abundances.
2.6 Radioactive labelling with 3H L-serine
2.6.1 Preliminary experiment
Anaerobic cells were harvested at various time points with a funnel and pump though a
25 mm glass microfibre made filter paper (Whatman), 5 µCi of 3H L-serine was used in
each of the 100 ml anaerobic cultures. One ml of the cultures was collected as the total
radioactive counts, prior the separation of the cultures from the media though the filter
paper. Another ml of the radioactive media counts was collected and the protein
radioactive counts were collected from the resuspension of the cells collected on the
filter paper with 10% cold TCA solution. All radioactive counts samples were mixed
with the scintillation solution prior reading from scintillation counter (Liquid
Scintillation analyser Tri-Cab 2100TR (Parkard, Canberra).
2.6.2 Isolation of cell fractions
Cells from aerobic and anaerobic cultures were inoculated with 1 μCi of 3H-L-serine in
100ml SDC medium at time 0 and were harvested at 5 h and 24 h by centrifugation
(3,000 x g, 5 min), followed by 10 mM tris-HCl pH 7.5 washes. Wet weights of the
76
samples were recorded prior to resuspension with 10 mM tris-HCl pH 7.5. Cell
suspensions were divided into three portions: one for isolation of cell wall, one for the
isolation of whole cell lipids and one for cell fractionation by differential centrifugation.
2.7 Isolation of cell fractions
2.7.1 Isolation of whole cell lipids
Whole cell lipids isolation was performed using the procedures described by Schneiter
and Daum (Xiao, 2006), and Folch et. al. (Folch et. al., 1957). Anaerobic cells with
densities approximately 5 x 106 cell/ml were harvested by centrifugation at various time
point. These samples were then washed with deionized water, followed by 100% (v/v)
methanol. Acid-washed glass-beads (0.25-0.50 mm) were added to the cell suspension
and vortex in the maximum speed for four periods of 30 s with 30 s cooling intervals.
Chloroform was added to the suspension to give a ratio of chloroform:methanol (2:1
(v/v)) prior to stirring on a flat-bed stirrer for 1 h at room temperature. The suspension
was transferred to a new tube and the glass-beads were then washed extensively with
chloroform:methanol (2:1 (v/v)). A 0.2 volume of 0.034% MgCl2 was added to the
extract prior to another stirring for 10 minutes. The organic phase of the extract was
washed with 2 N KCl/methanol (4:1 (v/v)), and extensively with chloroform:
methanol:water (3:48:47 (v/v/v)) until the phase boundary became clear. Samples were
aliquoted, dried under vacuum, and dissolved in 100 μl (approximately 0.1-1.0 mg
lipids/ml) with chloroform:methanol (2:1 (v/v)) and stored in a glass vial at -20°C.
Every mg of cells (wet weight) contains approximately 0.25 – 2.5 mg of lipids
according to Schneiter and Daum (Xiao, 2006b; Xiao, 2006a). Hence, all the
77
calculation performed in this thesis assumes that 0.25% of the wet weight of cells is
total lipids.
2.7.2 Isolation of phospholipids by one - dimensional thin layer
chromatography (1D- TLC)
A TLC chamber was filled with 150 ml of 25% chloroform:methanol:ammonia (50:25:6)
solution for 2 h with a cover for saturation. A silica gel TLC plate with a spore size of
60Å (Merck, NSW) was used as an absorbent and was pre-heated at 80°C for 10 min
prior to use for removal of any moisture from the plate. A fine spotting line was drawn
with a pencil about 2 cm from the bottom of the pre-heated TLC plate. Diluted
standards, phosphatidylserine (PS), phosphatidylethanolamine (PE) and
phosphatidylcholine (PC) (5 μg each) and extracted lipid samples (80 μg) were spotted
with a microsyringe (Hamilton) along the spotting line. All the spotted standards and
samples were then dried for approximate 5-10 minutes. The TLC plate was gently
submerged into the chamber with pre-saturated solvent inside. The system was stopped
by the removal of the TLC plate after 1.5 - 2 h when the solvent line reached about 2-3
cm from the top of the plate. The plate was then dried in the flume hood for 30 min,
prior to visualisation by sulphuric acid charring with spraying 50 % sulphuric acid (v/v)
to the plate and incubated at 150°C for 15 minutes. These plates were scanned with a
photo scanner (Cannon, Australia) for data analysis.
78
2.7.3 Cell fractionation by differential centrifugation
Cell fractionation was performed using the procedures as described in isolation of cell
wall. Radioactive cell suspensions were broken up with acid-washed glass-beads
together with protein inhibitors via a mini-glass beater. These suspensions were then
centrifuged at 1,000 x g, 20 min, 4ºC. The top of the supernatant was collected as
expected the cell membrane fraction, and the rest of the supernatant was collected and
centrifuged at 15,000 x g, 30 min, 4ºC. Collected pellet was resuspended with sterile
water as P15,000 fraction and the supernatant was further centrifuged at 100,000 x g, 60
min, 4ºC with using an ultracentrifuge (TL-100, Beckman, USA). Both supernatant
(S100,000) and pellet (P100,000) were collected and resuspended with sterile water. All of
these samples were stored at -20ºC for further manipulations.
2.7.4 Isolation of radioactive labelled phospholipids
Whole cell lipids were extracted as described previously, and approximate 80 μg of
extracted total lipids were spotted on a TLC plate and was run in the same solvent
system as described previously in Chapter 2.7.2 for 2 h. The TLC plate was dried in a
fume hood for 30min, prior to place it in a chamber with iodine crystal. This chamber
system was heated up to 50ºC. The TLC plate was removed once the lipids were
spotted. Images were saved by scanning into computer for record purposes and the
spotted phospholipids were cut out and put into a vial with scintillation solution for
radioactivity counting.
� ���
������������������� �������������������
�������������������������
�����������������������
����������������������� �� ���� �� ������������� ������������ ���������
������������������ ������������� � ��������� �������������� ���������������� ���
�������� ��������� ������������� ����������������������������������������
�������� ������ ������������������������������� ��������������� �����������
����� ���� ��� ������� ��� ��� �������� �� ������ ��������� ��� � �� ��������� ���
��������������������������������������������������� ��������������������
��� ������ ��� �� ����� � ��������� �������������� �����������!�� � "���� �� ������ �
������������������� ����#������������������ ������������������� � �����������
�
�� ��� ���!����������"� ����� ������#"��$� $���!� �� �% ��� ���
������&��!�!����"��!��
$�����%����� �������������� ��������� �������������������������������������
��� ������� ����� ��� ����� ��� ���� ��������� ��� ��� ���� ����� ������ � �� �������� �
������������� �����������$������������&''�(�)�����������&''&(����*�������������
+���!�� � ���� ������ ��� ������%����� ��������� ������� ��� ������� ���� ��� ���
�������������������������� ��������������������������&,����������������������
���������������-��������������&'',!������������������������������������������
��������� ���� ��������� ��������� ,�+�� �.� ������ ��� ��������� ��������� �������
�������� ������ ��� ����� �������� ����� ���� ����� ��� �����%������������� ����
������������������������������������������ ���������-���������������������
� /'�
�������������������������������� �������������������������������������������
����������� �������� ���������������������������"����������������������������
��� ������ ��� ���� ��������� ����� ����� ������ �� ��� ������� ��������� �� ���
���������������� ���������������� ��� ������������������������������������
� ��� ��� ������� ���� ������ �� ������������ ���� ��� ����� ���� �������� ����
��������� ������� � "��� ��� ������ �� �#�� ��� �� ���� ������� �� �� ������� ��
����������� ������������� ������#�������������� ����������� ��0�������������
���� ���������� ������������������������� �������������������������������#�����
������ � ��� ����� ����������� � ����� ��� ��� ���� ��� ��� ���� ���� �������� ��� ���
���� ��������������1����������������������� �������������� ������������(���
�������2���������������������� ������������������� ��������������������� ��
���������������������������������� �������������.������������3����+�4,(�
5�� ��������+��/(�6�������� ��������&'',!�� � ������������ �������� ������������ ���
������ �� ����������� �� ������ ��� ���� �� ����� �� ������������ �� �� �� ������ ����
��������������������� �7������������������������� ������ ��������������������
�������������
�
� /+�
��&%���� �������!��#��'���()��$�%�����$���!�����'��#��!��'�����#������������%�
#�������������
$�������� ����������������%�����������+������������������������� ����������
���&,����������� ����� �������������� �$������������������������������������
����������� �����-��������������&'',!����
����$��"� ��������$���!�����'��!'�#��
8��������������� ���������������������������� ����!������"#�
*����������������������� �"���� ��� $�� �%�� ���� ���� �$�� �&��'����� ������ ��"���( ����
()����!�"���!�"�&��"(*����+"��
.������ ������������ ,"�-��� �)���� �)�#�� �"���� )�.�� )��%�� )����� �+!���
!'(���!'(-��!'(--���,�������&��)("�%�/�
�
� .������� � �������������������� ������������������������ �� ������
������ ������������� � �� ������ � �������� ���������� ��� ����� ��������� ��� ����
����� ������� ������ ���� ����� ��������� ���� ������ � ��� ��������� �����
����%��������� �9� #������ &'':!�� ������� ,�&� �������� ��� ��� ��� ����%���������
������������������� ��������������������������������������� � ����������.�
�������������������������������������������� �������������������������
���������������� ����������������� ��������������-�������������������������
��������� ��� ���� ����� ������� ������ ���� ����� ��������� ���� ������ � ���
�������������� ���� ��� ����� ����� ���� �����&,����������� ������ ���������� �
������������������,�+!��-��������������&'',!����
�
� /&�
��&%����*���!���+�)��$�%����������$����������&����������&���!'�#��$���������
����� ������ �� ��� ������ ����� ����%��������� �� ���� ��%����� ���� ���� �������� ��
������������������ ����������� �����9� #������&'':!����
����$��"� ,�+�)��$�%�����$���!�
8��������������� �,�����������0�������"�����"�����"��
*����������������������� ,"�����"�����0,,#��'����� ,�����+1���( �����+"��
.������ ������������ ,�����,��#��,"����,"�$�&��,"�#����2���� ����'(����
'�����'��#�� )���� )��������&������-������#������.��
��������������������"!#�
�
� ;����������������&'������������������������� ���������������������%
���������������9� #����<������9� #������&'':!���.������ �����������������
��������� ��� #� ���� ������� ������� �� ����� �� ������ ����������� ��� ����
���������� � ����� ����� ���� ���� ��� ���������� ��������� ��� ������ � ���
�������� � ����� ���� ��� �� ������ ����� ���� ���� ���� ������ ������ �������� �
�������������������������� �������������������������������� �.������ ���
��������� � ��� ��� ���� ������������� ��� ������ ��� �� ��������� ���� ��� ����
�������������� ���������#���������������������������� ��������� ���.��������
�����+��:!���8�������������� ����#����������������� ����������������������� �
���� ���(� ������� ��������������� ������� ��������� ����������� �����������
���������������� �������������%��������������������������� ���������������
�������������� � �����������
�
� /,�
�����!���(�����%����� ������#������������&��!"��'�!�!�
�� *��-(� �!� �� ��!���� ����!���(�����%� ���� ����� �#� ������ �����
&��!"��'�!�!�
=�������� ���������������� ����������������������� ������������� ��������
���������� �������������������������������-������ ���+�/>(�-������ ���+���(�
-������ ��� &''4(� -������ �� ���� "��#�� +�/,(� -������ �� ���� 5����2���� &''&!���
���� �������������� �� �� ����� ��� ������������������������������� ��������� ���
��� ������� � ������� �� ������ � ��� ������������ ��� ����� ������ ��� ������ �
�����������
� ���� ������������#� � ����� ��� ��� ���� �� ���������������� �������� �����
����� ��� ����������� ������� ��������#� ��� ������������������� ������� ��
�������������������.=$��������������;6"���;6"+%>!��� ����������4?��������
������� ��� ������#��65.� �������#� ������� ��������� �� ���� � � �� ��������
��������� ��� �� ��������� �-������ ��� +�/>(�-������ ��� +�//(�-������ �� ����
"��#��+�/,(�@���������������+�/�!�� �������������������� ������������;6"+�����
�� ������%� ������������������������ �����;6"���=������������ �������
�������� �� ��� ��%� ������ ����� �� ������ ��� �;6"� ���� ���� �� �������
����������-������ ���+�//!����
� ���#� �� ��� ��� ����� ���%� ���� ������� ��������� ��� ��� �������� ������
����� � ������ ��������%����%���� �� ���� ������� ���� ��� ����������� �������
�$�� ��%9��������������&'''!�������������� �����������������$ �>���������������������
=����� ������� ��������� ���$ �+�� ������� ��� ��������� ������#� �-��������
���� -������ ��� +�/:!(� ��������� ������ ������������� ���� ��#�� ������ � ���
���������������� ��������������������� ���������� ��� �����������������������
���� ����%� �� ��������� �������� �� ��������� ��� ������ ��� �� �� ��� �������
� />�
������� ���#� ��������� �-�������� ���� -������ ��� +�/:!�� � -�� ���
�������������������������������������#����� ��������������������� ���&����"%
&!� ��� ��� ������� #����� ����� ������� ����������� ������ ��� ��� ����
��� ��������� � ������ ���#� ������ �������� ��� �������� �8���#����� ����
-������ ���&'',(�8�������������+��,(�A�������������+��&(�3������������-������ ���
&'''!����
� ����� ��� ���� �������� �� ����� �������3����%� ����������� ������� ��
��� 5%�������� ������� ��� ����� �$�� ��%9������ ��� ����� &'''(� 3�������� ����
-������ ���&'''!���.�8%������������������������������&'4&%&>&/!����������
�� ��� �� ����� ���� ���� ���� ���� ������������� ��� ����� ���� ��� ������ � ����� ���
�������� �������� �� ��� 8%�������� ������� �������� �� ������� ��� .��&&4�� ���
�� �������������������������� �������������-�� ������������������������������
� ����� ��� �� ������������ � ������� ��� �� ������� 65.�� � ���� �������� ���
������������� ��� ����������� ������#� ��������� ��� ��� ������������ ��� ������
� ����3������������-������ ���&'''(�7�#���������+�/�!���;� �����#����� ����
���� �� ������� ���� � ����� ��� ����� ��� ���� ������� �� ������ � ��� ���������
�-������ ���+�/4!�����������4���#���������������������������������������
�@��������#� ��� ����� &''4!�� ��� ��� ��������� ��� ���#� �� ���� ��� ��� �� ����%
���������������������������%����� ������������ ������� �������������������� ���
��������� �-��������$ �>�� �� �������������������� ������ �������������� �� ���
�������� �� �������� �-������ ��� +�/>(�-������ ��� +���(�-������ �� ���� "��#��
+�/,!�� � ���� ���� ��� ��� ������ �� �� �������� ��� ����� ������� ��� ��� $ �>��
��� ��������� ��������������������� �������������������
�
� /4�
��������!���(�������#����'�����(��������#�"��!����%%!�+'���!'�#����
#��������&������������&������������!�
B�������������������������������������� ����������� �������������������
����%��������� ����� ���� ���� ������ ����� �������� � �� ������ � ��������
�9� #������ &'':(� *��� ��� ����� &''4!�� � ����� ����� ���� ��2� ��� �� ������ ��� ���
$ �>�� ��� ������� �� ���� ���� ���� ���� ��� ��������� ��� ��������� �� ������ ���
��� �������� ��� ��� ��� ���� �� ������������ � ��� ������ �� ���� ��� ���������� ���
���������������������������������9� #������&'':!��������������������5�6#∆�
����� ��� ������� �� ����� �������� ����� ���� +�� �� ����� �� ���� ����� ������ � ��
�������� � ��������� � ���� ���������� ��� ���������� ����� ��� ������ ����� ���
����������� ��� 5�6#∆���������� �� �� ��� ��������� ������#� ����(�9@)>&/�
��������C8�4'%���#!���������� ��� �C8�4'!��������������#������� ����������
������ ��� ��� ������ ����� ������� ������ ��� ��� ����� �� �������%���� �������
���� �������������� ��������������$ �>��������� ��������� ������������������
���������� ���������������
�
� /:�
� �� !������ %��.��$� ����� �/'�&����� ��� �/������� %�$� ('�!��
#�%%�+��$��'��!'�#�����������&��!�!�
8�������������� ��� ������� ��������#� ��������� ��� �������� ���������� �������
���������� ��� ��� ���������� ������� �� ��� ��� 9� #����� �9� #������ &'':!���
.������� �������������5�6#∆ �������������%�������� �������3A8�����������
�������������������������>/�������� ������������������������������ � �������������
��� ���� ������������� ���5�6#∆� ��������������� �������������&>��� ����������
��� ���������������������� ������������������ �����������������������%����
����� ����� ��������� ����� �� ����� ����� ���� �"������ ,�+!�� � 1���������� ������ ��� ���
5�6#∆�������������������&>���������������� ������� �����������������>'������
�������� ���������7��������������� ��������������������������5�6#∆���������
������������������������%������������������ � ���������������,�,!���
� /��
�
�
�
���
�
��
� � �� �� �� �� ��
�� ���
�����
�
�
�$���� �� ������&��� $��+�'� .������!� �#� +�%�)�"(�� ��-0-� ���� ����∆� �������
� �����-1�'�(�������
$����� #���� � ���������� ������� �� �������� � �������� ��� �������%���� �����9C>�>,�
��!������5�6#∆��������!����3A8���������������������� ���������� �������:''������
���� ���������� ��� ���������� ����� ������� ��� ����� ��� ���� ����� ���� ������ �� ���
�������������������������������
�
�
�
�
�
� //�
��&%���������&���$��+�'��'��������!���!��#�����)��%������������ !�����!� 2���
��-0-�&��.$�����3��.������� �������#���� ������ ������������������������
������������>/����������������������������������������������� �������� �������
�������������������������������������������������3�A�!����
*����
��%������
��$�('�!��
2'3�
,��&%��$������
2'�4��,3�
�,566�����'���
�#����-1�'�
2'4�,3�
7��&�%��"����
'���8"$��!�
��(%����
3� 4� >�,�D�'�&,� ,�+/�D�'�'/� �
5�6#∆� &,� ��+��±�'�+:� &�>4�±�'�+'� �
786��∆� >�4�� 4�&:�±�'�&:� &�>4�±�'�&&� �
5�9�∆� >� >�+>�±�'�'�� ,�'�±�'�,&� �
5�9�∆� %� %� %� ���������
5�9&∆� >� >�&��±�'�+�� ,�,�±�'�&/���� �
5�9.∆� >� >�'4�±�'�':� &���±�'�,:� �
5�9��∆� %� %� %� ���������
5�6�∆� &>� 4��,�±�'�+:� +�&/�±�'�'�� �
56��∆� &&� :�>,�±�'�&�� &��:�±�'�&:� �
5�6�∆� &>� :�+&�±�'�'�� +�&�±�'�+>� �
5�6�%∆� &>� 4�:��±�'�4:� '��&�±�'�++� �
5��.∆� %� %� %� ���������
6 :�∆� %� %� %� ���������
:���∆� %� %� %� ���������
8 �∆� >� 4��:�±�'�,/� &�:/�±�'�,+� �
8 �∆� >� 4�:&�±�'�,&� &�/��±�'�+/� �
8 �∆� %� %� %� ���������
�#∆� 4� 4�,��±�'�&�� &�4:�±�'�&:� �
��:#�∆� %� %� %� ���������
� 7$∆� %� %� %� ���������
� 7��∆� %� %� %� ���������
� 7��∆� %� %� %� ���������
����∆� :� >�/,�±�'�+:� ,�+4�±�'�'�� �
����∆� %� %� %� ���������
� ��∆� >� >�&4�±�'�&+� �,����±�'�&4� �
�
� /��
-����������������!!�����%�#���������&���$��+�'�
��� ������ ��� ��� ������ ����� ����� ������ �� � �������� � ��������� �� ���
������� �� ������� �� �������� ������ ���� �������� � ������� ������,�4��"� �������
��������� ���� ������,�����,�����,�����,�#����!�����"�����"�����"���69���"#�
�� ���������%�������%�� �� �������������������������������� ������������������
����2��� ����� ��� �������� � ������ �.�������� ��� ����� &''+!�� ��� ��� ���� ��� ���� ����
������������������ ���������8����������������������;!�������;!�������������
�� ��� ����%��������� ������ ������������ ������ ����,�E��"� ������������ �����
������������ �������� �.�������� ��� ����� &''+(�8����� ��� ����� &''+!�� �3����������
����� �����������������"�����"��������"#���������������� �������� ���� �����
��� �� �� ��� ���� ������� �� ������� ���� �������� � ��������� �.�������� ��� �����
&''+!����������������������������������������������������������������������
������������������� � ���������������������������������������������� ������
����������������������������"������,�&������������ ��∆������ �#∆�����������
������������������������ �����������������������9�6�∆������ ��∆����������
�� ������� ������ ������ �� ��� ����%���� ����� � ����� ����� ������� ��"�� ����
��"#� ���� ������� ���� �������� � ���������� � ����� ��� � ��∆��������� ���� �� ��
����������������� ������������������������������������
�
�
�
�
�
�
�
� �'�
�
�
�
�
���
�
��
� �� �� �� �� ��
�� ���
�����
�
�
�
�$������,��������������#��!!�����%�$���!�#���������&���$��+�'������(�������#�
-1�'��
.������� �������#���� ���� �������%���� �����9C>�>,� �����5�6#∆������ ��!��9�6∆��
����� ����� � ��∆������ ���� � ��∆������ ��!�� ���� � �#∆������ ��� ���3A8����������
���� ���������� ��� ���������� ����� ������� ��� ����� ��� ���� ����� ���� ������ �� ���
�������������������������������
�
�
�
� �+�
9�,�%�������#���� ��%!���/����!��'��%�$�('�!��������������&��!�!���
=������������ ��������������������������������������������������#������� ���
���������%�����������������-������ ���+���!��������������������������5�6#∆�
����5�6�∆��������� ��������������%��� ����������� �������������������������
����� ��� ������ � ������ ��� 3A8� ������� ��� ��������� ����� �� 4'� ����� �������
���������������� �������� ����������������� ������������� ��������� ���������%
���� 9C>�>,� ����� ���� ��� ������ � � ��∆������ ����� �� ������ ���� �����������
=����� ������ � �������� �"������,�,.!�� �������%���������� ����5�6�∆� ����5�6#∆�
�������������������������&�4�����������������������������������������������
���������+'�������������� �������������������=������������� � ���������"������
,�,9!�� ���5�6#∆������������������������������������������������������������
��������������&>����������� ������������������������������������ ���������>4�
�� ��%��� ������� �� �������� � .� ������� ����� ��� �������� ��� ��� 5�6�∆� �����
������ ��� �������� �������������������������� �������� � ������� ����� ���� ���
������#������������������������������� �������������� ������������������������
�
� �&�
� �
� �� �
���
�
��
� �� �� �� �� ��
�����
�����
�
� � ��
���
�
��
� �� �� �� �� ��
�����
�����
�
�$�����*��+�'�.������!�#�%%�+��$���!'�#��#��������&������������&������������!��
��� .����� � ������ #���� � ��� ��� ����%���� ����� 9C>�>,� ��!�� 5�6#∆� ����� ��!� ����
5�6�∆������ ���� ��� 3A8������������ .������� � ������ #���� � ��� �������%���� �����
9C>�>,������5�6�∆����������5�6#∆ �������������� ��∆�������������3A8�����������
� �,�
5� �'������∆∆∆∆� ������&��� %�$� ('�!�� ���� ���� ��� %�!!� �#� ��&�%��"� ���
!�((��!!�����������!�
�������������� �������������������������������������������������������������
����� ���� ������ �� ��� ���� ���� ������ ��� ���� � ��� ��� ��������� �� ��%��������
��������� ��� #��� ����� ������� ���� ��������� �� ������������ ��� �� ��� ������ ���
�������� ����� ������� ��� ��� ������� � ���� �������� ���� ����� ���� ��� 5�6#∆�
��������� ���� ����� ����� ���� �� ��� ����� ��� �����2����� ��� ���� ������� ����
���������������������������� �����������������������������������������
� �����������������������%��������5�6#∆� ���������������������������������
�����������������������������������������������������B�!���������B���������
�� �������� ���� �� ��������� ������� ������� ���� ���%������� ���� �C��� ��� �����
+�/+!�������5�6#∆��������������������������������������������� �������������
����%����� ����#�� ��� � ��∆� ������ ������ ��� �� ��������� �� ������ ��� ���� ����
�"������,�>!�� ����� ����������������� ���5�6#∆������������ �������� � ��������
��� ��� ���� �� ��� ��� ���� ��� ��������������� �� �� ������� ����� ����� >/�
����� �������� � ������ ��� ���5�6#∆������ ������ ��� �������� ���� ����������
�����������%����������������������� ��������� ��������������������� ����������� �
�������"������,�,.�����9!���������������� ����������5�6#∆����������� �����
��������������� ����������������������������� ����������� � ����������� ���
����� ��� ��������� ��� ���������� �� ��������� � ����� ����� ���� ��� ��� ������
������ � ���������$ �>������������������ ����������� �������������������� ���
�������������� #�������#��������������������������� �����������������������
�������� ����������
� �>�
� ����������������� ����������� ����������������������5�6#∆������
�������������� � �������������������������� ����������������������������
��� ����������������
�
�
�
� �4�
�
�
�
��
���
� � �� �� �� �� ��
�� ���
������� �� ���� ������
�
�
�
�$����-���%%� ��&�%��"��#� �����!�������!������'��+�%�)�"(��#�%%�+��$��'��!'�#��
���������&������������!��
.������� � �������������������������������������� ������������������������������%����
�9C>�>,!������5�6#∆����������� � ��∆�������������∆��������� ����5���∆������
��� ����� ��� ���� �� �������� � 3A8� �������� � ���� ���������� ��� ���������� �����
������� ��� ����� ��� ���� ����� ���� ������ �� ��� �������� ��� ���� ���� ����� ��� ����� ���
�����������������������������
�
�
�
�
� �:�
-� ���'��� ���%"!�!� �#� �'�� ���� ��"� �#� �'�� $�����%� ������%�
(��'+�"����������&��!�!�
1��������� ����� ���������� ��� ������ �� ��������� ������� ��� �������� ��� ���� ���
������������� ��������������������������������������������,�,������������
�������� �������#���� ������� ����������������������������� ��������������
��� ���� ������ ��� ��������� ���� ���� ��� ��� ��� ������ ��� ���� ����� >/� �� ������
�������������������������������������������������������������������������
��� ��� ����� ���������� ���������� ���� ����� ��� ������ �� ����� ���� ����� ���� ����
��������� � -�� ��� $ �+��� $ �&��� $ �:��� ����$ ���� ���� ������� ���� ��������� ���
������� ��������� ����� ������ � ��� ���� ��������� �������� $ �+��� $ �&��� ����
$ �,�� ���� �� ������ �� � ����� ��� ��������� ������#� �65.� ������� ������ � ���
�������� �-�������� ��������+�/�(�-������������-������ ���+�/:!�� ����� �����
���� ��� ��� 5�6�∆�� 5�6�∆�� 5�6�∆� ���� 5�6�%∆� ����� ��� �� #� ��� ������� ��
����������������������$ �>���������������������������������������� ������
������������ ��������������������������� ������������������$ �>������������� �
��������� ������� ����� ����������� ��� ����������� ����������������
� ���
9� �)!������ ��� $%"����� ��������� ���.��%"� �������� �'��
�/�������%�$�('�!���#��'������∆�������������$�������&��!�!�
���� 3A8� �������� � ������� ���� ��� ������ *%��������� *%����������� *% �������
*%���������*%������������� �����*%�����������*%�������.�� ���������&''>!������������
������������������������������������ ���������������������5�6#∆� �������
�������� � ������� 3A8� ������� ����������� ���� �� �� ��� ��� ������ � ��� ���
��� ������ ���� ��� ����%���� ���� 5�6#∆� ����� ���� ������ ���� ����� ���� ����
�������������������������� ���� ���������� � �������� �������,�>!�� ���������%
��������5�6#∆������������������ ���������3A������������ ����������������
���� ��������� � �� �������� �*%��������� *%��� ����� *%����� ���� ���� ��� ��!�� ����
388������������ ������������������������������� ���������������������������
������,�>����
� 3������������� ���� ������ *%������ ��� ��� ���� ������ ����� �������� ���
��������� ������ ��� ���5�6#∆������ ������� ,�>� ����"������ ,�4!�� � *%8������ �����
������� ���� ��� ��� ������ ���� �������� ��� ���� ����� ������ � ��� ���� ��� ���� � ���
������ �� ����� � 3�� �� 3A8� ������� �������� �� ������� ��� ������ � ���� ��� ������
����������������������������������3A������������������������� ��������� �����
5����������������������� �����������������������������������5�6#∆�����������
��������������������������������!����
9������ ��������*%��������������������������������������������#�����
���� ������������ ������% ���������������� ����������� ����� ���� ���� ������%
������������������������������������������� �����������������������������
��������������������� �������������������������������������% ���������������
������� ������ � ���� �������� � ����� ���� ���$ �>������� ��� �������� ����� ��� ���
� �/�
�������� ��������������������� �������% �������������������� ��������������
��������������������.������������������������$ �>����������������% ������
������������� ������������8������>������������
� ������������������ �������� ���� ���� ��� ���388������������ �� �� ������
���������������������� ������������������ ������������������������������
5�6#∆ ����������� ���������������� ���� ���3A8����������� �� ��� ���������
�����&&�������&>������� ������������������������� ��������������� �����������
������������� �������� ���� ��������� �������#����� ���*%������������ ���� ���
��� ����� �� ��� ���� ��� ��� ������ � ���� ����#� �������� �� ������� ��� ������ � ���
��������� �� ���� ���� ��� ������ +�,�� ��������� �� �� ������� ��� ��� �������� ���
���#� ����������������� ��������������������������� ���������������� ������
����� ���� &'� ������ � ��� ���� ������ ���� ���� ������ ���������� ��� ������ ��
��������� ������� ��� ��� ��� ���� #�� #��� ����� ��� ���� ������ � ���
�����������������������+�,����������������.����>/�������������� ��������������
���� ����� ��������� ��� �������� ���� ����� �� �������� ��� ��� 5�6#∆� �����
�������������!����
�
�
� ���
��&%��-��##�����#� �����!�����&�%���!�����'��%�$�('�!�:����&%��$����������#���%�
��%%� "��%�� �#� �'�� +�%�)�"(�� ���� ����∆� ������� ������ �� !'�#�� ��� ������&���
���������!���������� ��������������� �������#���� ������ ���������������������
���>/������� ������������������ ���������������������� ��� ����� ������������
���� ���������������������������������������������3��A�!����
;������ ��$�('�!��
2'3�
,��&%��$������
2'�4��,3�
�,566�����'���
�#����-1'���������
2'�4��,3�
��<�%�)�"(����-0-� � � �
3A� >� ,�/:�D�'�'/� ,�&&�D�'�'��
3A8� 4� >�,�D�'�&,� ,�+/�D�'�'/�
3A8�F�*%�������� >� ,�4+�±�'�+,� >�,+�±�'�+>�
3A8�F�*%���������� >� ,��4�±�'�'>� >�&:�±�'�&+�
3A8�F�*% ����� >� ,�&4�±�'�&+� >�>4�±�'�'4�
3A8�F�*%��������� >� ,�/&�±�'�&4� >�,:�±�'�+&�
3A8�F�*%��������� >� &�/:±�'�+4� >�+/�±�'�+/�
3A8�F���� ���� >� ,��4�D�'�':� &�/4�D�'�'>�
3A8�F�*%�������� >� ,��+�±�'�&+� >�4&�±�'�'��
3A8�F�*%������ >� >�+4�D�'�'/� &�4�D�'�'4�
388� >� >�+��D�'�'�� ,�4�D�'�+4�
� � � �
������∆�������� � � �
3A� )� )� )�
3A8� &>� ,�'>�D�'�'/� &�>�D�'�'4�
3A8�F�*%�������� &>� 4�>4�±�'�'/� +�>+�±�'�'+�
3A8�F�*%���������� &>� 4�44�±�'�+,� +�>,�±�'�'��
3A8�F�*% ����� &>� ,�,��±�'�&�� +�>4�±�'�+��
3A8�F�*%��������� &>� :�4/�±�'�,&� +�,/�±�'�'>��
3A8�F�*%��������� &>� 4�44�±�'�+&�� +�,/�±�'�',�
3A8�F���� ���� :� ,�4�D�'�&�� >�/4�D�'�+��
3A8�F�*%�������� &>� >�4:�±�'�&,� +�>4�±�'�',��
3A8�F�*%������ >� ,�D�'�'/� >��4�D�'�'>�
388� &&� /�D�'�&4� &�>�D�'�'&�
� � � �
=�3A�������������������������� ������������ � �� �������� �*%���������*%
��� �����*%����� ����������� ��!���
� +''�
�
�
�
���
�
��
� � �� �� �� �� ��
�� ���
�����
�
�
�$����9�*��+�'�.������!�#�%%�+��$�����!#������������&������������!���� �����!�
������� �����(�������#�-1�'���!��
.������� ���������� �������%���� �����9C>�>,� ���� ���3A8��������� ���� ��� ���5�6#∆�
��������3A8����������������3A8���������������0���� ��������� ���������������*%
������ ����� � ���� ���������� ��� ���������� ����� ������� ��� ����� ��� ���� ����� ����
������������������������������������������
�
�
�
� +'+�
5�;�����!� �##������ ��� &��!"��'�!�!� �#� �)!������ ��� $%"�����
��!(%�"� �� !���%��� ('����"(�� ��� �'�� ����∆� ������� �����$�
������&��!�!�
����������������������������������������� ������������� �����������������
���� �� ��������� ��� �� �� ��� � ������ � ��� ����� �� ������ ��� ��� �������� �
������� ���� �������� � ������� � ����� ����� ���� ����� ��� ������ ,�4� ���� ��� ����
�������������������������������� ������������;�����4,���������� ��������������
��2����� ��������� �� ��������� ������� �� ��� ��� ��� ����%���� ��� ���� ����
�������� �����"���� )�� ����)��� ������ ������� ��������� �� ��� ��� ���5�6#∆�
��������������������∆������������������������������������
��&%��9�������&���$��+�'�.������!��#��������������/����('���������!�����,��
������������������ �������#���� ������ ������������������������������������
>/����������������������������������������������� �������� ���������������
����������������������������������
�
� *����
��%������
��$�('�!��
2'3�
,��&%��$������
2'±±±±��,3�
���%���,566�
����'����#����-1�
2'±±±±��,3�
7���%�����9C>�>,!� %� 4� >�+/�±�'�'/� >�,'�±�'�&,�
� � � � �
;���&�%���(��'+�"� 5�6#� &,� ��+��±�'�+:� &�>4�±�'�+'�
� 5�6�� &&� :�>,�±�'�&�� &��:�±�'�&:�
� � � � �
��$�������"��'�!�!�� ��5#� 4� >�:&�±�'�&+� &��/�±�'�+/�
� ��5$�&� 4� >�>/�±�'�'>� &�>4�±�'�>&�
� � � � �
�!(���$�����"��'�!�!�� �6�� >�4� >�+,�±�'�&/� &��:�±�'�&��
� �6�� >� ,��/�±�'�&&� ,�':�±�'�>/�
� � � � �
�"!�������"��'�!�!�� ���� &>� ��,>�±�'�,:� '�&:�±�'�'/�
� ��#� 4� 4�&,�±�'�:�� ,�&�±�'�+��
� � � � �
*%���������"��'�!�!�� 5�6�� 4� >��/�±�'�&4� ,�'4�±�'�&+�
� 5�6�� 4� 4�+&�±�'�,>� &��4�±�'�,,�
� � � � �
*%"������"��'�!�!�� 5���� &'� 4�,��±�'�&>� '�&,'�±�'�&'�
� +'&�
��!��������"��'�!�!� � �� 4� ,�>+�±�'�,� ,�,&�±�'�+4�
� � �� 4� ,����±�'�++� ,�44�±�'�'��
� � �� 4� ,�,/�±�'�'>� &��'�±�'�+&�
� � #� 4� >�/&�±�'�'/� ,�/��±�'�',�
� � $� 4� 4�4��±�'�'&� ,��+�±�'�'/�
� � .� 4� ,�&:�±�'�&+� ,�:>�±�'�&&�
� � � � �
�!�%��������"��'�!�!�� ���� >� >�4:�±�'�&+� ,�+&�±�'�&,�
� ���� >� >�,+�±�'�+:� ,�:��±�'�4&�
� ���� >� >�>&�±�'�'4� ,�4/�±�'�,/�
� ��$� >� >�+/�±�'�'4� ,�>:�±�'�&+�
� ��&� >� >�&4�±�'�'�� &��:�±�'�4:�
� � � � �
���������"��'�!�!�� �8�� >� ,��/�±�'�+&� ,�4�±�'�&>�
� �8�� 4� ,�/4�±�'�'>� ,�+4�±�'�44�
� �8#� >� >�+&�±�'�&:� ,�&4�±�'�&+�
� �8�� >� >�&>�±�'�&>� ,�&>�±�'�+>�
� � � � �
�"!�����"��'�!�!�� ���� >� ,�&��±�'�'/� ,�/��±�'�':�
� ���� >� ,�/��±�'�+>� ,�,4�±�'�+��
� ��#� >� ,��4�±�'�+�� ,�&>�±�'�'4�
� ���� >� ,�&��±�'�'�� ,�44�±�'�+,�
� ������ >� ,�4:�±�'�&+� ,�>>�±�'�+&�
� ���%� >� ,�:&�±�'�&>� ,�&+�±�'�&��
� ����� >� ,�&>�±�'�+&� ,�++�±�'�,/�
� � � � �
;��'��������"��'�!�!�� ���� >� ,�4�±�'�+��� ,�4,�±�'�,+�
� ���� >� ,��/�±�'�&+� &��,�±�'�>&�
� ��&� 4� ,��>�±�'�',� ,�&4�±�'�&&�
� ���%� >�4� ,��/�±�'�+�� ,�,�±�'�&4�
� ���#� >�4� ,�4:�±�'�+4� ,�>4�±�'�,+�
� ���&� >�4� ,����±�'�&:� ,�+>�±�'�&:�
� ���.� 4� >�+/�±�'�':� ,�+��±�'�+4�
� � � � �
���%�����"��'�!�!�� :���� 4� 4�,:�±�'�+4� &��,�±�'�+4�
� :���� 4� >�/:�±�'�+&�� ,�'+�±�'�&+�
� � � � �
��������"��'�!�!� ��� &&� 4����±�'�>,� &�+>�±�'�++�
� ��� :� >�,:�±�'�'&� &��/�±�'�,&�
� ��� 4� >�:��±�'�+:� ,�+&�±�'�&��
� ���� 4� >�&4�±�'�&:� >�+&�±�'�&4�
� � � � �
��"(��('����"��'�!�!� ��:�� >� ,�:&�±�'�+&� ,��/�±�'�,>�
� ��:�� >� ,��&�±�'�'4� &��4�±�'�&:�
� ��:�� >� >����±�'�++� ,�>'�±�'�+>�
� ��:#� >� ,�:��±�'�'/� ,�&,�±�'�+&�
� ��:$� >� ,�&4�±�'�'�� ,��4�±�'�+'�
� � � � �
� +',�
� � � � �
�'���������"��'�!�!�� ����� >� ,�/��±�'�+4� ,�+�±�'�+>�
� ���#� 4�4� >�+:�±�'�,&� +��/�±�'�++�
�
�
��
�
� ���� �������� �������� � ������ � ������ ����� *%������ ��� ��� ���� ���
��������������������������������∆������������������ �����������*%�����!�
�������������������5���∆�������"������,�:!�� ���������������������������
*%������ �� ���� ��� ��������� ���5���∆�� ��� ��� ��∆��������� ��� �� ���� ���
��� ���� �������������� ����� �������� ������������5���∆� ���� ��∆���������
����������� �������� ��� ������� ����������� ���� ���� ��� ���� ���� *%��������
$��+�������������������������� �� ���������� �����������*%����%�������������*%
��������� ���� ��� ���� �@�� ���� ��� ����� +���!�� ���� ��� �� �� ��������� ��� ���
��������������� ������3��+������,%��������������������������������� ������
�������������������*%������������� ����������������������������������� ������
���������� �����������������������$ �>���@�� ������������+��4!��@�� �����+��4!��
"������,�:�����������������������������*%������ ������������������������
�����������5���∆��������������������∆���������������������� �������
*%���������� ������������������ �����������������"������������������������*%
�������������������"����������� �������������� �����������������������*%
������ ��������(� 3��&�� �� ��� ������ �������� � A������� ��� ��"�� �� ������ ����
�������� � ������ ��� ��� ���� ����� ���� *%������ ������������� �6������ ��� �����
&'':!����� ������� ������� ����������������������∆��5���∆������ ��∆�������������
�����!����������� ������������"������,�>�� �-�������� ����������� ����������
� +'>�
�����∆�����5���∆������ �������� �������������������������������������
��� ��������������*%���������
.����� ���������������������������������������������������∆������
����� ��� ���� �� �������� � �������� ������� ,�4!�� ��� �� ������ ��� ����� ��� ���
����������������������*% ��������������� ������5�6#∆�������������,�>!����
8�������������������� ��������������������������� ������������*%������
������� ������������������������������������ �������������� ������������� ���
���� ���� ������� ����� ���� ��� �� �� ��� ����� ��� �� �������� �� ����� ���� ���
���������������������� ���������������������������������*%������������� ����
������������������������8������>�������������
� +'4�
�
�
�
���
�
��
� �� �� �� �� ��
�� ���
�����
��
�
�
�
�$����5�������&���$��+�'�.������!��#� �'������∆���������∆�������!� ���������
!�((%��������+��'�$%"��������>����)!��������
.������� ���������������∆���������3A8����������������������0���� �������� �
������ ����� ��� ���� ���� *%������ ���(� ��� ��� 5���∆������ ��� 3A8� ����������� ���0�
��� ���������*%�������������� ��������*%������ ����� ���������������������������������
������� �������� ����������������������������������������������������������
�
�
� +':�
5���/�������%�$�('�!���#�����∆�����������������&���$��+�'��!�����
���������/����('�����?��������!��#��'����-0-�!�������
��� ������ �� ������� ��� ��� �������� ����� ����� ��� ���� �� ��� ��������� �
�� ��������������5�6#∆�������������������������������������#��������������
������� ���� ����� �3&// !� ���� ��� �� ��������� � ���� ������� ����� ��� ��� ���
9C>�>,� �� #������� ��� �� �� ����� ��� ���� *%�������� ���� *%��� ���� ���� ��������
.������� � ������ ��� ��� 5�6#∆ ���� 5�6�∆� ����� ��� ��� ��������� � 3&&/ �
�� #��������������9C>�>,��� #�����������������������������,�:������������� �����
�������� � ������ ����� ��� ��� ��������� � 3&&/ � �� #������� ���� 9C>�>,�
�� #������� ���� ����� ��� "������ ,��.� ���� ��� 5�6#∆ ���� 5�6�∆� ����� ��� ���
��������� �3&&/ ��� #�����������9C>�>,��� #�������������������"������,��9����
�
��&%�� 5� ������&��� $��+�'� �'��������!���!� �#�������!� �##������ ��� �'�� $�����%�
������%� ��!(��!�� ��� �'�� ��/����('��� ��-0-� ���� ��11�� (�������('���
&��.$�����!�
�
���.$������ *������%������ ��$�('�!��2'3� ,��&%��$������
2'�4��,3�
�,566�����'���
�#����-1�'��������
2'�4��,3�
9C>�>,� %� 4� >�+/�±�'�'/� >�,'�±�'�&,�
9C>�>,� 5�6#� &,� ��+��±�'�+:� &�>4�±�'�+'�
9C>�>,� 5�6�� &&� :�>,�±�'�&�� &��:�±�'�&:�
3&// � %� >� +�>'�±�'�+>� ,��'�±�'�,>�
3&// � 5�6#� ++� &�::�±�'�+�� &�&4�±�'�,+�
3&// � 5�6�� +&� &�4,�±�'�&+� &��4�±�'�+��
�
���� ����� �� ���� ��� ��� ���������� ��� ��� ����� ��� �� ������ ��� ���
��������� �� �������������� ���3&//8�5�6#∆� ����� �������� �� �� ������ ����� ��
����������������������9C>�>,������������9C>�>,����������������������������
���� �� ������ ��� ��� ������ �� �������� ����� ������������ ��� 3&// � ���5�6#∆�
�3&// !��������������� ������������� � ���������"������,���.�����9!������������
� +'��
������������������� ��� �����������9C>�>,���5�������������������������
���#������ ��� ����������������������&>�����������������������
� +'/�
� � ����
���
�
��
� �� �� �� �� ��
�� ���
�����
�
� � ��
���
�
��
� �� �� �� �� ��
�� ���
�����
��
�$����0�����&�������������&���$��+�'�.������!��#� �'����/����('��� 2��-0-3�
����(�������('���2��11�3�!�����!����.����� �������������9C>�>,���������3&// �����.������� �������������9C>�>,�����
����3&// � �������.����� �������������5�6#∆�������9C>�>,!����� ����5�6#∆������
�3&// !� ����� .������� � ������ ��� ��� 5�6#∆������ �9C>�>,!� ���� ���� 5�6#∆������
�3&// !�����
� +'��
5�� �������%� ��?��������� �#� �)!������ ���� $%"����� #��� ������&���
$��+�'��#�����∆���������
B��������������"������,�4����� �����������������������*%������������ ���� ���
�� ��� ��� �������� ���� ����� ��� ��� 5�6#∆� ������ � ���� ����� �� ��� ������
������� ���� �� �������� ���� ���� �� ��� � ���� ������ ����� �� ������� �������
������������������� �������(���� ��� ���� ���� �� ������ ���� ���� �������� ���
��������������������������������� �� �����������*%������������� �������������
������ �����������∆�����5���∆���������� �������"������,�/�.�����9!���;�� ���
������������� ������� ������������������������� �������� �� �������������
�� �������������������"������,���.�����9�������������������������'�'4�µ@����
������������� ����������������� ��������������� ��� ����������������������
���� ����� ��� ��� ��������� ���������� �"������ ,�+'!� ������ ��� '�'4� µ@� ���
��� ���� ��� *%������ �� ��� �������� �� �������� ��� �� �� ������ �� �� ��� ���
�������� ���� ����� ���5�6#∆������� �� �� '�''4�µ@���� ������ ������ � ��� ���� ���
���������������������������������������������������������������� �������
���� ��������� ������� �� ���� ������� �� ������ ������ ��� ��� ���������� ���� �����
��������� �������*%���������������������������������������������������������������
��� ������������ ������������ �������8������>��������������
�
� ++'�
� � �
� � ��
���
�
��
� �� �� ��
�� ���
�����
�� � ��� � �
���
�
��
���
� �� �� ���� ���
�����
��
�$���� 1�����&��� $��+�'�.������!� �#� ��/����('���������!� !�((%��������+��'�
�����!��������������!��#�$%"���������)!�������
���5���∆���������������������'�µ@������������µ@� ����'�'4�µ�� �����'�4�µ@� �����
����4� µ�� ���� ��� ��� ���������∆���������������������'�µ@������ '�''4�µ@� ����
'�'4�µ�������'�4�µ@����������4�µ���������*%�������
� +++�
�
� � ��
�
�
�
�
� � � � � � � � � � � � � � �
� � � � � � � � � � � � � ! � � � � � � µµµµ " �
��
���
��
� � ��
� �
�
�
�
� �
� � � � � � � � � � � � � � �
� � � � � � � � � � � � � # $ % � � � � � µµµµ " �
��
���
���
�$����@��(����%����!����!�����'������ !��������"�('�!������(%�������$���!�� �'��
���������������#�$%"���������)!������!�((%������������'���������
���5���∆���������������������������µ@��'�'4�µ���'�4�µ@������4�µ�� ���������� ������������
����∆���������������������������µ@��'�'4�µ���'�4�µ@������4�µ���������*%��������
� ++&�
� � �
� � ��
���
�
��
� �� �� �� �� ��
�� ���
�����
�
� � ��
���
�
��
� �� �� �� �� ��
�� ���
�����
��
�$�����6�������&���$��+�'�.������!��������∆∆∆∆�����������������!�((%��������
+��'�$%"���������)!��������
��������������������������'�µ@����(�'�''4�µ@����������'�'4�µ@����������� ������
��������������������������'�µ@������'�''4�µ@����������'�'4�µ���������*%�������
� ++,�
0�,�!��!!�����.���������� ��� ���� ��� ����� ���������� ������ ����� �� �������� � ����������
9�������� ��� ���������� ���� ����� �������� ���� ������ � ��� ���� ��%���������
������ �������� � ��������� �������� ��� ������� �� ��� ��%���������� ���� �����
�������� �������������������������������� #������������-��������������&'',(����
*�������������+���!���6����������������������������������� ��������������������
���� ����� ���������� � ���� ���������� ���� ���� ��� ��� ���� ����� �� ������ �����
�������������������������������������������
� 1�������� �� �� ����� ���� ���� ��������� ��� �� �� �� ������ ���� ����
���� ����� ����������� ��� ������� �������� ������� ��� ������ ���� ������ ���
��� ����� �-�� ��� ����� ��������� ��� ��� ��������� ��� ��������� ���� ������� ����
��������������������������������� ����������������������������������������#��
��� �� �� �� �� ���� ��� ����� ��� ���� ������� � 3�������� ���� ������ � ��� ��� ���
��� �� ��� ����� �� �� ���������� ���� ���� ��� �� ���� >'� ����� ��� +&� �������
�� ������ ���� ���������������������� ��� �-������ ���+�/>(�-������ ���+�//(�
-������ ��� +��'(�-������ �� ����5����2���� &''&(�5����2��� ��� ����� &''+!�� � ����
����� �������� ����� ����� ����� ��� ������ �������� � �������� ����� ���� �����
������������� ��� ������ � ���� ��� ����� ���� �������� ������#� �������� ��� ���
��������������������&>��������A����������������������������#��� ����5�6�∆��
5�6�∆� ���� 5�6�%∆� ����� ����� ����� �������� �� ����� �� ������� ���� �������
-�������� ������������ �������������� ������ ��� ���� ��� *%������ �������� ���
����������������������������������������������������������������������������
� )��������"���������9�����"������� )������������$ �>�������������@�� �����
&''4(�@�� ���� ��� ����� +��4(� 5����2��� ��� ����� &''+!�� � ���� ������� ��� ������
$ �>�� ����������� ��� ���� ���� *%������ ����� ������� �� ��� ��������� �����������
� ++>�
-�������� ���������������� ����������� �������� �������#� �����������������
������������������������������ �������������������������������������5�6#∆�
����� ������ ���� ������ �� �������� � ���� 5�6#∆� ����� ���������� �� ������� ����
����� �� �� ���������� ������ ����� � ���� ����� ���� ���� ��� ��� ����� �� ������
������������ ���������������� ���������������������������� ����������������
���#�� � "������ ����������� ��� ���� ��� ���� ���� *%������ �� �� ������ ���� ���
���������� �� ����� �� ���� ����� ������� ��� ��������� ���� ���� ������ � ���
��������� ��������������� ���� ���� ��� ��� ������������ ������������������������ ���
���������� �������������������
��
� ����
�������� � ����� ��� � ������� � � � ��
����� � ����������� � ����
� �����������
�
��������������������� �
�������� ���������� ����������������������������������� ���������������� ���
������ �� �� ���� �������� ��� ���� ��� ����� ������������� ���� �
������������� ����������� � ������ ������������ ���� �� ��� � ����� �������
���������������������� !"#�$����%�� et. al.��&''�#�(� ������������������� ")*��
+�� ������ "�� ��� ,��� ������ ����� ��� gcn4∆ ������� �������� ��� ������ ��� �����
,��� � �� ,� ������� ���� ������ ��� �������� ����������*� � ��,��� �����
���� �����,���� -.���� �� � ����� ����� ��� � ���� ��� ����� ��� ���gcn4∆�
���������������������*��/�������� ��������,���� �������������������,����
� ��������SER1���GLY1*��-.��������� ��������������������������������.������
����� ����,����� ��� �� ������ � � � �� ������ ��� ��� ��������� ������� � ������
����� �������������������� ����������������������������������0�� et. al.��&'''#�
1��������� et. al.��&''�)*� �/������,������.����������� ������� � ����������
����� �*�*� � 2�.������ ����� ���� ��� ����� �� ���� ������� ��� ��� � � ���
���'.���� �� ��������� ��� �0�� et. al.�� &''')*� �2�.������������ �� �����
���� ��� �������� ����� -.����� � ����� ���� �����*� �3�� ������� ����� ������
,�������������������4���������-.��������� ���������� ����������� ����
��� ��.������ � �,�,��� � �� �� ������� ���� ������ ��� �������� ����������� ���
� ��5�
, � ��� ��� ������ ��� � � ��������� ��� ��� �� ������ ��� ��.����������� ����
��������������*���
�
�
�
�
�������
�������
��� � ��� �
������ � ������ �
����
����
����
��
����
���
����
�������� � ����
��������
���
���� ����
�
���
������������
��� ���
������������
����
������� � �
����
�������� �
�����������
�����
������
��������� �
���
!������ "����������
����
��
����
�
!�"��#�������$#�$�#%��&���#����'��� #��'�(�) ����*#�)���
2�.����������� �������������������������,������.���������������������
���� ��� ������ � ������ -.���� �� ������ ���� ��������� ��� ��������� ��� ������ �
������������ ������� ��� ���������� � ����� ��������� ���� ��� ��������� ��� ��� �������
����������������������������������0�� et. al.��&''')*���
� ��6�
+�!�� ��#��#)��#)��,#��#(�*#��(�"�-,�)#��&�����∆∆∆∆� ������
������#��'������������)��
-.��������� �����,�����,�������������.�������������������������� ����
��� ����� �������� ��� ��� gcn4∆� �������� ��� ������� ��� ��� ������� �����*��
������ ��� ��� ���� ��.������ ����� ��� ��.����������� ���� ��� ����� ������
�*�)*���
/������� ��,��� ��� ���gcn4∆�������� ��� 178������� ���� �����,����
������ �� �,�� �� ���� �� ������ ��� ������,���� ���� -.���� ��,���� � ����� ���
������� ��� ��� ����� ��� ��� gcn4∆� ������� �3�� � �*�� ���� ����� �*&)*� 2�� ��
���� ������������������������������.���������������������� �������������
���� ���� ��������������gcn4∆������������������������������.����������� ����
��� ��� ����� ��� ��� ����� ���� ����� ��� ������� ��� ��� gcn4∆� ������� ������
����������*���
� ��!�
��'(#����&&#����&�$�����)���#����'��� #��'�(��#)���� (�"�-,�)#.����'(��"� �� #�
���� &���(� �#((� *�#(�� �&� �,#� %�(���*-#� ���� ����∆∆∆∆� ������ &�((�%��"� �� ),�&�� ���
���#��'������������)����,���������,� �.��������gcn4∆�����������������17��178��
188� ���� 178� ����� ,���� ���� ��������� ��� ���� ��� ��� ��� ��� ��.������
����� ���������� ������,����� �,����������������� �*��3�������������
��� ����� ���� ��������������� ��������������������������������,������������
��������*���
�#��� � ��"�-,�)#�
/,0�
���'(��"��� #�
/,�1���0�
��233��#��,#��
�&�#��4,�/,�1�
��0�
��5�(���*-#��678� � � �
17� �� "*!5�9�'*'!� "*&&�9�'*' �
17�:�-.���� �� "* ��9��'*'!� ��*&!�9�'*'6�
17�:�� ������ �� "*5 �9�'*'�� "*���9�'*'��
17�:������� �� "* &�9�'*&�� "*�"�9�'*�&�
178� �� �*"�9�'*&"� "*�!�9�'*'!�
178�:�-.���� �� �*���9�'*'!� &*��9�'*'��
178�:�� ����� �� "* ��9�'*'5� &*!��9�'*'��
178�:������� �� "*6��9�'*�"� &* �9�'*���
188� �� �*� �9�'*' � "*��9�'*���
� � � �
������∆� ������ � � �
17� �� �� ��
17�:�-.���� !� !*&�9�'*'6� �*!��9�'*�"�
17�:�� ������ !� !*'�9�'*'�� &* �9�'*���
17�:������� !� 6*!��9�'*��� &*�!�9�'*�"�
178� &�� "*'��9�'*'!� &*��9�'*'��
178�:�-.���� �� "�9�'*'!� �* ��9�'*'��
178�:�� ����� 5� �*!��9�'*�6� "*��9�'*& �
178�:������� �� &*���9�'*���� �*56�9�'*���
188� &&� !�9�'*&�� &*��9�'*'&�
�
� �� �
�
�
�
�#�
�
��
� �� $� %�
����&'�(
)*%��
��
�
!�"��#� +� ���#��'��� "��%�,� 9��#���)� �&� �,#� ����∆∆∆∆� ������ ��� ���� #��� �
)�--(# #��#��%��,���#����'��������)���
/������� ��,��� �������� ��� ��� gcn4∆� ������� ��� 178� ������ �� ��� 178� �����
���� �����,����-.�������#�,����� ��������#�����,�������������� �3�����������
,��� ����� ���� ������ ��� ����� � ��� ������ ���� �� ��� �� ����� ��� ����� ,���� ��������
��������*���
� �&'�
8���)�-�����)#���#�,*���:* #�,*(����)&#��)#�����$��*���#�
�#;���#��&������#��'���"��%�,���� ��� �(� #��� �
3�� ����� ������ ��� � � ���� �� ������ ��� ��.����������� �������� ��������
������������ �������� ��,��� ��� 178������� ���� ��� 178� ���� ����� ,���� -.
������ ��������������������������������������������.����������� ����,���
������� ��� ���,� �.���� ����gcn4∆ ������*� �3��������� ������� ��� ����shm2∆�
� ������� ����� ������ ���� ���������� �������)�� shm1∆� � �������
����������� ��������������� �������)��������� �shm1∆shm2∆ �����������
,����� ��.����������� ���� ���� �� �� �� �������� ��� ��� ����������� � � �����
� �����������)�����gcn4∆ shm2∆�����gcn4∆ shm1∆����� ��������*���
� 3��� �������;�����������������������,���� ����������������������bas1∆
������� ������� ����� ����� ������������ ������ ������ ��� ���� 7$/������� ��� ������
�3�/838)*��;���������������,����������� ��������������� ��������.������
����� ���� ���� ������ ����������*� � +�� ��� � ��� ���� ��� ����� ������������
�7������.���������������� &#�� ��� et. al.��&''�)*� �+���������������178�
���������������������������������bas1∆��������4���������������,��*��
��,���� ����������,������� �����178����������� ���������bas1∆�������)�
���������������������178�������������178����������������������������
��������.����������� �����������*")*���
+������� ��� ��� ������������������� ��������.����������� ������� ��
��� ���� � shm1∆� ���� shm2∆� �������� �,� ���� �� ���� ����������#� ���� ���
bas1∆� ������ ���� ������� ���������gcn4∆ shm1∆��gcn4∆shm2∆� ����shm1∆shm2∆
����������,����� ��������*"/)*��3��������������������������� ���������� �������
��� ��� ���� ���������� ��������� �SHM)� ��� ������� ��� �������� ��,��*��
� �&��
/ ���� �����.������� ��.�� ������ ��� ���� ���� ���� ��� ��� ��.������
����� ������������� � �������������,�������������� ���gcn4∆shm1∆���� ���
gcn4∆shm2∆ ���� � ������� �,�� ���� ��� ���� � shm1∆ ���� shm2∆ �������� ���*��
(�� ���� ��������������������;������������������������,��������� ������������
��,��� ��� ������ � ������ ����������� ������ ���� ,��� ���� ������ � ��� ������
��,��������������������������<���� et. al.��� 6)*��=���� �����,���������� �
������� ����� ��� bas1∆� ������� ����� ���� �,� �������� �*� � +�� ,��� � ���
������ ����� � � ������� ����� ��� gcn4∆� ������ ���� ��� ������ ��� ����*� � 3��
shm1∆shm2∆ �������,������,������� �,�������������������������,���
��� ������ �*";)*� � -.���� �� ������ �������� ��,��� ��� � � ��������� ,���� ��
����� � ����� ��� ��,��� ���� �������� ��� ��� ������ ��� ��� bas1 ������
�������*"8�����7)*� �3��shm1∆shm2∆ ���� �������� �������,���� �, �� ���
��� ����� ��� � ����� �� -.����� ���� ,���� �� � ���� �� ����� ��� ��� �����*��
2�� �� ���� ��� ��� ���� ���������� ���SHM2� �,����� ������ ��� ����� ������
���� ���������� �������)� ������ ��� �� ��� ������ � ��� �������� ��,���
�����SHM1������������������������ ��>��)*��3����� ���������������������
������� � 4������ �����.����������� �������� �������� ��������������� ���
����������,������������ �������� �������������������� ��������� �������
���������� ���������.����������� ���*���
� �&&�
�
�� � � � � � ����
� � � � � � �
�
�
�
�
�
�� � � � � � ���
�
�
�
�
�
�
!�"��#�8����#��'���"��%�,�9��#���)��&� �����)��������'(#� �����)�������� #��� �
)�--(# #��#��%��,�$�����)� #��'�(��#)��
��,����������� �� �,���� ������ ������������������������� ���shm1∆� ���� shm2∆ ���
gcn4∆�����bas1∆�����gcn4∆shm1∆����� gcn4∆shm2∆ ��, shm1∆shm2∆ (���������� ���
178�����������178���������� �����,���������������� ���*��*����178������*���
,����� ����*��*�,����-.���*��*�,���������*��3����� ������������ ����� ���� ������
����������������������������������*���
�#�
�
��
� + �% �$ �� $� $+ �%
����&'�(
)*%��
�#�
�
��
� + �% �$ �� $� $+ �%
����&'�(
)*%��
�
�#�
�
��
� + �% �$ �� $� $+ �%
����&'�(
)*%��
�#�
�
��
� + �% �$ �� $� $+ �%
����&'�(
)*%��&
� �&"�
� ��������)� �#(��#�� ��� ��#����'��� #��'�(�) � ,�$#� ���
#&&#���������#��'���"��%�,�
1����SHM1�����SHM2,�,����������������.����������� ��������������������
�������� ������������ ���� �������� ��� ����� ����� ��� ����,��� ,� ����������
�GCV1��GCV2��GCV3��LPD1�ADE3, MTD1 ��� MIS1�������,�����������*�)*��3���
��������,���������������������������������������������������������!�������
������� ������������� ����������������� �� ��� ��,�����*��
������ ��� ���3� �������� ��� �������������� � � ������������ ��� ���� ��
�GDC)� ����� ��� 4���� ��� ��� ������ ���� ��� � ����� ��� ���'.���� ��
��������� ������������������������ ������� ��� � ��������'.���� �.3���
��� �������� ������ ��� et. al.��&''�#�0�� et. al.��&''')*� �GDC� ������� ���>���
���� �� ����� ���� �>�� ��� ���� � ��������� � ����� ��� � ����� ����� ������
��������������������1��� ����� �#�1��� �� et. al.��� 5)*��3���������������������
GDC ���� �� �� ���&�� �0� �������)�� ���"�� ��� �������)�� ���� -����� �-� �������)�
�1��� �������7�,���� �#�1��� �� et. al.��� 5)*� �GCV3� �����.�� �������� �����
���� ����� ��� ��� ����� ��� �������� ����� 4��� ��.������ ������ ��� ����
��������� �1��� �� et. al.�� � 5)*� � +�� ���������� �� ������ ���GCV3� ��� ��� ��� �
���������������� ����������������������������������� ������ � �����GCRE1�
GCRE2� GCRE3,� ���� 3/3/� ���� ������� ��� ��� GCV3� ���� ������ ����
�$����%�������1������� 6)*���
MTD1� ��� �� $/7:.������� ���'.���� ���������� ��� ����������
���� ��������������������������� ��������.�����������*��+���������������� ����
���;���������;��&������������������7������.���������������� &#�1�� et.
al.��&''�)����������������������������� �������� ����7��������7������.������
� !#� =���� � 5#� =�� et. al.�� � 5)*� � �������� MIS1� ��� �� ����������� �
� �&��
8�.��������� ��� �������� ,����� ��� ���� ��� ��� ��� ������������ ��,��
������� ���������� ������ ��� ��������� ��� ��������� ���� ������� ���������� ���
���� .3��� ���������� ����� .3��� ��� ����� ���� ���� ���� �.3���
�����������1�����������(�����,��>��� !!)*���
3�� ����� ������ ��� 3�� � �*&� � � �� ���,� ����� SHM1� ���� SHM2� ���� ��
����������� ��� ���� ���� ��� ������ ������ �� ������ �*")*� � 1��� � ��� � ����� ���
MIS1, ADE3 � MTD1�� ,����� �� ���� ��� ��� ��� ������������ ���
���'.���� ���������� ������������������������� ������������������������
�����������������������,����������*��3��������MIS1��ADE3�����MTD1)�,�
������ ��� �� ��.�� ���� ��� ��� ������ ��� ��� � ����.�������� ���������� ���
?����,����et. al.��&''5��?���,��� et. al.��&''5)*��$��� ������������������%��
� � �����.�� �����������������SHM1��SHM2*� � +�� ��������� � ����� ���������
��������������� ��������.����������� ������������� �����������������
��������������*���
� �&��
�
�
�
������� �������
��� � ��� �
�� ���� � �� ���� �
��������
���� ���
��� ���
������������������������
����
!������ "����������
,�$- -&�)�
������
����
�
!�"��#��<#�#)���$�($#�������#����'��� #��'�(�) ��������� �����������������
�
�
�
�
�
�
� �&5�
��'(#�+��,#�(�"�-,�)#.����'(��"��� #�����&���(��#((�*�#(���&��#(#����� �����)��&�
��#����'����#(��#��"#�#)�������� #����&�((�%��"���),�&��������#��'������������)��
3�� ����� �� ���� ��� ����� � ��� ������ ���� ��������� ��� ����� ��� ��� ���� ,����
�������������������������*���
� <#�#�
�#(#�����
��"�
-,�)#�/,0�
���'(��"��� #�
/,�1���0�
��233��#��,#��
�&�#��4,�
/,�1���0�
��#����'��� #��'�(�) � shm1� �� �*&"�±�'*��� "*&��±�'*&"�� shm2� �� �*&5�±�'*&�� "*"��±�'*�!�
� gcv1� �� �*�!�±�'*��� "*�5�±�'*'��
� gcv2� �*�� �*���±�'*�"� "*���±�'*'!�
� gcv3� �� �* &�±�'*&�� "*&��±�'*�"�
� lpd1 �� "* ��±�'*'�� "* &�±�'*�6�
� mis1 �� "*6&�±�'*�!� "*!��±�'*���
� ade3 �*�� �*���±�'*&�� "*�&�±�'*'!�
� mtd1 �� "*!��±�'*��� "*! �±�'*�&�
� � � �
�
�
3���� ��������� � 4������ ��� -.���� ���� �������� ��,��� �����������
������ ������ ��� ������� � ��� -.���� ������������ ���� � ��� ����� ����
".�������� ����� ��� ��� SER1� ����,��� �@ �� et. al.�� � �)*� � 3���� -.����
4������ ��� ���� ��� ��� ��� ������� ��� ��� ��.������ ����������� �� ���
��������� ����� ��������� ��� ���� ��.������ ������� � ����� �� ������� ���� ����
���� ��,��� ��� ��� shm1 shm2 ���� �������*� � 3��� �� ��� �������� ����� ����
�������������������� ���,���4���� ���������������-.����������.������
����� ���*� � 3����� ��� ������ ������ ���,�� ����� ��� �������� ��� ��.������
����� ���� ����������������������������S. cerevisiae�� ��,��������-.����
����� ���� ".�������� ����� ��� ��� ����� ��.������ ����*� � A��� ��������
�������������������������������.������������ ����������������������-.����
���� ����������������������������)*����������GLY1������������� ����������� ����
�������� ���������-.�������������� ���������������,��������������������� �
����������������������������������������������������.�����������*���
� �&6�
�
=� ����$���#)� �&� ��)�-� ���� <��-� �����"� �,#� ),�&�� ���
���#��'��)�)�
;���� ;����� ���� ������ ������������ ������� ���� �� 4���� ��� ����������� ���
����������*� � +�� ,��� ����� ������� ��,� ��� ��� ����
���������� �������� ���� SHM2� ,��� �� ���� �� �,���� �� ������ ���
����������������������������������������� ���������������������� � ����
;����� �7���� ���� 7������.������ � !#� 1��������� et. al.�� &''�)� ���� ������
�@�$� et. al.�� � �)*� � 3�� ,� �.���� ;B�6�"�� bas1∆� ���� gcn4∆� ������� ,�
��������� ,���� ��� SHM2::lacZ ���� ���� �������� ��� β.�� ����������
������� ��� ���� ������ ������� ��� �������� 178� ������ ���� ��� 178� �����
���� �����,��������� ������-.�����������*��3��������������������������
���������������������������������,�������� ��������������������������,� �.
����1&!!������gcn4∆��������������,�������GCRECClacZ �����������������/ ����
et. al.��� !)�������������������������������������*���
� A��� � � ����������� ��� �������� ��,��� ��� SHM2::lacZ ���� ���� ����
���,� ������ � ��������� ��� ��� ������ ��� ;������ ����������� ����� ����� ������������
������ ��� ������ � ��� �������� SHM2� �������� ������ �*�)*� � +�� ��� ,� �.�����
SHM2� �������� ,��� ������� ���.� ��� ���.�� �� ,������ ���� ����� ��� ��� ������ ���
�������� ����������� ���� ������ ����� ��� ���� ��,��� ����*� � +�� ��� gcn4∆�
����������,���������������� �������SHM2���������,��������������������
��� ������� ��� ��� ����� � �� ����� ��� ���,� �.���*� �=���-.���� �� ������
,�����������,����� ������� �����������SHM2������������� �������*��+�����
��������� ������SHM2 ��������������,� �.�������������.�� ���� ������
� �&!�
��,����������������������gcn4∆���������������������� ����������,����������
��������������������������������,��*���
� 3�� �������� ��������� ��� β.�� ���������� ,��� ������� ��� ��� ��������� ���
������������������� ����������������������������������������*��/�������������
��� ,� �.���� ������ ��������� ������� ���� ��� ������ ��� �������� ������������
���������������.�� ���������������&�����������*5)*��3��������������������������������
,���������������������������������������������-.���������������������
� ����*� �3���� �������������,���� ��� ������ ������������������������������������-.
�������������������������� ��������������������������������������� ��*���
+�� �������� ����������� ��� ������������ ��� ;����� ���� ������ ��� ������ �
����������������������������������������������*��3����������,�����������
��������������-.����������������������� ������������ ����*��1����;�����
���������������,��������������������� ��� ���������.�����D����������������
������������ ��������� ���������������,��������������� ������������-.
�������������������������������������*���
7����� ����� ������������ �������� � �� 4��� ��� ��������� � ��������� ���
�������>�-.������������� ������������������������������������������������
;����� � ��� ��������� � �� ��� �� ������ ���� ����*� � ;����� ��� ��� ��������� ���
�� ��� �ADE� ���� ������ADE3)� ���� ��� ���� ��� �������� �����BAS1����� �� ��
���������������$����%�� et. al.��&''�)*��3�����;��������������HIS4 �/��� et. al.��
� !6), HIS7 �1���� et. al.��� 5) , SHM2 and MTD1 �7��������7������.������
� !)*���
� �& �
�� � � � � � ���
�
�
�
�
�
�
�� � � � � � ���
�
�
�
�
�
�
�
!�"��#� =� �:-�#))���� �&� ���������� ��� �,#� %�(���*-#� ���� ����∆∆∆∆� ���� ���∆∆∆∆�
�����)�&�((�%��"���),�&��������#��'������������)���� #��� �)�--(# #��#��%��,�
$�����)���#����'��������)��
E�������� ��� SHM2::lacZ ���.�� ���������� ��� � �� ������� �� �,���� ������ ���
�������� ����������� ��� ��� ,� �.���� ������ ;B�6�"� ����� gcn4∆ ������� ���� ���� bas1∆
��������������178�����������178���������� �����,���������������� ���*���*����
178� �����*��*� ,���� � ����*� �*� ,����-.���*��*� ,���� �����*� � 3���� ������� ,���
����� ���� ��� ��� ����� � ��� ������ ���� �� ��� �� ����� ��� ��� ����� �������� ��������� ���
��� ������������,��������������������������������������*���
�
�
���
���
���
$��
���
%��
.��
+��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
�
���
���
���
$��
���
%��
.��
+��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
�
���
���
���
$��
���
%��
.��
+��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
�
���
���
���
$��
���
%��
.��
+��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
� �"'�
�� � � � � � ���
�
�
�
�
�
�
�
�� � � � � � ���
�
�
�
�
�
�
�
!�"��#�2��:-�#))�����&���������������,#�%�(���*-#����� �����)�&�((�%��"��,#�
),�&�����#��'��)�)���� #�������������"��,#���#����'��������)��
E�������� ��� GCRE::lacZ ���.�� ���������� ��� � �� ������� ���� ��� ��,��� ��������
�� �,���� ������ ����������������������������,� �.����������1&!!�������gcn4∆ �������
���� ���� bas1 ������� ���� ��� 178� ������ ���� 178� ����� ���� ����� ,���� �������
����� ���*� ��� ���178������*��*�,����� ����*��*�,����-.���*��*�,���������*� �3����
�������,������������������ ����� ���� ������������ ���������������������������
����������������������� ������������,��������������������������������������*���
�
�
���
���
���
$��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
�
���
���
���
$��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
�
���
���
���
$��
� + �% �$
����&'�(
/�������&�������&&'���#����#�� (
�
���
���
���
$��
� + �% �$����&'�(
/�������&�������&'���#����#�� (
� �"��
2� ������#((�(��� (#$#()� �&� ��)#���#� �#��#�)#� �����"�
���-������� ��� ���#��'��� "��%�,� ���� <��-� �)� �#;���#�� ���
-�#$#����� -(#�#�(�))��&���)#���#�
3�� �� ��� �� �������� ����� -.���� ��� ����� �� ��� ��� ������ ����� ���� ��� ���
������������������*��/�� ������������������������� � �����������������������
������ ���� ��� ���� ����� ��� ����,���� ���� �� ������ ���� ��������� ����� ,����
�������,���� �� �� ������� ��� ����������*� �3�� ������������� ���-.����
������ ����������� ��� �������� ����������� ������ �� �� �� ��� ��������� ���
����� � �� ������������ ��� ���� ��� ��� ������ ������� -.��������� -.����������
� ������-.�����������-.������������������������������������ ��� �� �����
���-.�����������������������*6)*���
8 �� ��� ���,� �.���� ����gcn4∆�������� ��,�� ������ �� ��� ��� ����� ���
178� ������ ,� ������� ��� �������� ����������� ���� ���� �� ������� ���
������ ����� ��� ���� ��� ����� �� ��� ���� ����*� � 3���� ����� ,��� ������ ����� ���
����� ��� ���� ��� � ��� ����������� ��� ��� ,� �.���� � �*� � �0-8� ��� ����� ��� ���
����� � �� � ����������������� ������������ ��,��������� ����� ���������
,���� /*� 3����� �;/;1�� A$1=)*� � 3�� ����� ��� ������� ��� ����� ������ ������ ��
���������������*!������ ������������������������� �������/������������
�*���
� �"&�
�
�
�
�
!�"��#�7����)*��,#����-��,%�*)�&�����)#���#.�"(*���#.����,�#����#.����)-�����#�
�������*)�#��#��#��$#��&�� ���"(���)#�������������������
� �""�
� 3��,����������������������� � ��-.����������,� �.������� �,��
��� �� ����� ��� "'F� ��� ��� ������ � � ��� ��� ���� ���� ������ ���� ���� ��
������� ������ ��� ��� ������������ ��� � ����� ���� -.������� ������ �*!)*��
+���� � �� � ������ ����������������������������������,����� �������������
���-.������������-.������������,��������������� � ������������������������
��� gcn4∆� ������� ������ �*!)*� � +�� ��� gcn4∆� �������� ����� � �� -.���� ,���
���� � �� �� ��� ��� ���� ������ ����������� ����� ��� ��� ������ ��� ������ ��� � �
��� ����������������������-.���������������*��� ������ ���������������
gcn4∆�����������������&'F�������� � ����������� �*� �-.�����������������
��������������������,��������������178����������*���
� �"��
�
!�"��#� 4� ������#((�(��� ����#��������)� �&� ��)#���#.� "(*���#.� ���*)�#��#.� ��
�,�#����#.����)-�����#��������)-���"��#����%�(���*-#�����"��� ������&�((�%��"�
��),�&��������#��'��)�)��
3�� ������� ,� ��,�� ��� ���. ��� ����� ��� 178������� ������ �� ���� ������� ���
�������� ����������� ��� ���� >�� ��� ��� ��������������*� �=� �.���� ;B�6�"� ����� ����
gcn4∆������������ ���178������*��+���� � �����������������C���)�-.1#���)�� �#���0�
-.8��#���0�-.��#�/�0�-./��#�����/!0�-./���������������������������� ������,������
���*���
� �"��
7��')#��#��&����,�#����#�),�%)����#:�#��#�� (�"�-,�)#��&�
%�(���*-#��#(()����#�����#��'��)�)�
3�� ����� ��� ���� ��������� ��� -.������� ��� ��� ��� ������ ���� ���� ���� ����
���� �� ��� ��������,� �.��������gcn4∆����������� ����������3�� ��*"*�� +��S.
cerevisiae� � ����� ��� ���� �� ����� ���� -.������� ��� ��� ������� ��� �������
� �� ������������GLY1��@������� et. al.��� 6)*��$��������178�����188������
�������������-.������*��3�����������-.���������������� ��������������
,� �.����� ����'�����)��,��������������,���,�������������������gcn4∆�
������*� � 3���� ��������� -.������� ��� ��������� ��� �������� ��,��#� �������
�����������������������,�������������-.����������� ����������� �������� ���*��
+�� ���������� ��� ����� ���� ��� �������� ��,��� ������ ��� ��� gcn4∆� ������� � ���
���������� ��� ���������� ��� ��� ��������� ��� -.�������� ��� -.������*� � 3����
����� �������������� �������GCN4� ��������� �������� �����*���
� �"5�
��'(#�8��&&#����&����,�#����#�����,#�(�"�-,�)#��&��,#�%�(���*-#���������∆∆∆∆�
���������#����),�&��������#��'������������)��3�����������,���������������
��� ����� ���� ������������ ����������������������������,��������������������*���
�#��� � ��"�-,�)#�
/,0�
���'(��"��� #�
/,�1���0�
��233��#��,#��
�&�#��4,�/,�1�
��0�
��5�(���*-#��678� � � �
17� �� "*!5�9�'*'!� "*&&�9�'*' �
17�:�-.������� �� "*6"�9�'*��� "*��9�'*'6�
17�G�-.�������:�-.���� �'� �*�!�±�'*�6� �*!"�±�'*���
178� �� �*"�9�'*&"� "*�!�9�'*'!�
188� �� �*� �9�'*' � "*��9�'*���
� � � �
������∆∆∆∆� ������ � � �
17� �� �� ��
17�:�-.������� &�� !*���9�'*�6� �*" �9�'*'5�
17�G�-.�������:�-.���� .� .� .�
178� &�� "*'��9�'*'!� &*��9�'*'��
188� &&� !�9�'*&�� &*��9�'*'&�
�
�
+�� S. cerevisiae,� � ����� ��� ���� �� ����� ���� -.������� ��� ��� ������� ���
�������� �� ������������GLY1��@������� et. al.��� 6)*��GLY1����������� ��
����� �������GCN4� �$����%�� et. al.��&''�#�1��������� et. al.��&''�)�����BAS1�
�1��������� et. al.�� &''�)*� �7����� ����������� ��� ����������� ��� ��� ����� ��
������ ��������������� ���������������������������������-.���*� �3����
����� �������������� ������������� ����� ��������������.����������� ����
���� ��� ��� �� ������ ��� -.���*� � 1���� � ����� ��� ���� �� �������>�� ����
�������� �� ����� ���)������������������������ ���������GLY1���������,���
������*���
�
� �"6�
4��� �� #:-�#))���� �)� �����#�� �����"� ���#��'��)�)� ���� �)�
�#-#��#�������,#��$��(�'�(��*��&���)#���#�����<��-�
/�� ��� ����� ��� GLY1� �������� ���� �� �������� ,���� GLY1� ���� �� � � ��� ���
������������-.������� ���� ��������� ����������*� �3��,� �.���� ����gcn4∆�
������� ,� ��������� ,���� �� GLY1::lacZ ���� ���� �������� ��� β.
�� ������������������������������������������������������178�����������
178���������� �����,����� ������-.�����������*��+����������� �������
-.�������������GLY1���������������,� �.��������� �����������������
��������� ��5�������������* )*� � +�������������� ������GLY1���������,���
��� ����� ��� ���gcn4∆ ������� ����,��� ������� ��� ���,� �.���*� ���,��� ��� ���
��������-.������ ������� ��������������GLY1 ,������ �,� ������� ���
,� �.������gcn4∆��������������.� �3��bas1∆������������ ��� �,��������������
GLY1�,��� ������,���� ���,� �.���� ��gcn4∆�������� ������� ��� ���� �����������
����*� �3���� �� �� ��������� �������� ��������������������������� ���GLY1����
���� �� ����� ���� �� �� ������ �� ��� ��� ���� ��� ���� ��� -.���� ����� �����
� ����)����������������������������������������������������������� �������
-.���*� � 3�� � �,� ���������� ��� ��� ��� ���� �� ��� ��� ��� ����� � �� ��� ���
����� � ��-.������������������������������������������*�
�
� �"!�
�� � � � � � ���
�
�
�
�
�
�
�
�� � � � � � ���
�
�
�
�
�
�
�
!�"��#�>��:-�#))�����&��� �����������,#�%�(���*-#.�����∆∆∆∆��������∆∆∆∆� �����)�
&�((�%��"���),�&�� ������#��'������������)���� #��� �)�--(# #��#��%��,�$�����)�
��#����'��������)��
E�������� ��� GLY1::lacZ ���.�� ���������� ��� � �� ������� ���� ��� ��,��� ��������
�� �,��������������������������������������,� �.����������;B�6�"������gcn4∆ �������
���� ���� bas1∆ ������� ���� ��� 178������� ���� 178� ����� ���� ����� ,���� �������
����� ���*� ��� ���178������*��*�,����� ����*��*�,����-.���*��*�,���������*� �3����
�������,������������������ ����� ���� ������������ ���������������������������
����������������������� ������������,��������������������������������������*���
�
���
���
���
$��
���
%��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
&
�
���
���
���
$��
���
%��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
�
���
���
���
$��
���
%��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
�
���
���
���
$��
���
%��
� + �% �$
����&'�(
/�������&�������&'���#����#�� (
� �" �
>���)��))�����
2�.������ ����� ���� ��� ������ � ��� ��� ��������� ��� ��� ���� � ������
��� �����������������������������������������������������*��3������ ���������
��� ���� ��� ��� ��� ��� ����� ���� �� ������ -.���� ���� �����)� ����� ���
GCN4������������������������ ���������������������,��*��;����GCN4�����
BAS1� �� ������������ ������� ����� ��� S. cerevisiae �� ������ � ��� ������ ����� ����
����� �� ��.������ ����� ���� ������ �� �7������.����� ���� ������ � &#�
� ��� et. al.�� &''�)*� � 7 ����� ���GCN4� �� ��� ��� ��� ������ ��� ����� ,���
�,������ ��� �������� ��,����,���� ��� � ����� ���BAS1� �� ��� ��� ��� ��,���
����!�����*��3����� �������������������������������������������������������
�������,���������������� ����������������������,�����������BAS1��������
���� ��� ��� ������������� ����������*� ������ ��� ��� ���������GCN4��BAS1�����
������������������������� �������������� ��������� ���������-.����
����������������������������������*���
� ��,��� ��� ������ ��� ������ ������ ��� ���� ��� GCN4� �� BAS1�
������� ,� ������� ��� ��� ���� ��������� ��� -.���� ����� ��������*� � 3����
���,�������-.�������������������������,��GCN4�����BAS1������������ ���
��� ��� ����������� 4�����*� � -.���� ������������ ��� �� ���� ��� ������
�$����%��� ���� ����������� &''&#� $����%�� et. al.�� &''�)� ��� ���� ��� ��� � � ����
SER1��������������@ �� et. al.��� �)�������������� �������GCN4������������
������� ����������������������������������*��GCN4���������������� ����������
���������������������������������,���������� ���������-.�������������������
���������� ��� ��� ��������� ��� -.������� ��� � ����*� � 3����� GCN4� ������ ���
�� ���GLY1� �������� ���� �������� ����������*� � 3�� �� ��� ��� ��� � � ���
���� ��� ��� ����� � �� ������ ������ ���� �� �� ��� � ����� ���GCN4��,����� ���
� ��'�
4���� ��� ��� �� ������ ��� -.���� �����������*� � 3�� ����� ���� ��� ��,�
�������� ��������������ser1∆�����������, ������� �������������������������
-.����������� ���������GLY1�������������������,�������-.����������������
��� ,������ ��� �� ��� ��� ��� ������ ��� -.���� ������ ��� ����������� ���
����������*���
� 8���� ��� GCN4� ���� �� ��� ��� ������ ����� ����� ���� ��������
����������#� ��� ��� � ��� ������ � ����� ��� ��� �� �� ���� ����������� ��� ������ ���
������������,������������ �����*���������������������������������������
GAP1, BAP2, CAN1 ��� AGP1�,� ����� �� ���������� ��� ������������"/3� ��� ��
GCN4������������� �$����%�� et. al.��&''�)������MUP3� ����LYP1���������
�����#����������������������������������������������������������������� ����
� �*��3�����5����������������������������������������������������������
���������� ��� ��� ������ ����$����%���et. al*��&''�� �$����%�� et. al.��&''�)*� �3���
���� ���������� ��� ��� ������������ ��� �������� $/7�� 3���� ���� ������
������� ��������� ���� ���>��� /*� � ����� ��������� ���� ���� ��� ��������� ���
�����������������,�������4��������������������������,��*��3������������
������������� ������ �������������������������������������������� ���������
������ �������������� �������� �$����%�� et. al.��&''�)*� �2�� ������������� ����
�$����%�� et. al.�� &''�)� � ��� ������ �����FOL2� ,����� ��� ���� ��� ��� ��� �� ��� �����
��������� ,��� �� ������ ����*� � 3����� ��� ������ ��� ����� ������ ��� ���
gcn4∆�������� ���� �� � ��� ��� ��� ��� ������������� ��� ������� ��� �������� ���� �� �
,����� ��� 4���� ��� ��� ���������� �� ��� ��������� ��� ��� ������ ������
����� �������,�������������������*���
� $��� ����������� ������������-.�������������������������������
GCN4�,������������������������*�������������������������,�����������
� ����
���������-.������������� ��������������������������������,�,�����������
����������������������� �,���������*��
�
�
� ����
������������� ���������������������������������
�
�������� ��������������
������� �������������������������������������������������������������������������
��� �� ��� ���� ����� ���� ������ �� �� �������� � ��� � ����� ��� �� ����� ������������
������ �� ����� ��������� ������ ������������ �������������� ����������������
������ ������� � ������������������ ��� ���������! �� ����� � �� ����� �"����������
������� ������ �������������������������������� ����������� �����������������
�� �! �� ��������������� ���������������� ����������#�����������������������������
����������������������$��������������� �%�� �������� �! �� �����������! �� �������
������������� ������ � #���� �������������� ��������� ��� ���� �������� �� ������� ���
��������������� ������������ ���������� ��������! �� �����������������&������������
������� �'���� ��������������� �������������������(�������������������� ���
�� �����������������������������������������������������)*���� �� ��������++,&�
#����� ��������++-.&� ����� ��������� ���� ��� �������� ����������������������������
������� ���������� ����������� �%�� ��! �� ������ ���� ��������� �� ��������
"�������� ���� �%�� ������ �� � ! �� ���� ������ ����������� �� ���� ������� ���
�� ����������� ����� ����� ��� �� �������� ������� ��������� ��� ��������� �� � ������
���������������� �! �� ����� �#������������� ���� ��� � �������� ��������������� �� ���
�������� ���������������� ������� �������������∆���������������� ����� ����� ���
�� ���� ���� ��� �� ���� ���� ����� � ���������� ! �� ���� ��� ��� ������������ � ��� ����
��������������� �������� ���������� ������������������������ ���������� ���!
������������������� ���������/� ���/� ����/� �����/� ��)"��� ��� �������
�++�&�0����� �� ��������--1.���������������� �������� ���������������������������
�������� ��� �������� ��� �� ���� ��� ���������� ���� ��� ��� � ���� ���� ��� ���
� ����
� ��������������� �! �� ���� ��� � ��� �� ����� ����� �� � ������ ���������� ������
� ��������������� ���� ���� ���������� ��� ! ���������� ����������� ��� �����������
�������������� ����� �#���������� ��������� � �������������������� ��� ���������
�� ���������������������� �����! �� ������ ������ ������ ����������������� �������
������������������ �������������������������� �������� ������ ��������
�
������ �������������� �����������!" �����������# ������
�������
������� �������������� ��������
! ��������� ��� �� ����� � ��� ! �� ���� �� � � ���� ��� ��� ������ ��� � ��� ������� � �
! ����������� �� � ���� ����� �� � #��� ������������� ��� ! ��������� ��� ������ �����
������ ���� )� ��� � ���� ��� ������ ������ ��� ����.� )2��� � �� ����� �---.��
����� 3�"������/����������������������������������������0�������0���4�
)3��(���+++.���3���������������������������� ����� ���������������������! �� ����
��� ������������� ��� �������� ������ ��� �������� ��� ������ � #��� ����� ���� ��� ����
������������� ��� ! ��������� ��� �� ����� � ��� ������������� ��� ������������� ���
�����������������������#��������� �������������������! ��������� �� ��� ���������
������������� ��� �������� )���.� ��� ������������� ��� ����� )���.�� ������
����� ���������� ����������������)5��� ��1��.����
�
� ����
���������
����������
��
�������
������������
������������
������
��
�������������������
���������������
��� �� ����
����
����
����
���
�����
�
�
�� ��
�
$�! ��������� ��������%���&� ������� �����������������������
�
����� ��� ����� �� ��������� ��� ���� ������������� ��� ! ��������� )5��� �1��.��
��� ��� ������������������������������������� �����������������/63�����������
������ ���� � ������� ��� � ��� �� ��������� � #��� ������� ������ ���� ��� #���� ��1� ���
3��� � �� ����� ���� ���������� ��(���� ����� ��� �� �� ���� ������� ��� � ��� ���� �
�� ��������� � #���� ��� ������ ��� ���� ��� ��� � ��� ���� ��������� ��� � �� �� �����
��������� ����� ��� ���� �����%����� ���������� ����� � ������ �� ���� ����∆� ������
����������������1���� � ������� ����� ������ ����������� ��� ����� � ��� ��������
���� �� ���� � 2�� ���� ���� � ����� �� ����� � ����� ��� ���� ���� ���� ��� ���� ����∆�
�������� �������� ������� ������������/���������������������������! ���������
�������� ����������������������������∆���������� ������������ ����������������
���� ������ ���� ������������ �����������������! �� ����� � �������� )#�������� ���
5��� ����1.���#���������� �����������������������������������������! ������������
������������ ������ �������������������∆����������� � �� ���������������� �#���
��������� ��� ������ �! ������������� �������7!3� ���3��� ��� ����������� ����
� ��1�
������������������������! �� ����� �! �� ����������������������������������������
! �����������#����� �����������������������������(��������������������� �%�� �������� �
! �� ������ ������ �������������������������������������� �������! ������������
�
������� �����������!" ���������
���������������� ����������������������������������������� ��������������������������
��� ! �������� ��� ! ��������� ��� ������ ! γ ����������������� �������� ��� γ
���������������������������)'���.���#�����������������������������������)��������
�������������������������������������.�������� ��������������������'�������������
��������� ��� ����� )' ��� � �� ����� �--,&� !��� � �� ����� �++�.�� � ���� ���������� �� � �����
����� �� ��� ����� ��� ������ ��� ����� � ������� �� ����� �� ��� ������ ���� ��������� ���
��������� ����� ��� ������� ��� ���� ����� � '���������� ��� ���� ����� �� �
� ��� ����� ����� ����� � ���� ���� ���� ���� ��� �� ���� ������ ��� ���� γ ��������
������)2��8����-4-�.����
�
����� � �� ���������
�� ��������������� �������
��� �����
���
����
����� ��� �� ������������
�������
�
$�! ��������� ��������%���&� ����!" ������������������������
�
�
� ��,�
6�������� ������� ��� ����� ��� ����� �� �� ���������� ����� /63� �������
����������� ����� ����������&� �� ����� � ����� ��� �������� �� ������ ���� ���
#����1�����#��� ������������������������������������� ������� ���������������������
��� ����� ��� �� ����� � ������ �������� ���� ��!�∆� ������ ��� � ��������� ����� �
��������� ��������� ��������� ��������� ��������� ��� ��� ������!�∆�������� �#�����
������ �������� �������������������� ��� ������ ��������
� ��4�
���"��������"�!�%�����'��� �"��!���������������"���""� ��"�������"������� ������
���� !" ��������� ���� �������� !����� ��� ()�� ������ � %%"�������� &���� *� µµµµ+�
!" ��������� ����� �� ������ ��� ���������� ����������� �#���� ����� ��� ��� �� �����
� �����(������������������������� ��� ��������9���� ���������� ���������� ����
���� ����� ���������� � �������� ��� ������� �� �� ���� ��� ���� ��� � ����� ���� ��
������������
� ,����
��"������
��!�
%�����-�.�
)� �"��!������
-��/�().�
0)1**���������
������23��
-��/�().�
," ������������� �������� ��!�� �� �����±�+���� ��91�±�+����� ��!�� 1� 1�,��±�+��,� ��-9�±�+�+9�
� � � � �
�
�
��� ��������� ���� ��������� ��� ������ � ����������� ��� �������� ���� �������∆�
������ ������������� ��� ����7!3����� � ����� � ����� ��� �� ����� �������������
*����������������5��� ��1������������������������������� ������ �������������������
� ������������������� �������������� ��������������� ������� ������������������
���������� ���������������������������������∆���������������#����������������
���������������������������������������������������������� ������������������������
�� ���� ���� � � ����� ���������&� ������ ���� ������ ��� ����������� ��� � ����� ������ ���
�������� ����������� � �� ��� ��� �%�� ��� �� � ���� ���� ��� ��� ��������� ��������������
������� ��� ������� � ��� ��� ����� ������ ���� ����������� ����� ���� ���� � ��������� ���
��������� � ��� ��������� �� ���� ���� � �� ����� ����������� )!��� � �� ����� �++�.���
������ �� ���� ��� ������ � ������ ��� ����������� ��� ����� � (����� �� ���� ����
������������ ������������������������ �����������∆�������)5��� ��1��.����������
���� ��� ����� ��� ����������� ��� ������������������ ��� ��� ��� �� ���� � ���(� �� � !
�� �������
�
� ��9�
�4� ���� ���������"� ��# �������� ��� ��������� ��� ���� ���� ����
���� �������������� ����������!" ����������
2�� ��������������(����������� ����������������������� �! ���������� �������������� �
�� ����� ������� ������ ���� �������� ��� ! ��������� ����� ������ �������� ����
������� ���� ���������� ���� ! ��������� ���������� ��� ����� � ����� �� ��� ����
��������� �%�� ������ �� � ! �� ����� �:����� ���� ����∆� ������ ������� � ��� �� ����
�� ��������� ���� ����∆� ������ ���� ����� � #���� ��� ��� ���� ��� ���� ����������� ���
������������������������∆��������� ��� ����������������������! �� �����������������
�������������������∆���������#�����������������������������������������������
������������� �����������∆��������������������������������������������! �� ����
��������� ������ �������������
� ��-�
�
�
�
�
�
�
�
����
����
� � �
���� ���
������ ����µ�������������
��
$�! ��� 4� �������������� ��� !" ��������� -µµµµ��"5�*3� ��""�.� ��� ���� &�"��� %�� ����
��� ∆∆∆∆�� �������""�� ������������������������������������������ ����� ��������
#������� ������ ���;<�4���)����������∆�������)������� �� �����������������#�������
������ ���;<�4���)����������∆�������)������� ��� �����������������#������� ������
��� � �� ���� ������ ���������� � �������� ��� ������� ��������� �� ���� �� ��� ��� ����
������� �������������������)µ���=�+9������.���������� ��������������
�
�
�
�
� �1+�
4����� �����������%���%��"�%����
7����������� ������������������������� ���� ����������� ���������� ��������������
����� �� �� ���� ���� ��� ����� �� ������ ��� ���������� ���� ��������� ��� ���� ���
�������)>����� ��������--�.���#�� �� �����8� �����������������������������������
���� ����� ����������������� )73.�� �������������������� )7?.��
������������������)7�.���������������� ����)7/.&�������������� ������� ����
���� ������� �������������� ��� )7'.� ��� � �������� )3!.� )3 ��� ��� ��� ���
�-9-.�� � 73�� 7?�� 7�� ��� 7/� �� ��������$��� �� ���� ��� ���� ���������� ���������
)?*.��������������������7?������������$������������������� ��)������*����� �������
�--1.����
� 7/��7?�����73���������������$���� �����������������)7".��������367
6'� ��������� 1@ �������� ���������� ��� ������ ������ 7?� ��� 73� ��� ���� ���
��������$����������>�������)367 �����������367 ����������.������)3 ���
��� A�����$�� �--,&� 7������ �--�.�� � /������ ���� �8� � ���������� 73� ��� ���
�� ����� � ���7"����367 6'� ��� ���� �� ��� � �������������������� ���7"�
��������73�������������� ��������������� ���� �367 �������������)"�(������� ��
������-9+�.���7����������� ������������)3���.���� �������������������������� ����
����� �� ����� ! �� ����� ������������ ��� �������� )3 ��� ��� ��� ��� �-9-.���
0������ ���������� ��� 7/� �������� )"�(������ � �� ����� �-9+�.� ��� 7/� ��� ��������
)# ���� � ��� B���(� �� �--1.� ��� ���� ��������$�� 73� ��� ����� �� ����������� �����
������������ �������� �� ���� �������� ��� ���� �������� ��� ��������� )>������ � �� �����
�-99.���?��������������������� ������������������$��7?����73��������>�������
�����)3 ��������� ����-9-.���?������������������������������������������
��� ��������� ���� >������� ����� ���� ������� ��� ���� ���������� ��� 73�� ���� ��������
� �1��
�%�� ��� ��� �� ����� � ��� ���� �� ���� � ��� 73� ������������ ��� ���� 367 6'� �����
)0�'���� ��������--�&�0�0��� ����;������--�.����
� #��� ����������� ��� 7/� �������� �������� ��� 73� ��� 7�� ��� ��� �%�� ��� ���
���������� ���� �� ��� ��� ���� ���� ���� � ��� ��� ���������� � ���� ����������� ���
������������ ���������������������������������� ���������������&������� �� ����
�� ����� �������������� �������������� ������ ��� �����������5� ��������
�� ��� ���� ��� 7�� ����� ���� ��� � ��� ���� ��� 7/�� �"�(������ � � ����� )"�(������ � �� �����
�-9+.������������������� ���������� ��������� � ��� �����������! �� ���������
7/�������� ������7?��� ��� ��� ������73�������� ����� �����������������������������
7/������������73������� ��������7/�������������������������������� ����������
���� ���)>����� ��������--�.���0�������������������7/�������������������������$��
������� � � ����� ��� 7/� ������� ����� �� ����������� ����� ����� ������� ��� ! �� ����
)"�(������ � �� ����� �-9+&� "�(������ � �� ����� �-9+�&� C�(�� ��� <������� �-9�.���
2��� ������ ������ ������� �%�� �� ������������ ���������� �� �������� ���
������������� ����������� �� �����)"�(������� ��������-9+&�"�(������� ��������-9+�&�
C�(�����<��������-9�.����
�
4����"��������"�������6����� �%���&� ��
��� ������ �������� ��� ������ 73� ��� 7?� ��� ���� >������� ����� �������� ����
��������������� �� ���� )"�(������ � �� ����� �-9+�&�7����� ���>��������� �--�.�� ����
�!"�∆�����������������������������7/������������� ����������������������������
7/� � �������� )"�(������ � �� ����� �-9+.�� � #���� 1��� ������ ������� ��� ���� � �����
(�������� ��� �!"�� ������ ������ ���� � � ����� ��� �� ����� ����������� �������������
#����!"�∆�������� �����(������ �������/63���������������������������������
����� ���������� �! �� ����� ������� ���������������� �������!"�∆������������ ���
� �1��
�� �������� ��� ���� ������� ��� ��������� ����� ������� �� �� �������� � :�� ��� ����
����������! �� ���������� ����������������������! �� ���������������������!"�∆�
������� ������������� � �� �������� ��� ��� �������� ���������������������
�����������
�
���"�� �� �������� ���� ���������� !��&��� 7�������� ��� ���� ��"������ ��� ���"����
� 8����%����� ��������()��������&����� %%"�����������������"���'�������������
������9���23��� ��� �#���� ��� ��� ������ ������ �����(������������!"�∆�������
��� ��� ��������9���� ���������� ���������� ���������������������� �����������
������������ �������������� ���������� ��������������
�
+��� �� ��!�%�����-�.� )� �"��!������
-��±±±±�().�$���"�0)1**���������
������23�
�
���������� � � �
/63�D�3�������� �� ��91�±�+���� �����±�+����
/63�D�/� ���� �� ��+1�±�+��,� ���1�±�+����
/63�D�/� ����D3�������� �� ��9-�±�+���� ��41�±�+����
� � � �
������������� � � �
/63�D�3�������� ��� ���+�±�+��4� +�4�±�+�+1�
/63�D�/� ���� 9� ��9-±�+���� ��1��±�+��4�
/63�D�/� ����D3�������� �� �����±�+�+9� �����±�+����
� � � �
�
� ?�� ������� �� �� �� ��� � � ���� ���� ���� � �� ����� ����������� ����� ����
���� ���� �������∆��������� �� ���������� �����/63�������� ����������������
��������)#����1��.�� �#�����������������������������/63���������������� ����������
����∆�������������� ������ ��������������������������������������������������� �
�� ����� � ������ � #��� ��� ������ ��� ���� ���� ���� ��� ����������� �����������
�����! �� ������� �����!"�∆������� ���������� ����! �� ���� ��� ����� ����������������
������������ ������ ��� ������ ������������� ��������������������������!"�∆�
��������������������������$����������������������������������������������������
� �1��
��������� ���������������������� ��� ��������������������������������������!
�� ������������
� �
���"��4��������������"�����������"�!�%�������������"��%����"������� �������������
����&�"��� %��������� ∆∆∆∆�� ����� �����23��� ����������������������������#����
��� ��������� ������ �����(������������������ �����������∆���������� ��� ����
��� �9� ��� ��� ���� ��� ������ ��� � ���� ���� ��� ���������� � �������� ��� �������
��������� ������� ������������� ���������� ���������������
�
+��� �� ��!�%�����
-�.�
)� �"��!������
-��/�().�
$���"�0)1**���������
������23��-��/�().�
��:�"��� %���;2<24� � � �
/6� �� ��9,�E�+�+9� �����E�+�+-�
/63� 1� ����E�+���� ���9�E�+�+9�
/63�D��������� �� ��94�E�+�+1� ��94�E�+�+��
/33�D��������� �� ���-�E�+�+-� ��1�E�+��1�
� � � �
����� ∆�� ����� � � �
/6� �� �� ��
/63� ��� ��+��E�+�+9� ����E�+�+1�
/63�D��������� ��� ��1�E�+��,� ��9�E�+�+,�
/33�D��������� ��� 9�E�+��1� ����E�+�+��
� � � �
�
� #��� ������ ��� ����� �*C"� ��� ������ ��� ��� ���� ��� ������� ��� �������
�� �������)!��� ��������++,.�����������������������(������������� ��� ��� ��������
� ������������ ���������� ���� �%�� ��� �� ��� ���� ��� ���� �������� ��� ���� �����
� ��� ���� ��� ����� ���� ���� ������������ ��� ��� ����� ��� ���� ���� ��� ��� �����
�� ������� )3���� ���3 ���� �++4.�� � ����� � ��� ��� ��� ��� ���� ��� ���� ���� ��
�*C"� ����� ������ ��� ��� ��� ������ ���� � ����(� ��� ����>������� ����� �� �
���������� ���������� ��� ���� ���������� �� � ���� ��������� ��� 7/� �������� ���
�*C"����������)3�������3 �����++4.����
�
�
� �1��
4������%����� "�������� ���������
7���������� ����������� � ���� � �������� ��������� ��� � ����� �������������
" ��������� 9F���� ��������� ��� ����������� �� 7/�� �"�(������� � ����� ����
�����������!"�∆�������� ���������������7/����������� ��������������� ������ ���
�����������������������������������������)"�(������� ��������-9+&�"�(������� ��
����� �-9+�.�� � ���� ���������� ����� � ��( ������ � ������� ��� ���� ���� 7/� ��������
��������� � ������� 7/� ��� ��������$��� ��� �������� ������� �������� 7?� ��� � ��� !
�� ����)>��� ���-9+.����
� 3������ ��� ���������� ����������� ��� ������ ��� � � � ���� ��� ���� ��� ��
���������� ���� ������ ��� �� ����� ����������� �� �� ������� ��� ���� ��� �
�� ����� ���)#!3.������� �� ���������������������� ��������������������������
����� ���� ���� ������ ��� ����∆� ������ ������ �� �� ���������� ����� /63� �������
�������� �������� ��� ! �� ����� � #���� ������ � ��� ��� ����� �������� �� ��� ��� �#!3�
���� ����� ������� ��������73��7?����7/�)5��� ��1��"����;.���6��� ��������
�������� ����������������73��7?����7/����� �� ���������� ������������� ��
73��7?����7/�������������������������
� 5��� �� 1��"� ������ ���� ���� ��� ����� ����������� � ��� �������� ���� �������
���5��� ��1��;����� �����������∆�������������� �#������������������������������
����������� ������ ����������������� ��������0�� �������0���������#�� ��� ���
������� ������������� �������� ������� ����������������� ������������������
#��������������������������� �73��7?����7/������������ ������������ ��%���������� �
��� ��������� ������ ����������������∆�������� �#����� �������������������������
������ ��� ! �� ���� ��� ���� �� � ���� ���������� ��� ������������ ������ ��� �� ��� ���
����������� ����� ����� �������� ���� ���� ���� ������ ��� ����∆� ������� ������ ��� ����
������ ��� ������������ ��� ������� ��� ! �� ���� ��� ������� �� � ���� ���������� ���
� �11�
����������� ���� ���� ���� ������ ������ �� ���� ��� ��������$�� ���� � ���� ! �� ����
��������������������������� ������������� ����������������∆����������������
�����������������$��! �� �������� ��� �����������
� 0� ���� �� �� ��������� �%�� ������ �� � ���������� ���������� �� ���� ����
������� ����� �������� �������(���� ������ ���� ��������� �������������� ���� ��� ����
�!"�∆����������������������������������� ��� ���������������)#����1��.���#���
��������������������������� ����������������������������∆�������)#����1��.����
� �1,�
��:�"��� %�� � �
�
�����������������������+�����������������������������������������������������������������������������1��������������,���
����� ∆∆∆∆�� �����
�
���������������������+�����������������������������������������������������������������������������1���������������,���
�
$�! ���2��#������ ����������������� ����������� ������������� ������ �������
�#!3����� �������#������ ����������������� �����������∆���������������#���
���� �������������73��7?����7/� ����������� ��� �����)���.���
� �14�
2�(%���������# �������������������������%�������� ��������
��� � �� � ��� ������ ���� ����� �� � ��������� ! �� ���� ��� �� ����� ������� �����������
���������� ! �� ���� ��� ����� ��� � �(� ��� �� ��� ��� ���� � ���� ����� ������ �� ��
������������� ��������� �#��� ������ �������� �������� ���������������� ��������
�����������������(���� ���������! �� ����� ��������������������� � �����������
������ � ���������#������� ���������� �� �������������������� ������������ ���
��������� ����������� ������������ ���������������#3"�������� ��������������� �
�������������� ��� �������������#������������� �������������������������������
����#3"� ������������ �������������� �����������∆������������� �������� ����
���5��� ��1�1���#��� �������������������� ! �� ��������(������ �����������������
�������� ������������ ��� �������������������∆����������������� ���������������
��� ���� ����� ��� ���� ����� ��� ���� � ���� ����� #3" ��������� ��� ����
����������������� ���������
� �19�
�
�
�
�
��
��
���
���
���
� � ���� ��
��� �������� ����
�
�
$�! ����4���������������������� �������������%����%����"���������"����&�"��
� %��������� ∆∆∆∆�� �������""������������������������������������������
*��������� ������� ����� ! �� ���� � ��� ���� �������� � ������� � ��� �������� ���� �� ���
;<�4���)����������∆�������)��������������������������������� ����������� ������ ���
;<�4��� )��� ��� ����∆� ������ )���� � #���� ��� ������ ��� � ���� ���� ������ ����������
� �������� ��� ������� ��������� �� ���� �� ��� ��� ������ ! �� ���� ������� ��� 0;%� �����
���� ��������������
� �1-�
� #��� ����� � ������� ����� ! �� ���� ������ ��� ���� �������� ��������� ����
�� ����������������������(�����! �� ����� ����� �� �������� ���������������������
� ������� ������� ! �� ���� ��� ���� � ����� ���� ������ ��� ���� ���� ���� ��� ����∆�
������ �� �� � ���� ��� � ��� � ����� ��� � ������ ��� �� ����� � ��� � ����� ���
�� ����������������������� ������������ ! �� ����)4����0�����4+�;%=��.��������
���� � ����� ����� � ����� ����� � ������� ��� ����� ���� ������� � 5���� �8� � ������ �
� ��������� ����������� ���������� ������������ ������������0�� �������0���������
#����� ��������G� ����� ���� ������� )3:.&� ���� ������ ��� � �1�+++� �� �� ���� ���������
)7�1(.� ������ ��������� ��������� ��� ���� ���� ���� �������� ?*� ���
� ��������&�������� �������� ��++�+++��������� ���������)/�++(.����������������
���� �������� ������ � ��� ������ � �������� �������� ���������� ������� ���
������� � ��� �� ���� ��� ������&� ���� ������� ������ ��� � �++�+++� �� ��
���� ��������� )7�++(.������� ���������'������ ���������� ������������� ��� ���
� ��� �� ��������&� ��� ���� ����� ����������� � 5��� ��� 1�,"� ��� ;� �����������
������ ��������� ����������� � ���������������� ������� ���������1���� ��������
��� ��� ��������� ��� ������������������� ����������� ���������∆����������������
�
2�������������# �������������� ���""����%�������
#��� �����������(� �������� ���������� ��� ��1�+++����� ���� ��������� )7�1(.�������
���������������������� ����������� ������������?*�� �� �����������������
��������������������! �� ���� �%�� ���������� �����������#��������������������� ��
�������� ��� ����� � � ����� � � �� ����� ������ ����� ��� ��� ���� 1� ��� ��� ��� �
������� �������� ���� ��� ��������∆������� ������ ��� ����� � ������� )5��� ���1�,"�
���;.��������� ��������������������������������������������� � �������� ��������
������������������������� ������������ ����������� ���������� ��������������
� �,+�
#��� ��� ����� ���������� ��� � �++�+++� �� �� ���� ��������� )/�++(.� ������
������������������� ������� ���������� ��������������������������� �������� �
������� � ��� �� ���� ��� �������� � #����� �� �� ���� ���� ��������� �� � ������
��� �����������! �� ����������� �#������ ������ �������� �������� �������� ����
��� ����∆� ������ ��� ��� ����� ������� ��� ���� � ����� ��� � ��� ��� �� ���� �����
� ������������������ ����������������! �� �������
#��� ��� ��� ��� ���� ������� ������ ���������� ��� � �++�+++� �� �� ���� ���������
)7�++(.� ������ �������� ������ ���������� ���� ���� ������� ��� '������ ���������
���� ���� ��� � ��� �� ������������� ���� ���� ���� ���(� �� � ���� ��������� ! �� ����
�%�� ������ �� ���� �� ��������� � #��� ������� ��� ���� � ����� ��������� � ��� �����
� �������� ���� �� ��������� ��������������� �� ����������� ��� �������� �������
��������∆������������� ��������������
�
2����������������%�������������%���%��"�%����
5��� ��1�,������� ��������� ���������� ���������! �� ���������������� ������������
��� ���� � ���� ��� ���� ��� ���� ������������ 7?�� 73� ��� 7/�� � #������� ���� ������
������������������������������73�������������������� ���������� �����������73����
7/����� �� ����������������� ������� ������������������� ����������� ���� ��������
�� ����� ������������ ���� ������� ��� ! �� ���� ���� � ���� ��� 7?� ��� 7/� ��� ������
��� ��� 73� ������� ��� �������� �� ��� ��� ��� �2�� ���� ���� � ����� ���� � ������� ���
! �� ���� ��������� ��� 7?�� 73� ��� 7/� ����������� ��� ���� ����∆� ������ ������ ���
��� �������� ������� ��� ��� ����������7/� ��� ����� �������� ��� � ������ ������ �����
��� ������ ������� � �� ����� ������������ ����7?� �������� ����� ���� ����������73�
������������ ��������7/� ��������������������� ��������������������� �� ��������
���� � � ����� ������������ �1F� ��� ���� ����� ����������� �� 73� ��� �+F� �� 7?&�
� �,��
������ 1+F� �� �� 73� ��� �+F� �� �� 7?� ���� � �� ����� ����������� )H������ � �� �����
�-,9.���2� ���������� ������� ���� ���������������� ��������������73������������
��� ���� ����� ������ ��� ���� ���� ������ ��� 73� ��� ����� ����� ������ �� �� �������� ���
�� ��������� ������� �� ���� ������������ �����7?������ ���������������������� ���
��������� ���� )H������ � ��������-,9.������� � ������ �������� ����� � ���������7?� ���
����� � ������������ �2�� ���� �� � ������� ���� ���� ����� ����8� � ����� ������ ��������
� ����� ����� ����������� ��� �������������� �������� ����������� ���� ����� ����� ������
��������������������������������! �� ������������� ���������������������������������
���������� ����������� ���� ���������� �������������������
�
� �,��
�
��
�
�
�
�
�
�
�
�
��
�
�
�
�
�
�
�
�
$�! ���1����������������"���� ��������""� �����%�������&����4��"���"�������������������
��=���%���%��"�%��������&�"��� %���;2<24�������� ∆∆∆∆�� ��������������2��� ��� �����
�������� ���� ���������� ����������� � 7� ����� ��� ����� ������ ��� ����� ���� � ������������
�������! �� ���� ��� �������8� ������������7?��73����7/�� ���7� ������������������!
�� ���� �� � ���� ��� ���� ������ � � ������� ��� ����� ������ ��� ����� ���� � ���� ��� ���� ����
;<�4���� ��� ����∆�������� �#���� ��� ��������� � ���� ���� ��� ���������� � �������� ���
���������������� ������� ����������� ����������� � �������������� ��������������
�
�
�
�
�
�
���� ��!�"� � ��� ��!�"� ���� ��!���� � ��� ��!����
#����� �!����$�� ���!�%!$���$����$�&�!�'�
#( #� #)
�
�
�
�
�
���� ��!�"� � ��� ��!�"� ���� ��!���� � ��� ��!����
#����� �!����$�� ���!�%!$���$����$�&�!�'�
� �,��
24���������������# ����������������� �������������""�&�""�%���������
#���������5��� ��1�4"����� ���������� (������ ��� � �� ��������! �� �������
���� � ���� ����� ���� ��������� � ��������� �������� ������ ���� �� ����������������
)�+F���1������1+F��������.���� ������� ����������������)�+F���1�������+F���
����.���#������ �������(�����! �� �������� ��� ���������������������������������
��������� �%�� ������ �� � ! �� ���� ��� ������� �� � ����� ���� �������������� � I��� �
�� ��������� �� � ��������∆�������������� ��������� ��� ������ �! �� �������������� ���
��������� ���� ������� ��� ����� �� �� � (��� ����� 41F� ��� ���� ����� ����� ������
���� � ���� ��������������� ���������� ���������� ����� ��������)������F�� �������.�
)5��� ��1�4;.���#����������������������������� ��������������������������! �� ����
�������������������� ����� ����������������� ��� ������ �%�� ����� � �����������������
���������������� ���������������� ���������
�
�
�
�
�
�
�
�
�
�
�
�
� �
� �,��
� ��
�
�
�
�
�
�
�
� ��
�
�
�
�
�
�
�
�
$�! ���<����������������"���� ��������""������%�������&����4��"���"��������������������
��� ���� ��"" "��� ���������� ���� &�"��� %�� �;2<24� ���� ��� ∆∆∆∆� � ����� ��� � ���� �2� �� ���
���������������������������������������#��������� �� ������� ����������� �������)�:.��
�������� ��� � �1�+++� �� �� ���� )��7.�� ��� ����� ��� � �++�+++� �� �� ���� )(�**7.��
����������� ��++�+++���������)��**7.�������������������)"�%���.�� ����������� ���������
7� ����� ������ ������� ! �� ���� �� � ���� ��� ���� ������ � � ������� ��� ����� ������ ��� �����
���� � ���� ������� ����;<�4������ ����∆�������� �#���� ��� ��������� � ���� ���� ���
����������� ����������� ���������������� ������� ����������� ����������� � ����������
���� ��������������
�
��
��
��
��
���� ��!�"� � ��� ��!�"� ���� ��!���� � ��� ��!����#����� �!����$�� ���!���!%� �����!�'�
�* #�"+ )���+ #���+ ��$�&�
�
��
��
��
��
���� ��!�"� � ��� ��!�"� ���� ��!���� � ��� ��!����#����� �!����$�� ���!���!%� �����!�'�
� �,1�
����� �������������""�&�""������%����������# ���������!����� ������
�����������
2�������� ��� ����������������� �� �! �� ���� ������ � ��� ������������� ������ ���� ��
���������� �%�� ����� ��� ������ �����)>����� ��������---&�!��� ��������++1&�!��� ��
������++,&��� �!������ ��������---.���#�������������� �������������������� �������
������������#$����#�%�����&'��%�� )"� ���� � �� ����� �++�&�"� ���� � �� �����
�++��&� 3����� � �� ����� �++�.�� ����� � ����������� ��� J�1 �+F� ��� ���� ����� ����
��������������! �� ����)#����1��.���#������������������� �������������������������
����������� �������� �� 3��� ��� 3��� ������ �� ������������ � ��������
)"� ����� ��������++��&������ �B ��� ��������--1.����������� ��#� � ���6�� ��
���#���)"� ����� ��������++�&�"� ����� ��������++��&�>���(��� ��������--4&�
>����� ��������++�&�>�����������������--�.� ������������� ��� ������ �����������
���� ��������� ��������� ������ � ��� �� �������� )"� ���� � �� ����� �++��&��� ���
��� ������� �++�� .�� � 3����� ��� ������ ���� ����� ���� ������� ��� ���� $'(� ��������
������ �� ����� ���� ������ �� �� �������� ��� �� ����� ������������ 6�� ��� #� � ���
#��� 8���� 3��� ��� 3��� ��� ���� ����� ����� ������ 3��� ��� 3��� �� ����
����������� ��� ������ �����)"� ����� ��������++��.�� �#������� ��������������
������ �� ������� ��� ���� ��� ������������ ����� ������� )#�������.����������� ����������
�#�%� ��#$�����&'�������������������������������� ��������������� ��������)���
' ����� ��������++4&��� �!������ ��������---.���"� ����� �����������������#� ��#���
�#� �&'��%�� ����������� ����������� ���������������������������#������#��
�� ��������� �� � �� ����� � ������ ������ �� �#�� ��� �������� ��� �� ��������
)"� ����� ��������++�.����
� 3���� ������ ������������� ������� ������ ��� � ����� ���������� �� (�����
���� �! �� ������������ )�� ����9�1F.�)/���#����1��� �� � ����3������3��.���
� �,,�
/����� ����� ��� ���� �� ��� ���� ���� ������� �� �������� ���� ��� ������ �� �� ��
�� ������ �����)"� ����� ��������++��&�>����� ��������++�&�!��� ��������++1.���� ��
���������� ��������������������������������������������)!�(�����2�������--9.�
��� ����������� ������� ���������� �%�� ������ �� �! �� ����� ������� �� �����������
��������������� ���������� ���������������� �! �� ���������������������8�����������
����������� ���� �� ���� ����� ������ �������� ���� ����� �����%����� ����������
���������������������������������� ����������
�
���"��2�> ��������������%����������9�"���" ��� ����������������������""�&�""�
�
(�����
��?%�����
%�������
����" �
0�� ��0�� @�����
������
�� "�
����� ���
+�"�� "��5
��""�
(������
����� ���
(������5�
��""��
A����
(������
������
��
#��� � √� ��+� �1�,++� 1,� ��--��,++� �����
#� �� � √� �1�� ,��� ,�� �-���-� ���9�
#� �� � √� �1�� �++� ,�� �9�,++� �1���
#� �� � √� ��+� � �-� � �-�
#� �� � √� �94� � ��-� � �+�,�
6��� � √� �-9� 41�� ,+� �1���+� �+�1�
6��� � √� ���� 4-� 9� ,��� ,�1�
6��� � √� ��+� 4-� �+� 4-+� 9���
6��� � √� ��,�� � �,�� � ���,�
3��� √� √� ��-� ,4�+++� 1�� ����4�+++� �����
3��� √� √� -�� ��1-+�+++� �+� �1�-++�+++� �+�-�
3����� √� √� ���� �19�+++� ��� ������+++� �+�1�
� � � � � � � �
0��B��������'���0��B����������'�@��B�@ �����
� �,4�
� <���� ��������� ��������������� ��� ������� ��������� �� ��� �� ��� ��� ���
��������� �������� ��� � ����������������� � 2��� ��� ���� �������� ������� ������
β)�→�.������� ��� ���� �8� � �� ���� �� ��������� ��� ���� ����� ����� � "����� �
β)�→,.��������� ������������� �)3����� ��������++�.���#������he roles of cell wall
mannoproteins include ����������� ��������������� � ��������������������� �������
��������������� �������� ��������)���' ����� ��������++1.���3�����������������������
�� ������� ������ �������������������������� ������%�����������������)3����� ��
������++�.����
���� �� � ������� ������������ ������������ ������������� ���� ���������� � ���
� ����� ��� �� ����� ������������ ����� ����� �� �� � ��� � ��� � ����� ������ ���
�� ����� ������ ��� ���� ���� ���� ��� ����∆� ������ �� ������ �� ���� ��� � �����
����� )/63� �������� /63� ������� ����� ! �� ���� ����������.� ���� � �� �����
����������� ��� ���� � ����������� ������� ������� ���� ���� ��� � #���� ��� ������
��� � ���� ���� ��� ������ ����������0��*��� ��� )�++9�� ;0/5��IC/:.��������
������������ � �����������!3 0/������������������������������������������� ��������
� �� ���� ��� <��� � � ���� )<��� � �� ����� �++1.�� ���� ���� ����� ��� � (��� ����� ������
�������� ���� � ����� ��� �� ����� ����� ��� ���� ���� ���� ������� ��� ����� ��� ����
���� ������� ��������� �� � �� ����� � ����� ��� ���������� � ������ �� �� ��� �
���������� ��� ���� �����������"�C� ������ ���� ��� ���� �������������� ��� #� �� ���
#����������������������������� ������������������������� ���������������∆�
������������� ����������! �� �������
#���� 1�,� ������ ���� ������� ��������� ������ �� �� ����� � ��� ����� ����
��������������� ������� �������������������� ������������������������ ����������
���� ����� ���� ������ ������� � "� ����� ������� ��� ���� ��� ��� ��� ���� "������ ��������
)"������#�����.���"������ ������� ���������������� ���������������#��������
� �,9�
��������������� ������������ ��������������� ���������������)���,F.����� �������
�����������������������∆���������+���� �������� ���� ������)5��� ��1�9����#����
1�1.�� ������ �� ��� ����� ������� ��� �#�� ������ �� �� ��������� ����� ���� ����∆�
������ ������ ��� ������ ���� ������ �� ���� )�,�4F� �� �9� �.� � ������ ����������
�������� ������������������! �� ������� ������)�9F�������.���#���� ���������������
��������������������� �! �� ��������� ������������� ������������������������������
���� �������� ������ ���� ��� ������ � ������ ��� ! �� ���� ��� ���� ���� ���� ������ ���
������������� ������������������������������� �������������������;�������������������
����� ���� �� ��������������� �����������$�� �������������� �%�� ������ �� �! �� �����
��� ��� �������������������������������������������8������������������ �����������
������������������������ ���������������� ������������������ ��������������
����������������! �� �������
�
� �,-�
�
�
�
�
�
�
��
��
��
�����
���� !�
�����
����
�"�
���"
�����
!�
���"
�����
�"�
���"
�����
"#�
���"
�����
�"�
���� ��
�����
#����� �!�%!����!$�$��&�!%��&!�'�
�
$�! ���3���������!����������%�%������� ������&�"��� %����""��������� ∆∆∆∆�� �����
��""�����*'��2�����23��� ��� ���������������������������������������7� ����������
�#��������������������� �����������������∆����������������/63����������+����
������ ��9����� ����/63�������������! �� �������������������������
� �4+�
���"���+����(%��������� ����" ���������""�&�""�%�%�������� ������&�"��� %��
������� ∆∆∆∆�� ��������9���� �������%������ �����������������C���
�
��������� @ ��������������-A������""�&�""�%�%������� ��.�
� &�"��� %�� ��� ∆∆∆∆��� *�� �2�� *�� �2�� 23�� �2�-���.CC�
��&�2%� �1�),�4.� �+�)1�9.� ��)+�4.� ��)���.� ��)���.� ��)��+.��
���4%� 9�)��,.� ���)9��.� 4�)1�+.� ��)���.� ��)�+�+.� ��)9�+.�
����%� ���)1��.� 9�)��4.� 4�)1�+.� ��)���.� ��),�4.� ��)9�+.�
����%� 1�)���.� ��)+�,.� ��)���.� ��)���.� +� +�
�&%�%� �,�)4��.� 9�)��4.� 9�)1�4.� 4�)4�,.� 1�)�,�4.� 1�)�+�+.�
���44%� -�)��+.� ���)4�+.� ��)��9.� ��)���.� ��),�4.� ��),�+.�
,���%� ���)1��.� ,�)��1.� ��)��9.� ��)���.� ��)���.� ��)��+.�
,��4%� -�)��+.� ��)���.� �+�)4��.� 4�)4�,.� +� ��)��+.�
,��%� ���)��-.� 4�)���.� ��)��9.� ��)���.� ��)���.� ��)��+.�
,"��%� �4�)����.� 4�)���.� �1�)�+�,.� 9�)9�4.� +� +�
,"��%� +� �4�)-�-.� �1�)�+�,.� +� +� +�
����%� ���)1��.� ���)���+.� �4�)����.� ���)���+.� +� 4�)���+.�
����%� +� +� +� +� +� +�
���4%� 1�)���.� +� +� +� +� +�
����%� -�)��+.� ��)+��.� ��)��9.� 1� +� ��)��+.�
����%� -�)��+.� 1�)+��.� 4�)1�+.� ,�),�1.� +� ��)��+.�
���2%� ,�)��4.� ��)+��.� ��)���.� ��)���.� +� +�
�� 4%� ��)��9.� ��)+��.� ��)���.� +� +� +�
?���%� ���)�9�9.� -�)1��.� �+�)����.� �,�)�4��.� +� +�
(�&2%� 1�)���.� +� 1�)��1.� ��)���.� +� +�
��%�� ��)+��.� ��)���.� ��)���.� ��)���.� ��),�4.� ��)��+.�
����%� ��)+�+.� �+�)���,.� ��)+�4.� +� 1�)�,�4.� -�)�9�+.�
����%� +� +� +� +� ��)����.� ��)��+.�
���4%� +� +� +� +� ��)���.� ��)��+.�
����%� ��)+��.� +� +� ��)���.� +� +�
;!%�%� ��)+��.� 4�)���.� ��)���.� ��)���.� ��)�+.� ��)9�+.�� � � � � � �
����"D� ��4� �<�� �2�� E�� 4*� *�K6���� ��������� �������)6.����0�������� �� �����������-�%%����8����"���.�
))����∆� ������ �� �� � ���� ������ ���� � �� �������� ����� ! �� ���� ����������� /63�
���������#������� ���������������������������� ����������*������� ������� �����������
����� ����������������������� ���������������������� ���������������
� �4��
1�)��� ������
#��� ������� ������������ ���� �� �������������� ���� ������������� �%�� �������� �
! �� ������ ���������������� ��������������������� � ��������������������������
���� ������� � #��� ����� ��� ���� ����∆� ������ ��������� ���� ���� ������ ���
���� ������������������������(����������������� ����������������� ���� �
������� ������� �� ��������� �������� ������������������ ���� �'���� ��������!
�� ���� �������������� ��� ��� � �� ��� � ��� C� 8�� � �� ����� )C� 8�� � �� �����
�++�.� ��� ���� ����∆� ������ ��� ������ ����� ��� ���� ������ ��������� ��� ! �� ����
������������� �� ���� � '���� ���������� � #����� ���� ������ ��(���� ����� ������
�%�� �� ����� �������� ��� ! �� ���� �� � �� ����� � ������ ������ ����� �� �� ������ ���
��������$�� ���� � ���� ��� ���� � ��� ������ � ���� ��� ! �� ���������� ��� ������� ������
C��� ����������������� �������������(���1+F��������! �� ���������������� �������
������� ��� ����� ������ �������� ���� ����� ������� ����� ������ ��������$�� ���� � ����
���������� ��� ������������������� �! �� ������ ���������������������������� ���
� �� � ��� ��� ��� ���� ���� ���� �������� � #��� ���� ������� ��� ���� ����� ����
����������� ������� ���� ���� �� ���� ��������� � ��������� ����� ������ ��� #� =#��
������ ��������� �� ������ ��� �������� ���� ��������� ����������� ��������������
���� ������ �� �� ��� ���� ��� ���������� ���� )��� � ����� ��� � ���� �� � ����
���� ������ �� �������.�� � "�� ���� ���� ������ ������ ����� ��� ������ ����� ! �� ����
������������ ���������������������������∆�������������)�������� �������� ��� ���
���.�������� ���������������������� ��������� ��������� �����������������������
��� ��9������������������������ ������2���������� �������������������∆���������
��� ����������������������������! �� ��������������������������������� �����
#� =#�� ������ ��� �� ����� �� ��������� ��� ���� ���� ���� �� ���� ���� ����� ��� �
��������������
� �4��
5 ����/�������;�������� ������������������������������ �� ������������
����� ������ ���� ����� ��� ���� ����� (�� ��� ����� ��������� ���� ���� ��� ����������
��������� ���������� ������ ����� ��������� ����� ������������� ��� �������������
������������������� ���������� �#������ ���� �������� ���� ��� �� ������ ���� ����
��� ���������������������! �� ������ ��������������� ����������������������3��������
������ ������������� � �� ��� �(�� �� ���� ��� � ���� � �������� ��������� ���� �
�� �������������������������! �� ������������������� ��������� �������� ���� ����
������� ���������������� ������������������������������������������� ��������
���������2�������������� ������ ���������������������� ���� ������ ��������������
�� ������������������ ���������������
�
1������"���9���� ��������������������%�����!���@����������������
���� ���������
"������ �������� ������������ )� �������� ����� ���������� �����.������� ��
����4+F�����������������I3I�� �I33�)�� ���������� �� ������*C"��������������
����������.�������� ��������I3"�)���*C"�.��I3'�)���*C".��"'3�� �"'I�)���*C".�
)7� ������ � �� ����� �--4.�� � /� ���� ������ ����� �� � ���� ���� ������ ������ ���
��� ����� ����� ���� ��� ��� �� ���� ������ ����� �� � ��� ������� ��� ������ ���� ���
"������5��� ����)"��;����3.���#���������������������������(�������������������� �
������� �� ������ ������ ��� ������� �������� ��� ���� �� ��������� �*C"��
)7� ������ � �� ����� �--4.�� � 2�� ���� ������ ��� ������ ��� �� �������� � �������� ��� ����
������������������ ���������������������������� ���������������� �����������������
������������� ���������� �����������*C"���������������� ����������������� ��
�� ���� ��� ! �� ����� ���� ������ ���� ��� ����� ���� ������� ��� ��� ������� �*C"�
� �4��
����������� �������! �� ������� ��� ���������� ��������������������������������� �
��������� ������ ����������
�
�
�
174
CHAPTER 6 DISCUSSION
During adaptation to anaerobiosis in S. cerevisiae, demand for L-serine is greatly
increased. This is probably to manufacture anaerobic cell wall mannoproteins, and
this requirement must be met not only from glycolytic intermediates via the pathway
requiring SER1, SER2 and SER3/33, but also from increased synthesis from L-
aspartate via L-threonine and glycine requiring GLY1. It has previously been noted
that SER1 is essential for anaerobic but not aerobic growth in rich medium (Reineret.
al., 2006). The reason why there is a shortfall in L-serine synthesis from glycolytic
intermediates may come from the demonstration that metabolites from the lower
section of the glycolytic pathway decrease quite dramatically with decreasing oxygen
in the medium; this includes 3-phosphoglycerate, which is the substrate for the SER1-
dependent pathway (Wiebe, 2008; Wiebeet. al., 2008).
Gcn4p clearly has a major role in cell physiology that has not previously been
documented and for which the gcn4 mutant exhibits a very strong phenotype that
has not been seen under anaerobic conditions. This general amino acid transcription
factor is required for rapid adaptation to anaerobiosis and it probably functions in this
respect through up-regulation of SHM2, GLY1 and other functions associated with
synthesis of L-serine and one-carbon metabolism such as the glycine-cleavage
reaction. The data also show that in minimal medium under anaerobic conditions the
Bas1p transcription factor is essential for growth. This requirement goes beyond its
involvement in the syntheses of purines (Denis and Daignan-Fornier, 1998), since the
bas1 mutant phenotype under anaerobic conditions was not alleviated by addition of
adenine. This requirement could however, be met by the addition of L-serine, hence
under anaerobiosis Bas1p has a major role in the syntheses of both L-serine and
purines.
175
This work has also demonstrated that the threonine aldolase (Gly1p) is
required for rapid adaptation to anaerobic conditions in the absence of L-serine, and
that GLY1 expression is markedly induced under the same conditions. The induction
of GLY1 was dependent on both Bas1p and Gcn4p, and the lack of GLY1 induction in
the bas1 and gcn4 strains may contribute to their respective anaerobic growth
defects. In addition, the lack of anaerobic induction of GLY1 in the gcn4 strains
might explain its accumulation of L-threonine, and both of these phenotypes were
relieved by L-serine supplementation. Evidence for regulation of GLY1 by Gcn4p
was also observed in transcriptomic analysis (Natarajanet. al., 2001). However, the
effect of Gcn4p and Bas1p on GLY1 expression is likely to be indirect, since the
GLY1 promoter region lacks a canonical Gcn4/Bas1p response element and was not
bound by either transcription factor in aerobic genome-wide location analyses
(Harbison, 2004; Mieczkowski, 2006; Mieczkowskiet. al., 2006).
The cell wall of the human pathogen Candida glabrata governs initial host-
pathogen interactions that underlie the establishment of fungal infections. Electron
microscopy has revealed a bilayered wall structure in which the outer layer is packed
with mannoproteins. Biochemical studies shows that C. glabrata walls incorporate
50% more protein than Saccharomyces cerevisiae walls (de Grootet. al., 2008).
Mass spectrometric analysis identified 23 cell wall proteins including 4 novel
adhesin-like proteins, Awp1/2/3/4p and Epa6p, which are involved in adherence to
human epithelia and biofilm formation (de Grootet. al., 2008).
Candida albicans is a common opportunistic pathogen of the human body.
Infections are associated with the formation of biofilms on host tissues. As a result of
the intrinsic resistance of C. albicans biofilms to most antifungal agents, new
therapeutic strategies are needed (Pierceet. al., 2009).
176
The cell wall is responsible for the specific shape of the cell. This function is
associated with specific molecules. The cell wall not only plays a significant role in
pathogenesis; it is also involved in the host-parasite relationship. The components of
cell wall can act as adhesive molecules mediating microbial attachment to the host
cells, thus initiating the infectious process and there is some evidence that the
mannans are responsible for the adherence to the tissues (Kanbeet. al., 1993). The
status of the cell surface hydrophobicity is linked to the distinctiveness of the cell
walls structure. The surface layer of the C. albicans cell walls contains fibril
structures which are made of mannoproteins (Cassoneet. al., 1978; Trinelet. al.,
1997). The ability of C. albicans to regulate cell surface hydrophobicity in fact
relates to an ability to alter the confirmation of the mannoprotein fibrils (Hazen and
Hazen, 1992). Hence, hydrophobic cells are more adherent to a variety of host tissues
and the pattern of adherence is more widespread (Hazen, 1989; Hazenet. al., 1991).
An intact cell wall is essential for the normal functioning of the fungus, thus
disrupting the wall or interfering with the biosynthetic pathways of some of its
components can be detrimental to the pathogens (Segal, 1994). While S. cerevisiae
has about 20 cell wall genes, some fungal pathogens have more serine-rich proteins
that show homology to TIR3 from S. cerevisiae. For example, analysis of the genomic
sequence of Candida albicans identified many more genes that encode serine-rich
proteins. Many of these genes are annotated as cell wall proteins that are induced by
stress or antibiotics, or they are involved in cell adhesion or pathogenicity (Chaffinet.
al., 1998; Garcia-Sanchezet. al., 2004; Li and Palecek, 2003). Infection with C.
albicans is normally treated by antimycotic drugs such as fluconazole, which inhibits
the biosynthesis of ergosterol (White, 1997). Resistance to anti-fungal drugs has been
found (White, 1997), and the fungal infection can be severe (Sanglardet. al., 1995).
177
Upc2p regulated the expression of a gene which is involved in ergosterol synthesis
(MacPhersonet. al., 2005). A mutant with the deletion of this gene has impaired
growth under anaerobic conditions, and the rendered cells are highly susceptible to
the antifungal drugs betoconazole and fluconazole (Bokenet. al., 1993). Thus, the
overexpression of UPC2 increases resistance to azole drugs (MacPhersonet. al.,
2005). Upc2p increases the expression of ERG genes by directly binding to their
promoters (MacPhersonet. al., 2005) and azole resistance is commonly found in the
over-expression of genes which encode the efflux pumps or the azole target lanosterol
demethylase (ERG11) (Lopez-Ribotet. al., 1998; Sanglardet. al., 1995). If so, then
adaptation of these pathogens to tolerate antibiotics, as well as to anaerobiosis, may
also depend on increased supply of L-serine. Thus, the inhibition or alteration of
L-serine biosynthesis may prevent or inhibit the growth of C. albicans during
pathogenic infection. Azaserine is an anti-neoplastic agent which can cause DNA
damage. Also it inhibits purine metabolism (Levenberget. al., 1957). However, as
an inhibitor of seryl-tRNA synthetase it may have anti-fungal activity, or of in
conjunction with other antibiotics, it may increase the efficacy of these available
antifungal antibiotics. Nevertheless, it will be worthwhile to determine if the
inhibition or the blockage on the L-serine biosynthesis, in order to prevent the C.
albicans infection is warranted in this study.
6.1 Further directions
While Klis and his colleagues carried out an elegant investigation of the mannoprotein
composition of the aerobic cell wall (Kliset. al., 2002), there is now a case to extend
this work to anaerobic conditions. An extensive study following the changes in cell
wall composition during the transition between aerobic and anaerobic conditions can
178
be undertaken, since there are substantial changes in the pattern of expression of the
mannoprotein genes following a shift to anaerobic conditions (Abramovaet. al.,
2001).
Although this thesis has illustrated how the complexity of the mannoprotein
composition and the metabolism in S. cerevisiae are related, there are still several
interesting questions that remain. It is not clear why there is a major requirement for
remodelling of the cell wall mannoproteins during anaerobiosis, nor why there is a
need for an increase in the seryl residues in the anaerobic cell wall. It has been
suggested that almost all of the anaerobic seripauparin genes may be up-regulated to
modify cell wall porosity (Laiet. al., 2005), so that the cell wall can accommodate the
transport and processing of any specific requirements during the shift to anaerobiosis.
Some of this may reflect changes in composition of the cell membrane resulting from
the altered supply of ergosterol and unsaturated fatty acid. The increase in serine
residues may reflect a need for more extensive mannosylation of cell wall proteins
under these conditions, which might be reflected in the morphology of the mannan
layer. However, from the perspective of systems biology, the difference in the
patterns of gene regulation and metabolic networks vary when cells are under
anaerobic conditions. On the other hand, the implication for the hierarchy of
utilisation of L-serine for synthesis of various cell components should provide an
insight into the demand of L-serine. Under anaerobic conditions, the cell wall protein
biosynthesis in S. cerevisiae appears to take priority over that of other proteins.
Although there are numerous studies to determine genes that are up- or down-
regulated during the anaerobic shift, it is still necessary to investigate genes that have
greater priority to be expressed when the cells are under anaerobiosis.
����������
�
Abramova, N. E., Cohen, B. D., Setil, O., Kapoor, R., Davies, K. J. A. and Lowry, C. V. (2001a). Regulatory mechanisms controlling expression of the Dan/Tir mannoprotein genes during anaerobic remodelling of the cell wall in ��������������� �. ��� �, 157, 1169-1177.
Abramova, N. E., Sertil, O., Mehta, S. and Lowry, C. Y. (2001b). Reciprocal regulation of anaerobic and aerobic cell wall mannoprotein gene expression in ��������������� �. ���������������� �����, 183, (9): 2881-2887.
Agte, V., Gokhale, M. K. and Paknikar, K. M. (1999). Effect of fermentation using baker's yeast on bioavailable iron and zinc from cereals and legumes. ������������������ ����������������, 36, (6): 551-554
Ahmad, M. and Bussey, H. (1986). Yeast arginine permease: nucleotide sequence of the �����gene. ���������� �, 10, (8): 587-592.
Albers, E., Laizé, V., Blomberg, A., Hohmann, S. and Gustafsson, L. (2003). Ser3p (Yer081wp) and Ser33p (Yil074cp) are phosphoglycerate dehydrogenases in ��������������� �. ������������ ���� ������� ���, 278, (12): 10264-10272.
Albers, E., Larsson, C., Liden, G., Niklasson, C. and Gustafsson, L. (1996). Influence of the nitrogen source on ������������ ��� � anaerobic growth and product formation ���� ��������� ��������� ���! �����, 62, 3187-3195.
Albrecht, G., Mösch, H. U., Hoffmann, B., Reusser, U. and Braus, G. H. (1998). Monitoring the ���" protein-mediated response in the yeast� ��������������� �. ������������ ���� ������� ���, 273, (21): 12696-12702.
Algranati, I. D. and Cabib, E. (1960 ). The synthesis of glycogen in yeast. � ��� � �����! ���� �������, 43, 141-142.
Alic, N., Felder, T., Temple, M. D., Gloeckner, C., Higgins, V. J., Briza, P. and Dawes, I. W. (2004). Genome-wide transcriptional response to a lipid hydroperoxide: adaptation occurs without induction of oxidant defences. ���#�� ����� ���������� � � �, 37, (1): 23-35.
Alimardani, P., Regnazq, M., Moreau-Vauzelle, C., Ferreira, T., Rossignol, T., Blondin, B. and Berges, T. (2004). �$��-promoted sterol uptake involved the ABC transporter Aus1 and the mannoprotein Dan1 whose synergistic action is sufficient for this process. � ���� �����������, 381, 195-202.
André, B., Hein, C., Grenson, M. and Jauniaux, J. C. (1993). Cloning and expression of the $��"�gene coding for the inducible GABA-specific transport protein of ��������������� �. ��������������������� �, 237, (1-2): 17-25.
Andreasen, A. and Stter, T. (1953). Anaerobic nutrition of ��������������� �. I. Ergosterol requirements for growth in a defined medium ������������������������������� ����� �����, 41, 23-26.
Andreasen, A. and Stter, T. (1954 ). Anaerobic nutrition of ��������������� �. II. Unsaturated fatty acid requirements for growth in defined medium. ������������������������������� ����� �����, 43, 271-281.
Aouida, M., Leduc, A., Poulin, R. and Ramotar, D. (2005). ��%&�encodes the major permease for high affinity polyamine import in ������������ ��� �' (����������� ���� ������� ���, 280, (25): 24267-24276.
Archer, T. E. and Castor, J. G. B. (1956). Phosphate changes in fermenting must in relation to yeast growth and ethanol production ��� ����(���������������������� � ������, 7, (2): 62-68.
Arndt, K. T., Styles, C. and Fink, G. R. (1987). Multiple global regulators control )*�"�transcription in yeast. �� ��, 237, (4817): 874-880.
Atkinson, K., Fogel, S. and Henry, S. A. (1980a). Yeast mutant defective in phosphatidylserine synthesis. �������� ��� � ���� ���� ��� ���, 255, (14): 6654-6661.
Atkinson, K., Jensen, B., Kolat, A. L., Storm, E. M., Henry, S. A. and Fogel, S. (1980b). Yeast mutants auxotrophic for choline or ethanolamine �������� �������� �����, 141, (2): 558-564.
Bacon, J. S., Farmer, V. C., Jones, D. and Taylor, I. F. (1969). The glucan components of the cell wall of baker's yeast (������������ ��� �) considered in relation to its ultrastructure. � ���� �����������, 114, (3): 557-567.
Bajmoczi, M., Sneve, M., Eide, D. J. and Drewes, L. R. (1998). �����encodes a low-affinity histidine transporter in ������������ ��� �. � ���� ���� ����! ���� ���������������� ��� ��, 243, (1): 205-209.
Bartnicki-Garcia, S. and Nickerson, W. J. (1961). Thiamine and nicotinic acid: Anaerobic growth factors for ����� ���+ � ���������������� �����, 82, (1): 142-148.
Beckhouse, A. G. (2006). The transcriptional and physiological alterations in brewers yeast when shifted from anaerobic to aerobic growth conditions. School of Biotechnology and Biomolecular Sciences. Sydney, University of New South Wales ��������� �������.
Birch, R. M. and Walker, G. M. (2000). Influence of magnesium ions on heat shock and ethanol stress responses of ������������ ��� �. ��,��� ����� ���! ������������, 26, (9-10): 678-687.
Bishop, C. T., Blank, F. and Gardner, P. E. (1960). The cell wall polysaccharides of ���� � �� ��! ���: glucan, mannan and chitin. ����� ��� �������� ������ ���, 38, 869-881.
Boer, V. M., de Winde, J. H., Pronk, J. T. and Piper, M. D. (2003). The genome-wide transcriptional responses of ������������ ��� � grown on glucose in aerobic chemostat cultures limited for carbon, nitrogen, phosphorus, or sulfur. ������������ ���� ������� ���, 278, (5): 3265-3274.
Boken, D. J., Swindells, S. and Rinaldi, M. G. (1993). Fluconazole-resistant ���� �����! ���. �� � ����*���� ���- �, 17, (6): 1018-1021.
Bradford, M. M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. ������ ����� ���� ���, 72, 248-254.
Bulawa, C. E. (1993). Genetics and molecular biology of chitin synthesis in fungi. ��������� .����� ���! �����, 47, 505-534.
Bungard, C. I. and McGivan, J. D. (2004). Glutamine availability up-regulates expression of the amino acid transporter protein ASCT2 in HepG2 cells and stimulates the ASCT2 promoter. � ������', 382, 27-32.
Cabib, E., Roberst, R. and Bowers, B. (1982). Synthesis of the yeast cell wall and its regulation. ��������� .����� ���� ���, 51, 763-793.
Cabib, E., Roh, D.-H., Schmidt, M., Crotti, L. B. and Varma, A. (2001). The yeast cell wall and septum as paradigms of cell growth and morphogenesis. ������������ ���� ������� ���, 276, (23): 19679-19682.
Carman, G. M. and Henry, S. A. (1989). Phospholipid biosynthesis in yeast ��������� .����! ���� ���, 58, 635-669.
Carman, G. M. and Zeimetz, G. M. (1996). Regulation of phospholipid biosynthesis in the yeast ��������������� �. ������������ ���� ������� ���, 271, (23): 13293-13296.
Cassone, A., Mattia, E. and Boldrini, L. (1978). Agglutination of blastospores of ���� �����! ��� by concanavalin A and its relationship with the distribution of mannan polymers and the ultrastructure of the cell wall. ����������������� ���! �����, 105, (2): 263-273.
Caubet, R., Guerin, B. and Guerin, M. (1988). Comparative studies on the glycolytic and hexose monophosphate pathways in ���� ��� ����� �� � and ��������������� �. ���� ������ ���! �����, 149, (4): 324-329.
Chaffin, W. L., Lopez-Ribot, J. L., Casanova, M., Gozalbo, D. and Martinez, J. P. (1998). Cell wall and secreted proteins of ���� ��� ��! ���/ identification, function, and expression. ���! ������ ���� �������� � ������ �� ., 62, 130-180.
Chapman, C. and Bartley, W. (1968). The kinetics of enzyme changes in yeast under conditions that cause the loss of mitochondria. � ���� �����������, 107, (4): 455-465.
Chen, E. C. (1981). Release of fatty acids as a consequence of yeast autolysis. ����������������� ������� ��������. ������ �, 39, 117-124.
Cherkasova, V. A. and Hinnebusch, A. G. (2003). Translational control by TOR and ��%"&� through dephosphorylation of eIF2alpha kinase ���&. ��� ����-�������, 17, (7): 859-872.
Chiocchetti, A., Zhou, J., Zhu, H., Karl, T., Haubenreisser, O., Rinnerthaler, M., Heeren, G., Oender, K., Bauer, J., Hintner, H., Breitenbach, M. and Breitenbach-Koller, L. (2007). Ribosomal proteins Rpl10 and Rps6 are potent regulators of yeast replicative life span. �+�� ������ ����������, 42, (4): 275-286.
Choi, H.-S. and Carman, G. M. (2007). Respiratory deficiency mediates the regulation of CHO1-encoded phosphatidylserine synthase by mRNA stability in ��������������� �. ������������ ���� ������� ���, 282, (43): 31217-31227.
Christensen, H. N. (1990). Role of amino acid transport and countertransport in nutrition and metabolism. %�� ���� ������ ., 70, 43-77.
Christensen, K. E. and MacKenzie, R. E. (2006). Mitochondrial one-carbon metabolism is adapted to the specific needs of yeast, plants and mammals. � ����� /� �.� ���� �� .� �� ��������0� �������� ���� �����������
! �����, 28, 595-605. Ciesarová, Z., Šmogrovičová, D. and Dömény, Z. (1996). Enhancement of yeast
ethanol tolerance by calcium and magnesium ��� �� ���! ���� ��, 41, (6): 485-488.
Cigan, A. M., Bushman, J. L., Boal, T. R. and Hinnebusch, A. G. (1993). A protein complex of translational regulators of ���"�mRNA is the guanine nucleotide-exchange factor for translation initiation factor 2 in yeast. %���'�����'�����'��� '�$'�'�', 90, (11): 5350-5354.
Cohen, B. D., Setil, O., Abramova, N. E., Davies, K. J. A. and Lowry, C. V. (2001). Induction and repression of�-��� and the family of anaerobic mannoprotein genes in ������������ ��� � occurs through a complex array of regulatory sites. ���� ���� ��#����, 29, (3): 799-808.
Compagno, C., Boschi, F. and Ranzi, B. M. (1996). Glycerol production in a triose phosphate isomerase deficient mutant of ������������ ��� �. � ����������������, 12, (5): 591-595.
Conway, E. J. and O'Malley, E. (1946). The nature of the cation exchanges during yeast fermentation, with formation of 0·02n-H ion. � ���� ���� (������, 40, (1): 59-67.
Cook, R. J. (2000). Defining the steps of the folate one-carbon shuffle and homocystenine metabolism. ��� ��� ���� (������� ��� �� � ���� ���� � ��, 72, 1419-1420.
Cooper, T. G., Ed. (1982). Transport in ������������ ��� �. The molecular biology of the yeast �����������. Metabolism and Gene expression. Cold Spring Harbour, New York, Cold Spring Harbour Press.
Correa García, S., Bermúdez Moretti, M., Ramos, E. and Batlle, A. (1997). Carbon and nitrogen sources regulate delta-aminolevulinic acid and gamma-aminobutyric acid transport in ������������ ��� �. ��� *������ ����������������� ���� ����1������ �����, 29, (8-9): 1097-1101.
Dagger, R. K., Reinhold, B. B., Petráková, E., Yeh, H. J. C., Ashwell, G., Drgonová, J., Kapteyn, J. C., Klis, F. M. and Cabib, E. (1997). Architecture of the Yeast Cell Wall - β (1->6)-GLUCAN INTERCONNECTS MANNOPROTEIN, β (1 -> 3)-GLUCAN, AND CHITIN. ������������ ���� ������� ���, 272, (28): 17762-17775.
Daignan-Fornier, B. and Fink, G. R. (1992). Coregulation of purine and histidine biosynthesis by the transcriptional activators ���� and����&. %���� ������������ ����������������� ��, 89, 6746-6750.
de Groot, M. J. L., Daran-Lapujade, P., van Breukelen, B., Knijnenburg, T. A., de Hulster, E. A. F., Reinders, M. J. T., Pronk, J. T., Heck, A. J. R. and Slijper, M. (2007). Quantitative proteomics and transcriptomics of anaerobic and aerobic yeast cultures reveals post-transcriptional regulation of key cellular processes. ���! �����, 153, 3864-3878.
de Groot, P. W., de Beor, A. D., Cunningham, J., Dekker, H. L., de Jong, L., Hellingweif, K. J., de Koster, C. and Klis, F. M. (2004). Proteomic analysis of ���� ��� ��! ���� cell walls reveals covalently bound carbohydrate-active enzymes and adhesins. ��2����� �����, 3, (4): 955-965.
de Groot, P. W., Kraneveld, E. A., Yin, Q. Y., Dekker, H. L., Gross, U., Crielaard, W., de Koster, C. G., Bader, O., Klis, F. M. and Weig, M. (2008). The cell wall of the human pathogen ���� ��� ���!����: differential incorporation of novel adhesin-like wall proteins. ��2����� �����, 7, (11): 1951-64.
de Groot, P. W., Ram, A. F. and Klis, F. M. (2005). Features and functions of covalently linked proteins in fungal cell walls. ���������� ������� �����, 42, 657-675.
Denis, V. and Daignan-Fornier, B. (1998). Synthesis of glutamine, glycine and 10-formyl tetrahydrofolate is coregulated with purine biosynthesis in ��������������� �. ��������������������� �, 259, 246-255.
Dever, T. E., Feng, L., Wek, R. C., Cigan, A. M., Donahue, T. F. and Hinnebusch, A. G. (1992). Phosphorylation of initiation factor 2 alpha by protein kinase ���&�mediates gene-specific translational control of ���" in yeast. ���, 68, (3): 585-96
Dever, T. E. and Hinnebusch, A. G. (2005). ���& whets the appetite for amino acids. ������������18, 141-148.
Devlin, C., Tice-Baldwin, K., Shore, D. and Arndt, K. T. (1991). #�%��is required for ����/���&- and ���"-dependent transcription of the yeast )*�"�gene. �������� ��', 11, (7): 3642-51.
Dickinson, J. R., Ed. (1999). Carbon metabolism. The Metabolism and Molecular Physiology of ��������������� �. Philadelphia, PA, Taylor & Francis.
Duffus, J. H. and Patterson, L. J. (1974). Control of cell division in yeast using the ionophore, A23187 with calcium and magnesium. �����, 251, 626 - 627
Egli, C. M., Edinger, W. D., Mitrakul, C. M. and Henick-Kling, T. (1998). Dynamics of indigenous and inoculated yeast populations and their effect on the sensory character of Riesling and Chardonnay wines. ��������������� �� ���! �����, 85, 779-789.
Ehrlich, F. (1907). U¨ ber die Bedingungen der Fuselo¨lbildung und u¨ber ihren Zusammenhang mit dem Eiweissaufbau der Hefe. �� ���� ��� -��������� ������������, 40, 1027-1047.
Farcasanu, I. C., Mizunuma, M., Hirata, D. and Miyakawa, T. (1998). Involvement of histidine permease (Hip1p) in manganese transport in ��������������� �. ��������������������� �, 259, (5): 541-548.
Fix, G. (1996). %� �� ��������. ����� ��. Colorado, Brewers Publication. Fleet, G. H., Ed. (1991). Cell walls. Yeast organelles. London, Academic Press. Fleet, G. H., Lafon-Lafourcade, S. and Ribe´reau-Gayon, P. (1984). Evolution of
yeasts and lactic acid bacteria during fermentationand storage of Bordeaux wines. ���� ��������� ��������� ���! ������48, 1034-1038.
Folch, J., Lees, M. and Solane-Stanley, G. H. (1957). A simple method for the isolation and purification of total lipids from animal tissues. �������� ���� ���� ������� ���, 226, 497-509.
Fricker, R. (1978). The design of large tanks. ��.'������', 107, (5): 28-37. Fujii, T., Nagasawa, N., Iwamatsu, A., Bogaki, T., Tamai, Y. and Hamachi, M. (1994).
Molecular cloning, sequence analysis, and expression of the yeast alcohol acetyltransferase gene. ���� �� ���� ��� ��������� ���! �����, 60, 2786-2792.
Garcia-Barrio, M., Dong, J., Ufano, S. and Hinnebusch, A. G. (2000). Association of ����3���&4 regulatory complex with the N-terminus of eIF2alpha kinase ���&�is required for ���&�activation. � �5��, 19, (8): 1887-1899.
Garcia-Sanchez, S., Aubert, S., Iraqui, I., Janbon, G., Ghigo, J.-M. and d’Enfert, C. (2004). Biofilms of ���� �����! ���/ a developmental state associated with specific and stable gene expression patterns. ��2����� ������3, 536-545.
Gatlin, C. L., Kleemann, G. R., Hays, L. G., Link, A. J. and Yates, I. J. R. (1998). Protein identification at the low femtomole level from silver-stained gels using a new fritless electrospray interface for liquid chromatography-microspray and nanospray mass spectrometry. ������ ����� ���� ���, 263, 93-101.
Gelling, C. L., Piper, M. D. W., Hong, S.-P., Kornfeld, G. D. and Dawes, I. W. (2004). Identification of a novel One-carbon metabolism regulon in ��������������� �. ������������ ���� ������� ���, 279, (8): 7072-7081.
Gietz, D., St Jean, A., Woods, R. A. and Schiestl, R. H. (1992). Improved method for high efficiency transformation of intact yeast cells. ���� ���� ��#����, 20, 1425.
Gil, J. V., Manzanares, P., Genoves, S., Valles, S. and Gonzalez-Candelas, L. (2005). Over-production of the major exoglucanase of ��������������� � leads to an increase in the aroma of wine. *������ ����� �������� ��� ����� ���! �����, 103, (1): 57-68.
Grant, C. M., MacIver, F. H. and Dawes, I. W. (1996). Glutathione is an essential metabolite required for resistance to oxidative stress in the yeast ��������������� �. ���������� ��29, (6): 511-515.
Grauslund, M., Didion, T., Kielland-Brandt, M. C. and Andersen, H. A. (1995). ��%&, a gene encoding a permease for branched-chain amino acids in���������������� �. � ��� � �����! ���� �������, 1269, (3): 275-280.
Gregory, J. F., Cuskelly, G. J., Shane, B., Toth, J. P., Baumgartner, T. G. and Stacpoole, P. W. (2000). Primed, constant infusion with [2H3] serine allows in vivo kinetic measurement of serine turnover, homocysteine remethylation, and transulfuration processes in human one-carbon metabolism. ��� ��� ����������������� � �������� � ��, 72, 1535-1541.
Grenson, M., Hou, C. and Crabeel, M. (1970). Multiplicity of the amino acid permeases in� ������������ ��� �. IV. Evidence for a general amino acid permease. ���������������� �����, 103, (3): 770-777.
Guarente, L., Yocum, R. R. and Gifford, P. (1982). A ��6�43�7�� hybrid yeast prometer identifies the ��6" regulatory region as an upstream sites. %���� ������������ ����������������� ��, 79, (23): 7410-7414.
Guymon, J. F. (1964). Studies of higher alcohol formation by yeasts through gas chromatography %��������������)��������� � ��, 11, (2-4): 194-201.
Hammond, J. (2000). Yeast Growth and Nutrition. Brewing yeast fermentation performance. K. Smart. Oxford, Oxford Brooks university�75-85.
Hammond, J. R. M., Ed. (1993). Brewer's yeasts. In the Yeasts. London, Academic Press.
Hansen, H., Nissen, P., Sommer, P., Nielsen, J. C. and Arneborg, N. (2001). The effect of oxygen on the survival of non-������������yeasts during mixed cultures fermentations of grape juice with ��������������� �. ��������������� �� ���! �����, 91, 541-547.
Harashima, S. and Hinnebusch, A. G. (1986). Multiple ��- genes required for repression of ���", a transcriptional activator of amino acid biosynthetic genes in ������������ ��� �. �������� � ������ ��� ��� ���, 6, (11): 3990-3998.
Harbison, C. T., Gordon, D.B., Lee, T.I., Rinaldi, N.J., MacIsaac, K.D., Danford, T.W., Hannett, N.M., Tagne, J.B., Reynolds, D.B., Yoo, J., Jennings, E.G., Zeitlinger, J., Pokholok, D.K., Kellis, M., Rolfe, P.A., Takusagawa, K.T., Lander, E.S., Gifford, D.K., Fraenkel, E., Young, R.A. (2004). Transcriptional regulatory code of a eukaryotic genome. �����, 431, 99-104.
Hardwick, W. A. (1994). History and antecedents of brewing. Handbook of brewing. W. A. Hardwick. New York, Marcel Dekker, Inc.�p37-51.
Hazelwood, L. A., Daran, J.-M., van Maris, A. J. A., Pronk, J. T. and Dickinson, J. R. (2008). The Ehrlich Pathway for Fusel Alcohol Production: a Century of Research on ������������ ��� � Metabolism. ���� �� ����
��� ��������� ���! �����, 74, (8): 2259-2266. Hazen, K. C. (1989). Participation of yeast cell surface hydrophobicity in adherence
of ���� �����! ����to human epithelial cells. *���� �������*���� ��, 57, (7): 1894-1900.
Hazen, K. C., Brawner, D. L., Riesselman, M. H., Jutila, M. A. and Cutler, J. E. (1991). Differential adherence of hydrophobic and hydrophilic ���� �����! ��� yeast cells to mouse tissues. *���� �������*���� ��, 59, (3): 907-912.
>azen, K. C. and Hazen, B. W. (1992). Hydrophobic surface protein masking by the opportunistic fungal pathogen ���� �����! ���. *���� �������*���� ��, 60, (4): 1499-1508.
Hermann, H., Hacker, U., Bandlow, W. and Magdolen, V. (1992). �768� vectors: ������������ ��� �9���� �� �� ��� � shuttle plasmids to analyze yeast promoters. ��, 119, 137-141.
Higgins, V. J., Beckhouse, A. G., Oliver, A. D., Rogers, P. J. and Dawes, I. W. (2003). Yeast genome-wide expression analysis identifies a strong ergosterol and oxidative stress response during the initial stages of an industrial lager fermentation. ���� ��������� ��������� ���! �����, 69, 4777-4787.
Hinnebusch, A. G. (1984). Evidence for translation regulation of the activator of general amino acid control in yeast. %���� ������������ ����������������� ��, 20, 6442-6446.
Hinnebusch, A. G. (1985). A hierarchy of trans- acting factors modulates translation of an activator of amino acid biosynthetic genes in ���������������� �. ������������� �����, 5, (9): 2349-2360.
Hinnebusch, A. G. (1988). Mechanisms of gene regulation in the general control of amino acid biosynthesis in ������������ ��� �. ���! ���� ����#� .�52, (2): 248-273.
Hinnebusch, A. G. (1990). Transcriptional and translational regulation of gene expression in the general control of amino acid biosynthesis in���������������� �. ���� ���� ��#��������� ��������� �����, 38, 195-240.
Hinnebusch, A. G. (1997). Translational regulation of yeast ���"' A window on factors that control initiator-tRNA binding to the ribosome. �������� ���� ���� ������� ����272, (35): 21661-21664.
Hinnebusch, A. G. (2005). Translation regulation of ���" and the general amino acid control of yeast. �������#� .���� ���! �����, 59, 407-405.
Hinnebusch, A. G. and Fink, G. R. (1983). Positive regulation in the general amino acid control of� ������������ ��� �. %���� ��� ��� ��� ��� ����������������� ��, 80, (17): 5374-5378.
Hinnebusch, A. G. and Natarajan, K. (2002). Gcn4p, a master regulator of gene expression, is controlled at multiple levels by diverse signals of starvation and stress. ��2����� �����, 1, (1): 22-32.
Hong, S. P., Piper, M. D., Sinclair, D. A. and Dawes, I. W. (1999). Control of expression of one-carbon metabolism genes of ������������ ��� � is mediated by a tetrahydrofolate-respsonsive protein binding to a glycine regulatory region including a core 5'-CTTCTT-3' motif. ������������ ���� ������� ���, 274, (15): 10523-10532.
Hope, I. A. and Struhl, K. (1985). ���" protein, synthesized in vitro, binds� )*�: regulatory sequences: implications for general control of amino acid biosynthetic genes in yeast. ���, 43, (1): 177-88.
Horie, T. and Isono, K. (2001 ). Cooperative functions of the mannoprotein-encoding genes in the biogenesis and maintenance of the cell wall in ��������������� �. 7��, 18, 1493-1503.
Hornsey, I. S. (1999). ��. ��. Cambridge, The Royal Society of Chemistry Hough, J. S. (1985). ��� ! ����������� ��� ���� ��� ���� !�. ��. Cambridge,
Cambridge University Press. Hough, J. S., Briggs, D. E. and Stevens, R. (1971 -a). Biology of yeasts. Malting and
brewing science. J. S. Hough, D. E. Briggs and R. Stevens. New York, Halsted Press.
>ough, J. S., Briggs, D. E. and Stevens, R. (1971 -b). Metabolism of wort by yeast. Malting and brewing science. J. S. Hough, D. E. Briggs and R. Stevens. New York, Halsted Press.
Isnard, A. D., Thomas, D. and Surdin-Kerjan, Y. (1996). The study of methionine uptake in ������������ ��� � reveals a new family of amino acid permeases. ����������� ��������� �����, 262, (4): 473-484.
Jakovcic, S., Getz, G., Rabinowitz, M., Jakob, H. and Swift, H. (1971). Cardiolipin contents of wild type and mutant yeasts in relation to mitochondrial function and development. ���������������� �����, 48, 490-502.
James, T. C., Campbell, S., Donnelly, D. and Bond, U. (2003). Transcription profile of brewery yeast under fermentation conditions. �������� ��� ���� �� ���! �����, 94, 432-448.
Janke, C., Magiera, M. M., Rathfelder, N., Taxis, C., Reber, S., Maekawa, H., Moreno-Borchart, A., Doenges, G., Schwob, E., Schiebel, E. and Knop, M. (2004). A versatile toolbox of PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substituation cassettes. 7��, 21, 947-962.
Jauniaux, J. C. and Grenson, M. (1990). ��%�, the general amino acid permease gene of ��������������� �. Nucleotide sequence, protein similarity with the other bakers yeast amino acid permeases, and nitrogen catabolite repression. �������������������� ���� ���, 190, (1): 39-44.
Jauniaux, J. C., Vandenbol, M., Vissers, S., Broman, K. and Grenson, M. (1987). Nitrogen catabolite regulation of proline permease in ��������������� �. Cloning of the %$�"�gene and study of %$�"�RNA levels in wild-type and mutant strains. �������������������� ���� ���, 164, (3): 601-606.
Jin, Y.-L. and Speers, R. A. (1998). Flocculation of ��������������� �. �����#�����*������ ����, 31, (6-7): 421-440
Jollow, D., Kellerman, G. M. and Linnane, A. W. (1968). The biogenesis of mitochondria. 3. The lipid composition of aerobically and anaerobically grown ������������ ��� �� as related to the membrane systems of the cells. ���������������� �����, 37, (2): 221-230.
Jones, M. and Pierce, J. S. (1964). Absorption of amino acid from wort by yeasts. ��������������*�� ���������. ��, 70, 307-315.
Joo, Y. J., Kim, J. A., Baek, J. H., Seong, K. M., Han, K. D., Song, J. M., Choi, J. Y. and Kim, J. (2009). Cooperative regulation of �-�:� transcription by Gcn4p and Bas1p in ��������������� �' ��2���������', 8, (8): 1268-1277.
Kanbe, T., Han, Y., Redgrave, B., Riesselman, M. H. and Cutler, J. E. (1993). Evidence that mannans of ���� �����! ����are responsible for adherence of yeast forms to spleen and lymph node tissue. *���� �������*���� ��, 61, (6): 2578-2584
Kanfer, J. N. (1980). The base exchange enzymes and phospholipase D of mammalian tissue. ����� ��������������� ���� ���, 58, 1370-1380.
Kelley, M. J., Bailis, A. M., Henry, S. A. and Carman, G. M. (1988). Regulation of phospholipid biosynthesis in ��������������� ��by inositol. Inositol is an inhibitor of phosphatidylserine synthase activity. �������� ��� � ���� ������� ���, 263, 18078-18085.
Kent, C., Carman, G. M., Spence, M. W. and Dowhan, W. (1991). Regulation of eukaryotic phospholipid metabolism. ��� ����� ��� ��� ��� ���� ��� � ������+�� ������� �����, 5, 2258-2266.
Klis, F. M. (1994). Cell wall assembly in yeast 7��, 10, 851-869.
Klis, F. M., Boorsma, A. and de Groot, P. W. J. (2006). Cell wall construction in ��������������� �. 7��, 23, 185-202.
Klis, F. M., Mol, P., Hellingwerf, K. and Brul, S. (2002). Dynamics of cell wall structure in ��������������� �. �� �� ���! ������#� .�26, 239-259.
Klotz, S. A., Rutten, M. J., Smith, R. L., Babcock, S. R. and Cunningham, M. D. (1993). Adherence of ���� ��� ��! ��� to immobilized extracellular matrix proteins is mediated by calcium-dependent surface glycoproteins. ���! ���%������ , 14, (2): 133-147.
Koehler, R. N., Rachfall, N. and Rolfes, R. J. (2007). Activation of the ADE genes requires the chromatin remodeling complexes SAGA and SWI/SNF. ��2���������', 6, 1474-1485.
Kosugi, A., Koizumi, Y., Yanagida, F. and Udaka, S. (2001). $%�, high affinity methionine permease, is involved in cysteine uptake by ��������������� �. � �� ��0�� ����������0������ ���� ���, 65, (3): 728-731.
Kresnowati, M. T. A. P., van Winden, W. A., Almering, M. J. H., ten Pierick, A., Knijnenburg, T. A., Daran-Lapujade, P., Pronk, J. T., Heijnen, J. J. and Daran, J. M. (2006). When transcriptome meets metabolome: fast cellular responses of yeast to sudden relief of glucose limitation. �������������� �����, 49, 1-16.
Krishan, A. (1975). Rapid flow cytofluorometric analysis of mammalian cell cycle by propidium iodide staining. ���������������! �����, 66, (1): 188-193.
Kudo, M., Vagnoli, P. and Bisson, L. F. (1998). Imbalance of pH and potassium concentration as a cause of stuck fermentations. ��� ����(����������������������; � ������, 49, (3): 295-301.
Kunzler, M., Balmelli, T., Egli, C. M., Paravicini, G. and Braus, G. H. (1993). Cloning, primary structure, and regulation of the )*�<� gene encoding a bifuncational glutamine amidotransferase:cyclase from ��������������� �. ���������������� �����, 175, 5548-5558.
Kwast, K. E., Lai, L. C., Menda, N., James, D. T., Aref, S. and Burke, P. V. (2002). Genomic analyses of anaerobically induced genes in ��������������� �: functional roles of #�+��and other factors in mediating the anoxic response. ���������������� �����, 184, 250-265.
Lai, L. C., Kosorukoff, A. L., Burke, P. V. and Kwast, K. E. (2005). Dynamical remodelling of the transcirptiome during short-term anaerobiosis in ������������ ��� �/� differential response and role of �& and/ or �" and other factors in galactose and glucose media. �������� ����� �����, 25, (10): 4075-4091.
Lai, L. C., Kosorukoff, A. L., Burke, P. V. and Kwast, K. E. (2006). Metabolic-state-dependendt remodeling of the transciptome in response to anoxia and subsequent reoxygenation in ������������ ��� �. ��2����� �� ���, 5, (9): 1468-1489.
Large, P. J. (1986). Degradation of organic nitrogen compounds by yeasts. 7��, 2, 1-34.
Lee, J.-C., Straffon, M. J., Jang, T.-Y., Higgins, V. J., Grant, C. M. and Dawes, I. W. (2001). The essential and ancillary role of glutathione in ��������������� � analysed using a grande ���� disruption strain. �� �� 7���#����, 1, 57-65.
Lentini, A., Rogers, P., Higgins, V., Dawes, I., Chandler, M., Stanley, G. and Chambers, P. (2003). The impact of ethanol stress on yeast physiology.
Brewing yeast fermentation performance. K. Smart. Oxford, Oxford Brooks university�25-38.
Lesage, G. and Bussey, H. (2006). Cell wall assembly in ������������ ��� �. ���! ���������� ��������� ������#� ., 70, (2): 317-343.
Levenberg, B., Melnick, I. and Buchanan, J. M. (1957). Biosynthesis of the purines, XV. The effect of aza-L-serine and 6-diazo-5-oxo-L-norleucine on inosinic acid biosynthesis ������. ������������ ���� ������� ���, 225, 163-176.
Li, F. and Palecek, S. P. (2003). ��%�, a ���� �����! ��� gene involved in binding human epithelial cells. ��2����� �����, 2, 1266-1273.
Lilly, M., Lambrechts, M. G. and Pretorius, I. S. (2000). Effect of increased yeast alcohol acetyltransferase activity on flavor profiles of wine and distillates. ���� ��������� ��������� ���! �����, 66, (2): 744-753.
Lipke, P. N. and Ovalle, R. (1998). Cell wall architecture in yeast: new structure and new challenges. ���������������� �����, 180, (15): 3735-3740.
Lopez-Ribot, J. L., McAtee, R. K., Lee, L. N., Kirkpatrick, W. R., White, T. C. and Sanglard, D. (1998). Distinct patterns of gene expression associated with development of fluconazole resistance in serial ���� �����! ��� isolates from human immunodeficiency virus-infected patients with orpharyngeal candidiasis. ��� � ���! ����������������������, 42, 2932-2937.
Lorenz, M. C. and Heitman, J. (1998). The �%&� ammonium permease regulates pseudohyphal differentiation in ��������������� �. � �5�(������, 17, (5): 1236-1247.
MacPherson, S., Akache, B., Weber, S., de Deken, X., Raymond, M. and Turcotte, B. (2005). ���� ��� �� ! ���s zinc cluster protein Upc2p confers resistance to antifungal drugs and is an activator of ergosterol biosynthetic genes. ��� � ���! ����������������������, 49, (5): 1745-1752.
Magazinnik, T., Anand, M., Sattlegger, E. and Hinnebusch, A. G. (2005). Interplay between ���&� and ���"� expression, translation elongation factor 1 mutations and translational fidelity in yeast. ���� ���� ��#�����33, (14): 4584-4592.
Marini, A. M., Soussi-Boudekou, S., Vissers, S. and Andre, B. (1997). A family of ammonium transporters in ��������������� �. ������������� �����, 17, (8): 4282-4293.
Marini, A. M., Vissers, S., Urrestarazu, A. and André, B. (1994). Cloning and expression of the �%�� gene encoding an ammonium transporter in ��������������� �. � �5�(������, 13, (15): 3456-3463.
Marquis, C. P., Barford, J. P., Harbour, C. and Nobbs, D. M. (1993). Evaluation of the batch kinetics of the amino acid metabolism of a mouse hybridoma and human lymphoblastoid cell line using a pre-column FDNDEA derivitisation, HPLC technique � ��������������� =�, 7, (11):
McGee, T. P., Skinner, H. B., Whitters, E. A., Henry, S. A. and Bankaitis, V. A. (1994). A phosphatidylinositol transfer protein controls the phosphatidylcholine content of yeast Golgi membranes. �������� ��� ����� �����, 124, (3): 273-287.
McGovern, P. E., Zhang, J., Tang, J., Zhang, Z., Hall, G. R., Moreau, R. A., Nunez, A., Butrym, E. D., Richards, M. P., Wang, C. S., Cheng, G., Zhao, Z. and Wang, C. (2004) Fermented beverages of pre- and proto-historic China. %���'�����'�����'��� '�$'�'�', 101(51):17593-17598.
McMaster, C. R. and Bell, R. M. (1994). Phosphatidylcholine biosynthesis in ������������ ��� �. Regulatory insights from studies employing null
and chimeric sn-1,2-diacylglycerol choline- and ethanolaminephosphotransferases. ������������ ���� ������� ���, 269, (45): 28010-28016.
McMurrough, K. and Rose, A. H. (1967). Effect of growth rate and substrate limitation on the composition and structure of the cell wall of ��������������� �. � ���� �����������, 105, 189- 203.
McNeil, J. B., Bognar, A. L. and Pearlman, R. E. (1996). In vivo analysis of folate coenzymes and their compartmentation in ��������������� �. ��� �, 142, (2): 371-381.
McNeil, J. B., McIntosh, E. M., Taylor, B. V., Zhang, F. R., Tang, S. and Bognar, A. L. (1994). Cloning and molecular characterization of three genes, including two genes encoding serine hydroxymethyltransferases, whose inactivation is required to render yeast auxotrophic for glycine �������� ��� � ���� ������� ���, 269, (12): 9155-9165.
Melcher, K., Rose, M., Künzler, M., Braus, G. H., and Entian, K.D (1995). Molecular analysis of the yeast ��#� gene encoding 3-phosphoserine aminotransferase: regulation by general control and serine repression. ���������� �, 27, (6): 501-8.
Mendes-Ferreira, A., Mendes-Faia, A. and Leão, C. (2004). Growth and fermentation patterns of ������������ ��� � under different ammonium concentrations and its implications in winemaking industry. �������� ������� �� ���! �����, 97, (3): 540-545.
Mieczkowski, P. A., Dominska, M., Buck, M. J., Gerton, J. L., Lieb, J. D. and Petes, T. D. (2006). Global analysis of the relationship between the binding of the Bas1p transcription factor and meiosis-specific double-straind DNA breaks in ��������������� �. ������������� �����, 26, 1014-1027.
Monschau, N., Stahmann, K. P., Sahm, H., McNeil, J. B. and Bognar, A. L. (1997). Identification of Saccharomyces cerevisiae �67� as a threonine aldolase: a key enzyme in glycine biosynthesis. �� �� ���! ���6���, 150, (1): 55-60.
Morris, E. O., Ed. (1958). The chemistry and biology of yeasts. New York, Academic press.
Mortimer, R. K. and Johnston, J. R. (1986). Genealogy of principal strains of the yeast genetic stock center. ��� �, 113, (1): 35-43.
Mrvčić, j., Stanzera, D., Stehlik-Tomasa, V., Škevina, D. and Grbaa, S. (2007). Optimization of bioprocess for production of copper-enriched biomass of industrially important microorganism ������������ ��� �. �������� ���� �� �������� ��� �� ��, 103, (4): 331-337
Mueller, P. P., Harashima, S. and Hinnebusch, A. G. (1987). A segment of ���"�mRNA containing the upstream AUG codons confers translational control upon a heterologous yeast transcript. %���'� ����'� ����'� �� '� $'�'�', 84, (9): 2863-2867.
Munroe, J. H. (1994). Fermentation. Handbook of brewing. W. A. Hardwick. New York, Marcel Dekker, Inc.�323-353.
Murray, C. R., Barich, T. and Taylor, D. (1984). The effect of yeast storage conditions on subsequenct fermentation. �������� ����>��������21, (4): 189-194.
Myers, A. M., Tzagoloff, A., Kinney, D. M. and Lusty, C. J. (1986). Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of Lacz fusions. ��, 45, (3): 299-310.
Nagarajan, L. and Storms, R. K. (1997). Molecular characterization of ��;:, the ������������ ��� � gene coding for the glycine cleavage system hydrogen carrier protein. �������� ��� � ���� ���� ��� ���, 272, (7): 4444-4450.
Natarajan, K. and Hinnebusch, A. G. (2002). Gcn4p, a master regulator of gene expression, is controlled at multiple levels of diverse signals of starvation and stress. ��2����� �����, 1, (1): 22-32.
Natarajan, K., Meyer, M. R., Jackson, B. M., Slade, D., Roberts, C. and Hinnebusch, A. G. (2001). Transcriptional profiling Gcn4p is a master regulator of gene expression during amino acid starvation in yeast. ������������! �����, 21, (13): 4347-4368.
Nes, W. R., Sekula, B. C., Nes, W. D. and Adler, J. H. (1978). The functional importance of structural features of ergosterol in yeast. ������������ ���� ������� ���, 253, (17): 6218-6225.
Nikawa, J. and Yamshita, S. (1981). Characterization of phosphatidylserine synthase from ��������������� � and a mutant defective in enzyme. � ��� � �����! ���� �������, 665, (420-426):
Nomura, W., Maeta, K., Kita, K., Izawa, S. and Inoue, Y. (2008). Role of ���"� for adaptation to methylglyoxal in ������������ ��� �" methylglyoxal attenuates protein synthesis through phosphorylation of eIF2α. � ���� ��������! ���� ���������������� ��� ��, 376, (4): 738-742.
Nordstrom, K. (1962). Formation of ethyl acetate in fermentation with brewer's yeast. III Participation of coenzyme A. ��������������*�� ���������. ��, 68, 398-407.
Nurminen, T., Konttinnen, K. and Suomalainen, H. (1975). Neutral lipids in the cells and cell envelop fractions of aerobic bakers's yeast and anaerobic brewer's yeast. ��� ��������%�� �����6 � �, 14, 15-32.
Nyka¨nen, L. (1986). Formation and occurrence of flavour compounds in wine and distilled alcoholic beverages. ��� ���������������������������; � �������37, 84- 96.
Okuyama, H., Saito, M., Joshi, V., Gunsberg, S. and Wakil, S. (1979). Regulation by temperature of chain length of fatty acids in yeast. �������� ��� � ���� ������� ���, 254, 12281-12284.
Ono, B. I., Hazu, T., Yoshida, S., Kawato, T., Shinoda, S., Brzvwczy, J. and Paszewski, A. (1999). Cysteine biosynthesis in ������������ ��� �: a new outlook on pathway and regulation. 7��, 15, (13): 1365-1375.
Osuji, G. O. (1979 ). Glutathione turnover and amino acid uptake in yeast: evidence for the participation of the gamma-glutamyl cycle in amino acid transport. �����6���, 105, (2): 283-285.
Ough, C. S., Davenport, M. and Joseph, K. (1989). Effects of certain vitamins on growth and fermentation rate of several commercial active dry wine yeasts ��� ���������������������������; � ������, 40, (3): 208-213
Palmqvist, U. and Ayrapaa, T. (1969). Uptake of amino acids in bottom fermentations. ��������������*�� ���������. ��, 75, 181-190.
Paltauf, F., Kohlwein, S. D., and Henry, S. A. (1992). Regulation and compartimentalization of lipid synthesis in yeast. The molecular and cellular biology of Yeast ������������ ��� �: Gene Expression. E. W. Jones, Pringle, J. R., and Broach, J. R. N.Y., Cold Spring Harbour Laboratory Press�415-500.
Panozzo, C., Nawara, M., Suski, C., Kucharczyka, R., Skoneczny, M., Becam, A.-M., Rytka, J. and Herbert, C. J. (2002). Aerobic and anaerobic NAD+ metabolism in ��������������� �. �����6���, 517, 97-102.
Pasternack, L. B., Littlepage, L. E., A., L. J. D. and Appling, D. R. (1996). 13C NMR analysis of the use of alternative donors to the tetrahydrofolate-dependent one-carbon pools in ������������ ��� �. ���� �� ��� � ���� ���� ����� ���� �, 326, (1): 158-165.
Percudani, R., Pavesi, A. and Ottonello, S. (1997). Transfer RNA gene redundancy and translational selection in ��������������� �. ����������� ��������� �����, 268, 322-330.
Pierce, C. G., Thomas, D. P. and López-Ribot, J. L. (2009). Effect of tunicamycin on����� ��� ��! ��� biofilm formation and maintenance. ��� �������� ������ � ���! �������������, 63, (3): 473-479.
Pierce, J. S. (1982). Amino acids in malting and brewing. ����������� ���*�� ���������. ��, 88 228-233.
Pinson, B., Gabrielsen, O. S. and Daignan-Fornier, B. (2000). Redox regulation of AMP synthesis in yeast: a role of the Bas1p and Bas2p transcription factors. ��������� ���! �����, 36, (6): 1460-1469.
Piper, M. D., Hong, S. P., Ball, G. E. and Dawes, I. W. (2000). Regulation of the balance of one - carbon metabolism in ��������������� �. ������������ ���� ������� ���, 275, (40): 30987-30995.
Piper, M. D., Hong, S. P., Eissing, T., Sealey, P. and Dawes, I. W. (2002). Regulation of the yeast glycine cleavage genes is respsonsive to the avaliability of multiple nutrients. �� ��7���#����, 2, (1): 59-71.
Pironcheva, G. L. (1998). The effect of magnesium ions during beer fermentation. ����! �, 94, (377): 135-139.
Pitarch, A., Nomela, C. and Gil, C. (2008). Cell wall fractionation for yeast and fungal proteomics. ����� �� ��������� �����, 425, 217-239.
Qadota, H., Python, C. P., Inoue, S. B., Arisawa, M., Anraku, Y., Zheng, Y., Watanabe, T., Levin, D. E. and Ohya, Y. (1996). Identification of Yeast Rho1p GTPase as a Regulatory Subunit of 1,3-beta -Glucan Synthase �� ��, 272, (5259): 279-281.
Rapp, A. and Versini, G., Eds. (1991). Influence of nitrogen compounds in grapes on aroma compounds of wine. Proceedings of the International Symposium on Nitrogen in Grapes and Wines. Davis, C. A., American Society for Enology and Viticulture.
Ratcliffe, J., Hossack, G., Wheeler, G. and Rose, A. (1973). Modifications to the phospholipid composition of ��������������� � induced by exogenous ehtanolamine. ����������������� ���! �����, 76, 445-449.
Ree, E. M. R. and Stewart, G. G. (1997). The effects of increased magnesium and calcium concentrations on yeast fermentation performance in high gravity worts. ��������������*�� ���������. ��, 103, 287-291.
Regenberg, B., Düring-Olsen, L., Kielland-Brandt, M. C. and Holmberg, S. (1999). Substrate specificity and gene expression of the amino-acid permeases in ��������������� �. ���������� �, 36, (6): 317-328.
Regenberg, B., Holmberg, S., Olsen, L. D. and Kielland-Brandt, M. C. (1998). Dip5p mediates high-affinity and high-capacity transport of L-glutamate and L-aspartate in ��������������� �. ���������� �, 33, (3): 171-177.
Reiner, S., Micolod, D., Zellnig, G. and Schneiter, R. (2006). Genomewide screen reveals a role of mitochondria in anaerobic uptake of sterols in yeast. ��������� ���������������, 17, (1): 90-103.
Richardson, A. J., Calder, A. G., Stewart, C. S. and Smith, A. (1989). Simultaneous determination of volatile and non-volatile acidic fermentation products of anaerobes by capillary gas chromatography. 6���� ������ �� ���! �����, 9, (1): 5-8.
Rodrigues, F., P., L. and Leao, C. (2006). Sugar metabolism in yeasts: an overview of aerobic and anaerobic glucose catabolism. Biodiversity and Echophysiology of yeasts. P. Gabor and R. Carlos. Heidelberg, Springer 101-121.
Rolfes, R. J. and Hinnebusch, A. G. (1993). Translation of the yeast transcriptional activator GCN4 is stimulated by purine limitation: implications for activation of the protein kinase GCN2. ���� ������', 13, (8): 5099-5111.
Romano, P., Fiore, C., Paraggio, M., Caruso, M. and Capece, A. (2003). Function of yeast species and strains in wine flavour. *������ ����� �������� ��� ����� ���! �����, 86 169-180.
Rose, M. and Botstein, D. (1983). Construction and use of gene fusions to ���8 (beta-galactosidase) that are expressed in yeast. ����� ����,�������, 101, 161-80.
Rosenfeld, E., Bertrand Beauvoit, B., Blondin, B. and Salmon, J. (2003). Oxygen consumption by anaerobic ������������ ��� � under enological conditions: Effect on fermentation kinetics. ���� �� ���� ��� ��������� ���! �����, 69, (1): 113-121.
Rossignol, T., Dulau, L., Julien, A. and Blondin, B. (2003). Genome-wide monitoring of wine yeast gene expression during alcoholic fermentation. 7���20, 1369-1385.
Rouillon, A., Surdin-Kerjan, Y. and Thomas, D. (1999). Transport of sulfonium compounds. Characterization of the s-adenosylmethionine and s-methylmethionine permeases from the yeast ������������ ��� �. ������������ ���� ������� ���, 274, (40): 28096-28105.
Roy, A., Lu, C. F., Marykwas, D. L., Lipke, P. N. and Kurjan, J. (1991). The �����product is involved in cell surface attachment of the ��������������� � cell adhesion glycoprotein a-agglutinin. �������� ���� � �����, 11, 4196-4206.
Russell, I. (2006). Yeast Handbook of Brewing. F. G. Priest and G. G. Stewart. New York, CRC Press�288-332.
Rytka, J. (1975). Positive selection of general amino acid permease mutants in ��������������� �. ���������������� �����, 121, (2): 562-570.
Sambrook, J., Fritsch, E. and Maniatis, T. (1989). ������������ ��/���6�!�������� �����. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory.
Sanglard, D., Kuchler, K., Ischer, F., Pagani, J. L., Monod, M. and Bille, J. (1995). Mechanisms of resistance to azole antifungal agents in ����� ��� ��! ��� isolates from AIDS patients involve specific multidrug transporters. ��� � ���! ����������������������, 39, 2378-2386.
Sattlegger, E. and Hinnebusch, A. G. (2000). Separate domains in �����for binding protein kinase ���&� and ribosomes are required for ���&� activation in amino acid-starved cells. � �5��, 19, (23): 6622-6633.
Schmidt, A., Hall, M. N. and Koller, A. (1994). Two FK506 resistance-conferring genes in ������������ ��� �, ���� and ���&, encode amino acid
permeases mediating tyrosine and tryptophan uptake. ������������� �����, 14, (10): 6597-6606.
Schqtz, M. and Gafner, J. (1993). Analysis of yeast diversity during spontaneous and induced alcoholic fermentations. ��������������� ������� �����, 75, 551-558.
Schreve, J. L. and Garrett, J. M. (2004). Yeast Agp2p and Agp3p function as amino acid permeases in poor nutrient conditions. � ���� ���� ���� � ���� ����#����������� ��� ��, 313, (3): 745-751.
Schreve, J. L., Sin, J. K. and Garrett, J. M. (1988). The ������������ ��� ��7��? (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. ���������������� �����, 180, (9): 2556-2559.
Segal, E. (1994). Cell wall. Pathogenic yeast and yeast infections. E. Segal and G. L. Baum. Salem, CRC Press�23-32.
Sengstag, C. and Hinnenbach, A. (1988). A 28-bp segment of the ��������������� � %)4? upstream activator sequence confers phosphate control to the CYC-���8 gene fusion. ��, 67, (2): 223-228.
Sentandreu, R. and Northcote, D. H. (1969). Yeast cell-wall synthesis. � ���� ���, 115, 231-240.
Sentheshanmuganathan, S. (1960). The mechanism of formation of higher alcohols from amino acids by ��������������� �. � ���� ���, 74, 568-576.
Shannon, K. W. and Rabinowitz, J. C. (1988). Isolation and characterization of the Saccharomyces cerevisiae *��� gene encoding mitochondrial C1-tetrahydrofolate synthase. �������� ��� � ���� ������� ���, 263, (16): 7717-7725.
Shepherd, M. G. (1987). Cell envelope of ���� ��� ��! ���. �� � ���� #� .� �� ���! �����, 15, 7-25.
Sinclair, D. A. (1995). Biochemcial and genetic charcterisation of �-�. Molecular Biology and Biochemistry. Sydney, UNSW. ����.
Sinclair, D. A. and Dawes, I. W. (1995). Genetics of the synthesis of serine from glycine and the utilization of glycine as sole nitrogen source by ��������������� �. ��� �, 140, (4): 1213-1222.
Sinclair, D. A., Hong, S.-P. and Dawes, I. W. (1996). Specific induction by glycine of the gene for the P-subunit of glycine decarboxylase from ��������������� �. �������� ���! �����, 19, (3): 611-623.
Skoneczny, M. and Rytka, J. (2000). Oxygen and haem regulate the synthesis of peroxisomal proteins: catalase A, acyl-CoA oxidase and Pex1p in the yeast ������������ ��� �; the regulation of these proteins by oxygen is not mediated by haem. � ���� ���, 350, 313-319.
Snoek, I. S. I. and Steensma, H. Y. (2007). Factors involved in anaerobic growth of ��������������� �. 7��, 24, 1-10.
Som, I., Mitsch, R. N., Urbanowski, J. L. and Rolfes, R. J. (2005). DNA-bound Bas1 recruits Pho2 to activate �-��genes in ��������������� �. ��2����� �����, 4, (10): 1725-1735.
Springael, J. Y. and André, B. (1998). Nitrogen-regulated ubiquitination of the �����permease of ��������������� �. ��������� ���������������, 9, (6): 1253-1263.
Springer, C., Künzler, M., Balmelli, T. and Braus, G. H. (1996). Amino acid and adenine cross-pathway regulation act through the same 5'-TGACTC-3' motif in the yeast )*�<� promoter. �������� ��� � ���� ���� ��� ���, 271, (47): 29637-29643.
Stassi, P., Rice, J. F., Munroe, J. H. and Chicoye, E. (1987). Use of CO2 evolution rate for the study and control of fermentation. �������� ����>��������23, (2): 37-43.
Steffen, K. K., Mackay, V. L., Kerr, E. O., Tsuchiya, M., Hu, D., Fox., L. A., Dang, N., Johnston, E. D., Oakes, J. A., Tchao, B. N., Pak, D. N., Fields, S. and Kennedy, B. K. (2008). Yeast life span extension by depletion of 60S ribosomal subunits is mediated by ���". ���, 133, 292-302.
Subramanian, M., Qiao, W.-B., Khanam, N., Wilkins, O., Der, S. D., Lailch, J. D. and Bognar, A. L. (2005). Transcriptional regulation of the one- carbon metabolism regulon in ������������ ��� � by Bas1p. �������� ���! �����, 57, (1): 53-69.
Sundstrom, P. (2002). Adhesion in ���� �����' �������� ���! �����, 4, (8): 461-469.
Sychrova, H. and Chevallier, M. R. (1993). Cloning and sequencing of the ������������ ��� ��gene 67%��coding for a lysine-specific permease. 7��, 9, (7): 771-782.
Tabor, S. and Richardson, C. C. (1987). DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. %���� ������������ ����������������� ��, 84, (14): 4767-4771.
Taherzadeh, M. J., Lidén, G., Gustafsson, L. and Niklasson, C. (1996). The effects of pantothenate deficiency and acetate addition on anaerobic batch fermentation of glucose by ������������ ��� �. ���� �� ���! ������ ����� ����������, 46, (2): 176-182.
Taillandier, P., Portugala, F. R., Fuster, A. and Strehaian, P. (2007). Effect of ammonium concentration on alcoholic fermentation kinetics by wine yeasts for high sugar content ����� ���! �����, 24, (1): 95-100
Tanaka, J. and Fink, G. R. (1985). The histidine permease gene ()*%�) of ��������������� �. ��, 38, (1-3): 205-214.
ter Linde, J. J., Liang, H., Daris, R. W., Steensma, H. Y., van Dijken, J. P. and Pronk, J. T. (1999). Genome-wide transcriptional analysis of aerobic and anaerobic chemostate cultures of ������������ ��� �. �������� ��� ����� �����, 181, (24): 7409-7413.
Thevelein, J. M., Geladé, R., Holsbeeks, I., Lagatie, O., Popova, Y., Rolland, F., Stolz, F., Van de Velde, S., Van Dijck, P., Vandormael, P., Van Nuland, A., Van Roey, K., Van Zeebroeck, G. and Yan, B. (2005). Nutrient sensing systems for rapid activation of the protein kinase A pathway in yeast. � ���� ������� ���������� ��, 33, 253-256.
Thomas, D., Becker, A., and Surdin-Kerjan, Y. (2000). Reverse methionine biosynthesis from S-adenosylmethionine in eukaryotic cells. �������� ���� ���� ������� ���, 275, (52): 40718-40724.
Thomas, D., Hossack, J. and Rose, R. (1978). Plasma membrane lipid composition and ethanol tolerance in ��������������� �. ���� ������ ���! �����, 117, 239-245.
Thomas, D. and Surdin-Kerjan, Y. (1991). The synthesis of the two S-adenosyl-methionine synthetases is differently regulated in ������������ ��� �. ��������������������� �, 226, (1-2): 224-232.
Thomas, K. C. and Ingledew, W. M. (1990). Fuel alcohol production: effects of free amino nitrogen on fermentation of very-high gravity wheat mashes. ���� ��������� ��������� ���! �����, 56, 2046-2050.
Tong, A. H. Y., Evangelista, M., Parsons, A. B., Xu, H., Bader, G. D., Page, N., Robinson, M., Raghibizadeh, S., Hogue, C. W. V., Bussey, H., Andrews, B., Tyers, M. and Boone, C. (2001). Systematic genetic analysis with ordered arrays of yeast deletion mutants. �� ���294, 2364-2368.
Trinel, P. A., Lepage, G., Jouault, T., Strecker, G. and Poulain, D. (1997). Definitive chemical evidence for the constitutive ability of����� �����! ��� serotype A strains to synthesize beta-1,2 linked oligomannosides containing up to 14 mannose residues. �����6���, 416, (2): 203-206.
Trotter, P. J. and Voelker, D. R. (1995). Identification of a non-mitochondrial phosphatidylserine decarboxylase activity (%�-&) in the yeast ��������������� �. ������������ ���� ������� ���, 270, (11): 6062-60670.
Tsoi, B. M., Beckhouse, A. G., Gelling, C. L., Ratfery, M. J., Chui, J., Tsoi, A. M., Lauterbach, L., Rogers, P., Higgins, V. and Dawes, I. W. (2009). Essential role of one-carbon metabolism and Gcn4p and Bas1p transcriptional regulators during adaptation of anaerobiosis growth of ��������������� �. ������������ ���� ������� ���, 284, (17): 11205-11215.
Tsukahara, K., Hata, K., Sagane, K., Watanabe, N., Kuromitsu, J., Kai, J., Tsuchiya, M., Ohba, F., Jigami, Y., Yoshimatsu, K. and Nagasu, T. (2003). Medicinal genetics approach towards identifying the molecular target of a novel inhibitor of fungal cell wall assembly. �������� ���! �����, 48, 1029-1042.
Ulane, R. and Ogur, M. (1972). Genetic and physiological control of serine and glycine biosynthesis in �����������. ���������������� �����, 109, (1): 34-43.
Umemura, M., Okamoto, M., Nakayama, K., Sagane, K., Tsukahara, K., Hata, K. and Jigami, Y. (2003). GWT1 gene is required for inositol acylation of glycosylphosphatidylinositol anchors in yeast. �������� ��� � ���� ������� ���, 278, (26): 23639-23647.
Valerius, O., Brendel, C., Wagner, C., Krappmann, S., Thoma, F. and Braus, G. H. (2003). Nucleosome position-dependent and independent acitivation of )*�<�expression in ��������������� ��by different transcriptional activators. ��2����� �����, 2, (5): 876-885.
van de Rest, M. E., Kamminga, A. H., Nakano, A., Anraku, Y., Poolman, B. and Konings, W. N. (1995). The plasma membrane of ��������������� � structure, function and biogenesis. ���! ���� ����#� ., 59, (2):
van den Brink, J., Daran-Lapujade, P., Pronk, J. T. and H., d. W. J. (2008). New insights into the ������������ ��� � fermentation switch: Dynamic transcriptional response to anaerobicity and glucose-excess. � ������ �, 9, (100):
van der Varrt, J. M., Caro, L. H., Chapman, J. W., Klis, F. M. and Verrips, C. T. (1995). Identification of three mannoproteins in the cell wall of ��������������� �. ���������������� �����, 177, (11): 3104-3110.
van Iersel, M. F. M., van Dieren, B., Rombouts, F. M. and Abee, T. (1999). Flavor formation and cell physiology during the production of alcohol-free beer with immobilized ������������ ��� �. ��,��� ���� ���! ��� ���������, 24 (7): 407-411.
Vandenbol, M., Jauniaux, J. C. and Grenson, M. (1989). Nucleotide sequence of the ��������������� � %$�"�proline-permease-encoding gene: similarities between ����, )*%��and %$�"�permeases. ��, 83, (1): 153-139.
Varela, C., Cardenas, J., Melo, F. and Agosin, E. (2005). Quantitative analysis of wine yeast gene expression profiles under winemaking conditions. 7��, 22, 369-383.
Wainwright, T. (1971). Biochemisty of Brewing. Modern brewing technology. W. P. K. Findlay. London, Macmillan press�129-163.
Walker, G. M. (1994). The roles of magnesium in biotechnology. �� � ����#� .� ��� ����������, 14, (4): 311-354.
Walker, G. M. (1998a). Magnesium as a stress-protectant for industrial strains of ������������ ��� �. �������� ��� ��� ��� ���� ��� ��� ��� ��. ������ ���56, (3): 109-113.
Walker, G. M. (1998b). 7������ ����������! ����������. Chichester, John Wiley & Sons.
Walker, G. M. (2004). Metals in yeast fermentation processes. Advances in Applied Microbiology A. I. Laskin, J. W. Bennett and G. M. Gadd. New York, Elsevier Academic Press. ���197-230.
Walker, G. M. and Duffus, J. H. (1980). Magnesium ions and the control of the cell cycle in yeast. ����������������� ��, 42, (1): 329-356.
Walker, G. M. and Maynard, A. I. (1997). Accumulation of magnesium ions during fermentative metabolism in ������������ ��� �. �������� ��� *����� ��� ���! ����������� ����������, 18, (1): 1-3.
Wek, R. C., Jackson, B. M. and Hinnebusch, A. G. (1989). Juxtaposition of domains homologous to protein kinases and histidyl-tRNA synthetases in ���&�protein suggests a mechanism for coupling ���"� expression to amino acid availability. %���'�����'�����'��� '�$'�'�', 86, (12): 4579-4583.
West, M. G., Horne, D. W. and Appling, D. R. (1996). Metabolic role of cytoplasmic isozymes of 5,10-methylenetetrahydrofolate dehydrogenase in ��������������� �. � ���� ���, 35, (9): 3122-3132.
West, M. G., Horne, D. W., Appling, D. R (1996). Metabolic role of cytoplasmic isozymes of 5,10-methylenetetrahydrofolate dehydrogenase in Saccharomyces cerevisiae. . � ���� ���, 35, (9): 3122-32.
White, T. C. (1997). Increased mRNA levels of �#��@, �-#, and -#��correlate with increases in azole resistance in ���� �����! ����isolates from a patient infected with human immunodeficiency virus. ��� � ���! ��� ����� ��������������, 41, 1482-1487.
Wiebe, M. G., Rintala, E., Tamminen, A., Simolin, H., Salusjärvi, L., Toivari, M., Kokkonen, J. T., Kiuru, J., Ketola, R. A., Jouhten, P., Huskonen, A., Maaheimo, H., Ruohonen, L. and Penttilä, M. (2008). Central carbon metabolism of ������������ ��� � in anaerobic, oxygen-limited and fully aerobic steady-state conditions and following a shift to anaerobic conditions. �� ��7���#����, 8, 140-154.
Wikén, T. O., Verhaar, A. J. M. and Scheffers, W. A. (1962). The influence of potassium and sodium ions on the negative pasteur effect in� ���������������� �custers ���� ����� ���! �����, 42 (2): 226-236.
Willaert, R. and Nedovic, V. A. (2006). Primary beer fermentation by immobilised yeast—a review on flavour formation and control strategies. �������� ������ ��������������1�� ����������, 81, (8): 1353-1367.
Wu, J., Zhang, N., Hayes, A., Panoutsopoulou, K. and Oliver, S. G. (2004). Global analysis of nutrient control of gene expression in ������������ ��� � during growth and starvation. %���� ��� ��� ��� ��� ����� ������� ����� ��, 101, 3148-3153.
Xiao, W., Ed. (2006). Methods in Molecular Biology: Yeast Protocols. Extraction of Yeast Lipids. Totowa, New Jersey, Humana Press Inc.
Yamauchi, Y., Okamoto, T., Murayama, H., Nagara, A., Kashihara, T., Yoshida, M. and Nakanishp, K. (1995). Rapid fermentation of beer using an immobilized yeast multistage bioreactor system ���� ��� ���� ���� ����� ����������, 53, (3): 245-259.
Yeh, C. J., Hsi, B. L. and Faulk, W. P. (1981). Propidium iodide as a nuclear marker in immunofluorescence. II. Use with cellular identification and viability studies. �����������*�������� ���� ����, 43, (3): 269-275.
Yin, Q. Y., de Groot, P. W. J., Dekker, H. L., de Jong, L. and Klis, F. M. (2005). Comprehensive proteomic analysis of ������������ ��� � cell walls. ������������ ���� ������� ���, 280, (21): 20894-20901.
Yoshioka, K. and Hashimoto, N. (1981). Ester Formation by Alcohol Acetyltransferase from Brewers' Yeast. ��� �������������� ���� ������� ���, 45, (10): 2183-2190.
Yoshioka, K. and Hashimoto, N. (1983). Cellular Fatty Acid and Ester Formation by Brewers' Yeast. ��� �������������� ���� ������� ���, 47, (10): 2287-2294.
Zhang, F., Kirouac, M., Zhu, N., Hinnebusch, A. G. and Rolfes, R. J. (1997). Evidence that complex formation by Bas1p and Bas2p (Pho2p) unmasks the activation function of Bas1p in an adenine-repressible step of �-� gene transcription. ������������� �����, 17, 3272-3283.
Zhu, X., Garrett, J., Schreve, J. and Michaeli, T. (1996). ��%�, the high-affinity glutamine permease of �'���� �. ���������� �, 30, (2): 107-114.
Zlotnik, H., Fernandez, M. P., Bowers, B. and Cabib, E. (1984). ��������������� � mannoproteins form an external cell wall layer that determines wall porosity. ���������������� �����, 159, (3): 1018-1026.
Appendix Table 1. Proteins peptide found in various time point in wild type BY4743 and gcn4 mutant by mass spectrometry Protein Measured mass (Da) Mascot score % of peptide found no. of time found
name wt gcn4 wt gcn4 wt gcn4 wt gcn4
Yin Tsoi Yin Tsoi Yin Tsoi Yin Tsoi
0h 0h 24h 0h 24h 48h 24h* 0h 0h 24h 0h 24h 48h 24h* 0h 0h 24h 0h 24h 48h 24h* 0h 0h 24h 0h 24h 48h 24h*
Ccw14p YLR391wp 1583.8 1001.5 871.41 1524.6 1258 871 871 116 20 31 57 20 21 40 11.8 8.93 6.47 0.81 1.72 3.33 2 1 1 2 2 1 1 1
2221 1072.5 1001.5 1525 39 38 26 47 1 2 2 2
3475.7 1395.6 1138.5 29 49 36 1 2 2
2675 1520.6 1395.6 32 53 39 1 2 1
2803.1 1583.8 1524.6 40 62 51 1 4 2
1272.4 1653.6 1653.6 24 60 66 1 2 2
2259 1723.7 45 28 1 2
2130.9 2037.9 142 53 1 2
2152.9 56 2
2675.1 34
Cis3p YJL158cp 828.48 828.48 828.48 1900 828 828 85 59 62 56 59 59 4.02 8.82 5.28 2.87 10 8 2 2 7 3 2 2
960.55 943.41 1899.9 1902 1075 1075 42 28 66 77 27 32 2 1 6 2 1 2
1554.8 1074.6 29 45 1 1
1556.7 1226.6 23 43 1 2
1899.9 1469.7 32 57 1 1
1901.8 1669.8 50 21 2 1
1724.9 21 1
1899.9 61 2
1901.8 50 2
2020 43 2
Crh1p YGR189cp 808.41 653.35 713.47 713.46 823.4 713 713 27 34 24 37 46 24 36 8.82 4.46 4.12 5.28 2.87 6.67 8 1 2 2 4 1 1 1
1241.6 713.47 1213.6 823.38 1214 1214 823 111 25 36 49 52 26 27 1 1 1 2 2 1 1
1121.5 1246.5 1246.5 934.48 1462 1214 23 48 57 51 59 35 1 2 2 3 2 1
1325.6 1461.7 2012.9 1213.6 1326 24 54 90 58 34 1 2 2 2 1
1081.6 1781.8 1461.7 49 90 56 1 2 2
1209.7 2012.9 45 77 1 1
Crh2p YEL040wp 1826.8 1077.5 1087.6 1077.5 1078 17 83 30 92 72 2.94 1.34 2.35 1.63 1.15 1 1 2 4 2
1110.6 1205.5 1205.5 22 33 29 1 1 2
1487.7 31 1
Cwp1p YKL96wp 1250.6 638.26 908.46 907.46 908.5 845 958 63 31 38 47 49 22 33 19.1 7.14 5.29 6.5 12.1 16.7 10 1 2 2 4 4 1 1
1136.7 908.46 1086.5 1086.5 1087 1090 1089 49 22 52 41 33 33 44 1 1 2 2 4 2 1
1945.9 936.46 1089.5 1214.7 1215 1228 1228 90 21 63 61 50 35 42 1 1 2 4 5 1 1
1352.8 1048.6 1329.7 1225.6 1330 1251 1251 57 34 54 42 59 29 33 1 1 2 2 8 1 2
1640.8 1089.5 1640.75. 1329.7 135 46 53 55 1 1 1 4
1882 1166.5 83 29 1 2
1847.9 1250.6 102 43 1 2
1397.6 1329.7 89 48 1 2
2225.1 1470.7 84 60 1 3
958.49 1640.8 65 41 1 1
2030 59 1
1089.5 63 1
1544.8 35 1
Ecm33p YBR078wp 1202.6 1286.7 754.33 754.33 1003 1203 1045 43 63 36 34 31 33 20 7.35 2.68 7.06 3.25 2.87 6.67 6 1 1 2 3 1 1 1
1574.9 1507.8 1002.5 1002.5 1287 1526 1287 65 30 49 40 76 54 48 1 2 2 2 1 1 1
1318.6 1525.8 1078.6 1286.7 1331 1526 60 71 20 79 62 59 1 2 1 2 1 1
1623.8 1574.8 1095.6 1705.9 1478 56 40 20 49 56 1 1 1 1 2
1751.9 1330.7 10 22 1 1
1507.8 22 1
1525.8 78 2
1574.8 56 2
Gas1p YMR307wp 1255.7 828.48 828.48 1127.6 963.5 1255 828 18 31 31 26 31 31 26 5.88 5.36 3.53 3.25 3.45 3.33 4 1 2 2 4 2 1 1
1699.8 956.58 1322.6 1423.7 1128 1255 48 28 30 40 50 60 1 1 2 1 2 1
1694.8 1078.5 1588.7 1662.8 1424 48 40 50 57 45 1 2 2 3 1
1192.5 1254.7 1663 57 92 39 1 2 1
1310.6 30 1
1322.6 36 2
1588.7 62 2
Gas3p YMR215wp 1427.7 1062.5 1097.5 996.49 996.5 1307 33 25 35 45 21 30 7.35 4.02 2.35 7.72 7.47 2 1 2 2 4 1 1
1543.8 1135.6 1306.6 1135.6 1062 86 35 33 22 43 1 2 1 1 1
1577.8 1423.6 1423.6 1266.6 1136 58 63 51 42 68 1 2 1 2 3
1513.7 1621.6 1423.6 1267 23 61 70 67 1 2 3 1
1256.6 1782.9 1580.8 1581 43 48 78 46 1 1 2 2
1621.6 1622 47 29 2 3
1724.9 1725 54 64 3 2
1782.9 28 2
Gas5p YOL030wp 1125.6 1159.6 1159.5 1289.6 1988 1160 1160 34 30 25 41 67 21 31 5.88 4.46 5.88 2.85 1.72 3.33 4 1 2 2 5 3 1 2
886.49 1182.6 1182.6 1987.9 22 55 54 61 1 2 1 2
1819.8 1289.6 1313.6 17 44 27 1 2 1
1599.8 1393.7 1393.7 42 88 46 1 1 1
1987.9 1528.7 74 40 3 1
1632.7 42 2
1987.9 75 2
Gls1p YGL027cp 1168.6 606.35 713.48 357.8 49 25 27 27 12.5 8.24 11.8 8.62 2 1 2 1
1243.5 614.38 766.39 420.2 28 21 23 30 2 1 2 1
1310.6 694.4 771.42 437.7 31 23 29 23 1 1 1 1
1330.6 713.48 873.44 585.3 45 21 22 51 2 1 2 2
1344.7 1110.6 1002.5 607.9 37 24 27 39 1 1 1 1
1383.6 1168.6 1213.7 624.3 46 42 46 74 2 1 2 2
1425.8 1243.5 1243.5 873.4 46 24 33 25 2 2 2 1
1529.7 1425.8 1257.7 897.5 31 57 23 65 1 2 1 1
1615.8 1511.8 1258.6 1214 56 38 30 29 2 2 2 1
1783.9 1529.7 1313.6 1426 56 50 27 93 4 2 4 2
1819.8 1315.6 1793 68 42 70 2 2 2
1826.9 1425.8 60 84 2 2
1942 1476.7 32 40 1 3
2041 1942.1 58 68 2 3
2108.9 88 2
Gls2p YGL027cp 606.35 713.48 25 27 6.1 2
614.38 766.39 21 23 1
694.4 1213.7 23 46 3
713.48 1243.5 21 33 3
1088.5 1258.6 39 30 2
1168.6 1425.8 42 84 1
1243.5 1476.7 24 40 1
1364.7 1810.9 41 21 1
1425.8 1942.1 57 68 1
1463.8 43
1511.8 38
1529.7 50
1793.9 41
1810.9 62
2090.9 66
Pir1p YKL164cp 1078.5 828.48 759.41 759.41 1805 759 86 85 25 22 52 33 4.41 5.36 13.5 13.4 13.8 14 1 2 2 4 3 3
1675.7 945.39 828.48 828.48 1868 828 18 22 59 62 74 59 1 1 2 5 11 3
2175.9 1072.4 958.38 1804.9 1904 1079 82 33 51 56 55 32 1 2 2 3 1 1
1078.5 1072.4 1867.9 2418 30 28 68 28 1 2 3 3
1455.7 1226.6 1903.8 2522 21 43 68 50 1 2 4 6
1513.6 1455.7 2146.9 37 22 43 1 2 4
1556.7 1469.7 2418.2 23 57 43 1 1 6
2168 1620.7 2522.2 62 39 30 2 1 4
2522.3 1627.7 36 30 1 1
1867.9 43 2
2020 43 2
2168 26 1
2522.2 37 3
Pir2p YJL159wp 1092.5 83 2.94 1
1376.7 58 1
Pir3p YKL163wp 2270.1 828.48 50 85 1.47 4.46 1 2
837.36 29 2
945.39 22 1
1455.7 21 1
1556.7 23 1
2168 62 2
2522.3 36 1
Pmt1p YDL095wp 857.53 875.49 875.48 965.4 1028 20 22 22 33 31 3.13 1.18 3.25 6.32 4 1 1 2 2 1
965.42 1027.5 1128.7 1082 1129 26 56 57 36 29 1 1 1 3 1
1027.5 1239.7 1259 54 23 40 2 1 3
1261.6 1369.7 1370 39 38 30 2 1 1
2021.9 1459.7 1460 127 40 32 1 1 2
1505.8 56 2
Pmt2p YAL023cp 1187.7 861.47 766.4 1370 802 52 20 29 43 24 3.13 3.53 5.28 6.32 2 1 1 4 5 1
1369.8 976.52 1369.7 1441 39 22 47 38 2 2 2 3
1440.7 1417.8 1440.7 1647 41 39 33 80 2 1 4 2
1646.7 1440.7 1646.7 1835 80 29 80 43 1 1 2 1
1834.9 1650.8 1834.9 34 57 58 1 1 1
Pmt4p YJR143cp 615.37 615.37 1247.7 28 26 34 2.23 1.76 1.22 1 1 1
1247.7 798.5 1444.7 30 31 31 2 1 2
1444.7 1867 78 50 2 1
1866.9 45
Pry3p YJL078cp 1677 974.41 1084.5 1067.5 21 47 31 32 2.94 1.79 1.18 2.03 1 2 2 2
1084.5 1084.5 1368.6 22 45 37 1 2 3
Pyr1p YKL216wp 729.4 1028.6 813.37 813.4 28 42 30 27 19.6 3.53 15.4 18.4 2 2 2 2
785.43 1453.8 815.43 913.6 34 39 34 47 1 1 1 3
808.41 1541.9 913.56 967.5 26 29 43 21 2 2 2 1
813.37 1638.8 976.51 1020 23 49 49 31 1 1 2 1
872.51 1026.5 1026 35 38 34 2 2 1
1006.5 1028.6 1051 21 45 27 1 3 1
1028.6 1274.7 1113 28 53 65 2 2 2
1054.6 1307.7 1226 33 37 22 2 2 1
1083.5 1363 1255 29 38 65 2 2 2
1136.7 1392.8 1257 28 69 78 2 2 2
1233.7 1444.7 1282 30 29 52 2 2 3
1234.7 1470.7 1308 30 53 40 2 1 2
1251.6 1490.7 1364 39 39 56 1 1 2
1256.6 1541.9 1445 45 58 21 1 3 2
1267.8 1602.9 1471 48 21 31 2 2 2
1317.6 1638.8 1535 23 68 50 1 1 3
1434.8 1745 1542 40 38 82 2 2 1
1453.8 2276.1 1639 56 29 73 2 2 1
1467.7 2334.3 25 29 2 2
1470.7 2393.2 76 44 2 2
1541.9 44 2
1543.8 31 1
1602.9 33 2
1638.8 79 2
1891.9 83 2
2097.1 32 1
Scw4p YGR279cp 1533.7 908.42 980.46 980.5 51 29 31 31 10.3 2.68 1.22 4.02 1 2 2 2
2018 1087.6 1251.6 1024 93 21 49 30 1 1 1 2
1685.8 1251.6 1085 113 50 23 1 2 1
1049.5 1504.7 1107 49 25 52 1 1 2
1257.7 37 1
1108.6 42 1
980.51 11 1
Ser3p
**
YER081wp 1064.5 616.39 730 800 41 23 29 29 2 2 1 1
1181.6 730.39 800 879 32 21 27 28 2 1 1 1
1478.9 800.48 879 1018 31 27 29 34 2 1 1 1
1769.9 844.42 1018 1055 57 30 35 23 2 1 1 1
2036 879.49 1055 1065 75 28 24 49 2 2 1 1
950.49 1065 1083 61 37 20 2 1 1
981.44 1182 1110 34 35 43 2 1 1
1065.5 1285 1182 24 35 37 1 1 1
1082.6 1419 1260 31 32 32 1 1 1
1109.6 1285 22 56 1 1
1175.6 1419 27 40 1 2
1272.7 2036 43 59 1 1
1310.6 44 1
1345.7 60 1
1418.6 68 2
1475.9 52 3
1702.8 65 2
1769.9 78 3
2036 87 4
Shm2p YLR058cp 897.41 650.36 1513 822 822 31 24 45 34 35 1 2 1 1 1
**
43 35 33 25 30 26 1 2 2 1 1
48 35 29 25 1 1 1
44 23 20 1 1
6.5 39 2
6.6 22 1
2.7 45 4
9.7 33 1
3.9 39 1
p .2 7 4 1 1 1 3 4 1 1
0.6 23 1 1 1
6.8 84 2
p 0.41 1 1
3.7 5 813 84 45 72 28 45 1 1 2 2 1
1.6 24 30 65 1 1 5
3.7 48 72 58 7 1 2
8.7 34 2
0.7 29 5
6.7 50 1
1.9 20 1
6.8 83 2
2 100 2
p 408 928 28 25 13.3 4 2 2
465 29 1
634 43 1
p 26 31 3.33 2 1 1
.7 45 4.41 1
.7 13 1
.6 44 1
9 8 1 1 2 1 1 1
9 1 1 3 1 1 1
0.7 1.6 30 53 57 56 32 2 2 2 1 1
3 45 41 45 1 3 1
0.7 23 1
8 39 2
998.45 840. 215
8 1015 1008
157
1.8 916. 1015
939. 1120
107
114
151
152
170
Tip1 YBR067cp
2070
1696.8
669.44 1696.8 169
784 784 69 66 27 26 43 33 28 1.47 0.45 2.35 1.22 2.3 6.67
116 1697 1697 50 50
169
Tir1 YER011wp
1983 1246.6 669.41 1540.7 722 722 33 24 22 30 23 21 2.94 0.89 14.1 16.7 18 1 1 1 1
1621 128
960. 1247
125 1247 1284
128 1284 1541
133
154
155
181
182
201
Tir2
Tir3 1212 1212
Tos1p
YBR162cp
1417
2899
1050
Ygp1p
YNL160wp
803.38 975.49 1188.7 118 1018 1018 20 27 22 28 30 26 1.79
4.71
2.03
4.02
10
1129.6 1129.6 2553.3
119 1130 1073 24 26 56 49 32 45
141
126 1788 118
9 1130
1403.7 255
1189
141
178
* Medium supplemented with L-serine 68 224 170 246 174 30 50
** Are not cell wall proteins
0
0.03
0.06
0.09
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.2
0.4
0.6
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.02
0.04
0.06
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
D
0
0.05
0.1
0.15
0 3 6Time (h)
Co
nc.
(µ mo
l/10
8 c
ell
s)
0
0.25
0.5
0.75
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.15
0.3
0.45
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
A B
C
E F
Appendix Figure 1. Intracellular concentrations of L-Ala(A); L-Arg (B); L-Gln (C); L-Glu (D);
L-His (E); L-Ile (F) in wild-type and gcn4 mutant following a shift to anaerobiosis.
L-Ala L- Arg
L-GlnL-Glu
L-His L-Ile
0
0.15
0.3
0.45
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.2
0.4
0.6
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.15
0.3
0.45
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.2
0.4
0.6
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.4
0.8
1.2
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.1
0.2
0.3
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
G H
IJ
K L
L-Leu
L-Met
L-Pro
L-Lys
L-Phe
L-Try
Appendix Figure 1. Intracellular concentrations of L-Leu(G); L-Lys (H); L-Met (I); L-Phe (J);
L-Pro (K); L-Try (L) in wild-type and gcn4 mutant following a shift to anaerobiosis.
0
0.05
0.1
0.15
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
0
0.2
0.4
0.6
0 3 6Time (h)
Co
nc (µ m
ol/
10
8 c
ell
s)
M NL-Tyr L-Val
Appendix Figure 1. Intracellular concentrations of L-Tyr(M); L-Val (N) in wild-type and gcn4 mutant
following a shift to anaerobiosis.
Top Related