E

Tapn

HQ

a

Cb

c

d

C

RA

B

0d

pilepsy Research (2011) 95, 94—99

journa l homepage: www.e lsev ier .com/ locate /ep i lepsyres

he identification of a novel mutation of nicotiniccetylcholine receptor gene CHRNB2 in a Chineseatient: Its possible implication in non-familialocturnal frontal lobe epilepsy

ui Liua,1, Cailing Lub,1, Zhenzhong Lid, Shiyi Zhoub, Xiaoqiao Lib,c, Liri Ji a,iang Lua, Ruijuan Lva, Liwen Wua,∗, Xu Mab,c,∗∗

Department of Neurology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences, Peking Union Medicalollege, 1, Shuaifuyuan, Dongdan, Beijing 100730, ChinaDepartment of Genetics, National Research Institute for Family Planning, 12, Dahuisi Road, Haidian, Beijing 100081, ChinaGraduate School of Peking Union Medical College, 5, Dongdansantiao, Dongdan, Beijing 100005, ChinaDepartment of Neurology, The Second Hospital of Hebei Medical University, 215, Hepingxi Road, Shijiazhuang, Hebei 050000,hina

eceived 13 August 2010; received in revised form 27 February 2011; accepted 6 March 2011vailable online 16 April 2011

KEYWORDSNocturnal frontallobe epilepsy;Mutational screening;CHRNB2

Summary Autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE) is partly caused bymutations in the nicotinic acetylcholine receptor (nAChR) genes CHRNA4, CHRNB2, and CHRNA2.Cases of non-familial nocturnal frontal lobe epilepsy (NFLE) are more common than the familialtype and the phenotypes of the two are similar. CHRNA4 mutations have been found in sporadicNFLE, but no mutation in CHRNB2 or CHRNA2 have been reported. To analyze the geneticfeatures of sporadic NFLE, we designed mutation screening of exon 5 of CHRNA4, exon 5 ofCHRNB2, and exon 6 of CHRNA2, mutations in which are associated with ADFLE. We screeneda group of 105 Chinese sporadic NFLE cases and identified a novel CHRNB2 mutation, V337G,in an evolutionary conserved region of the intracellular loop between transmembrane domainsM3 and M4 in one patient. This mutation was not observed in the control group of 200 subjects.

Bioinformatics analysis indicated that the mutation altered the hydrophobicity and secondarystructure of the protein. To thethat CHRNB2 is potentially assocor CHRNA2 were revealed by ou© 2011 Elsevier B.V. All rights re

∗ Corresponding author. Tel.: +86 10 65296381; fax: +86 10 65296382.∗∗ Corresponding author at: Department of Genetics, National Researcheijing 100081, China. Tel.: +86 10 62179059; fax: +86 10 62179059.

E-mail addresses: wlw1946@yahoo.com.cn (L. Wu), genetic@263.net.1 These authors contributed equally to this work.

920-1211/$ — see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.eplepsyres.2011.03.002

best of our knowledge, this study established for the first timeiated with non-familial NFLE patient. No mutations in CHRNA4r screening method.served.

Institute for Family Planning, 12, Dahuisi Road, Haidian,

cn (X. Ma).

eps(lHacPgTwp34muf(iP

t(sp

R

C

Ia2PshobapwfaomEic

aoFtr

i

A novel CHRNB2 mutation in sporadic epilepsy

Introduction

Autosomal dominant nocturnal frontal lobe epilepsy(ADNFLE) is genetically transmitted idiopathic partialepilepsy. ADNFLE is characterized by clustered attacks ofbrief motor seizures with hyperkinetic or tonic manifes-tations originating from the frontal lobe mostly duringthe non-rapid eye motion phase sleep. Patients’ physicalexaminations, brain imaging, and interictal EEG are usuallynormal, while ictal EEG and PET scans show the involvementof the frontal lobe in some patients. The age of onset is usu-ally during childhood and ranges from age 2 months to age52 (Cho et al., 2003; Scheffer et al., 1995).

ADNFLE is partly associated with mutations in the genesencoding the �4, �2, and �2 subunits of the neuronal nico-tinic acetylcholine receptor (nAChR), which is a member ofthe Cys-loop receptor family. The most abundant form ofheteromeric nAChR in the brain contains �4 and �2 subunits(Lindstrom, 1996). Subunits of Cys-loop receptors share asimilar topology, comprising a large N-terminal extracellu-lar domain, three closely linked transmembrane domains(M1—3), a large cytoplasmic domain, followed by a fourthtransmembrane domain (M4), and a short stretch of extra-cellular C-terminal amino acids (Sadtler et al., 2003). Todate, all the mutations in CHRNA4, CHRNB2, and CHRNA2identified in ADNFLE kindreds affect the first, second, orthird transmembrane domains (Aridon et al., 2006; De Fuscoet al., 2000; Steinlein et al., 1995). Clinically, sporadic noc-turnal frontal lobe epilepsy (NFLE) cases are more commonthan familial NFLE. Both types of disease have similar clin-ical feature; thus, it is supposed that the genetic basis ofnon-familial NFLE may resemble that of ADNFLE. In fact, denovo mutations in CHRNA4 have been found in a Lebaneseand a Chinese sporadic NFLE patient, respectively (Chen etal., 2009; Phillips et al., 2000). However, no mutations inCHRNB2 or CHRNA2 in non-familial NFLE cases have beenreported.

The purpose of the present study was to screen mutationsin CHRNA4, CHRNB2, and CHRNA2, in a group of 105 Chinesesporadic NFLE patients.

Subjects and methods

One hundred and five sporadic Chinese NFLE patientswere recruited from the epilepsy center in the PekingUnion Medical College Hospital. Based on clinical perfor-mance and video-EEG records, patients were diagnosedas frontal lobe epilepsy. The patients had no history ofhead trauma, encephalitis, meningitis, or any other neu-rological condition that was likely to cause epilepsy. Theneurological physical examinations and cranial MRIs of theaffected individuals did not show any abnormalities. Venousblood samples were collected and informed consent wasobtained from all the patients. Control DNA samples wereobtained from 200 Chinese unrelated healthy individu-als.

Genomic DNA was prepared from peripheral venous blood

of each subject. Mutational screening was performed bysequencing two or three polymerase chain reaction (PCR)amplified DNA fragments from each gene, spanning exon 5of CHRNA4, exon 5 of CHRNB2, and exon 6 of CHRNA2. These

hlft

95

xons encode the M1—3 regions that contribute to the ionore of the three nAChR proteins. Primers used for PCR andequencing reactions were designed by the Primer3 programhttp://frodo.wi.mit.edu/primer3/) according to the pub-ished sequences from NCBI GenBank (accession numbers:uman CHRNA4, NG 011931; Human CHRNB2, NG 008027;nd Human CHRNA2, NG 015827). Primer sequences and theharacteristics of the PCR products are shown in Table 1.CR was performed in a 30 �l volume containing 50 ng ofenomic DNA, 5 mM dNTP, 5 pmol of each primer, and 2.5 U ofaq DNA polymerase (Tiangen Biotech, Beijing, China). PCRas performed with the following amplification parameters:re-denaturation at 94 ◦C for 5 min; 35 cycles of 94 ◦C for0 s, annealing temperatures 58—60 ◦C for 30 s, and 72 ◦C for0 s; followed by a final incubation at 72 ◦C for 10 min. Theelting temperature (Tm) was established in experiments

sing the recommendations of Primer3. The purified PCRragments were sequenced by an ABI 3730 xl DNA AnalyzerApplied Biosystems, Foster City, CA, USA). Any mutationsdentified in the patients were screened in the controls byCR amplification and sequencing.

The hydrophobicities of the wild-type and mutated pro-eins were analyzed by DNAMAN 5.2.2 software programLynnon Corp., Quebec, Canada). The protein secondarytructures were analyzed by CLC Main Workbench 3 Softwarerogram (Aarhus, Denmark).

esults

linical description

n our study, 65.7% of the NFLE cases are male (69 of 105)nd the mean age of seizure onset was 9.5 years (6 months to5 years), which was approximately the same as the data inrovini’s clinical research (Provini et al., 1999). The seizurestarted with some vocalizations, awakening, followed byyperkinetic activity, dystonic posturing or tonic stiffeningf the limbs, mostly in the 1—2 h after falling asleep andefore awakening. Seizures were brief, shorter than 1 min,nd appeared in clusters, sometimes occurring 10—20 timeser night. Epileptic discharge, including sharp, spike, andave complexes, and � rhythms, in the left, right or bilateral

rontal leads were found in the 85.7% (90 in 105) of casesnd 25.6% (23 in 90) were synchronized in sleep. On thether hand, interictal EEGs of 15 (14.3%) patients were nor-al. Video-EEG monitoring was performed in nine patients.

pileptiform activities originated from the frontal areas dur-ng seizures in seven of them, while the ictal EEGs of twoases remained negative.

All the patients were treated with one of fourntiepileptic drugs (AEDs), including carbamazepine (CBZ),xcarbazepine, lamotrigine (LTG), and valproate (VPA).orty-nine (66.2%) of the 74 follow-up patients reacted wello the AEDs and were seizure-free; however, the seizureselapsed in four of them during or after drug withdrawal.

We discovered a missense mutation, V337G, in CHRNB2n a 19 year-old female sporadic NFLE patient. The patient

ad exhibited stiffening of limbs and head turning to theeft side 4—6 times in a cluster, within a few hours afteralling asleep since the age of 15. The interictal EEG showedhat epileptic discharge appeared in the right frontal leads

96 H. Liu et al.

Table 1 Primer sequences and characteristics of PCR products.

Primer sequence Amplicon size (bp) Amplicon % GC

CHRNA4 a F: TCTCACACCCTTCGCTCTCT 776 60.31Exon 5 R: TATGCATGGACTCGATGAGC

b F: CTCACTGGTCATCCCACTCA 426 64.32R: CTGGCTTTCTCAGCTTCCAG

c F: CATGCATAAGATGGCCAGTG 805 68.57R: CATAGCAGGCTTGGGAAGAG

CHRNB2 a F: AGGAGGAAGGAACGCTTAGG 629 56.76Exon 5 R: CTGGTGACGATGGAGAAGGT

b F: CGCTAGCCATCCTTGTCTTC 676 66.57R: GTCTATAGAACGCCGCTGCT

CHRNA2 a F: GGGTCTGACTTGGTTCTTCG 602 59.47Exon 6 R: CAGTGATGAGCAGCAGGAAG

b F: ATCTCCTGCCTCACTGTGCT 708 62.85GTG

wTaC

M

MesnitGMMf

Fs

R: TCACACTCTGCGGTAAG

hen drowsy and were synchronized during sleep (Fig. 1).he patient did not respond well to monotherapy with CBZnd has since become seizure free with the combined use ofBZ, VPA, and LTG.

utation analyses

utation analyses were performed for exon 5 of CHRNA4,xon 5 of CHRNB2 and exon 6 of CHRNA2 in the 105poradic Chinese NFLE patients. A heterozygous T-to-Gucleotide substitution was identified in exon 5 of CHRNB2n a female NFLE patient. The mutation was absent inhe control group (Fig. 2). The mutation causes a Val-to-

ly substitution at amino acid position 337, located in the3—M4 intracellular loop, 17 amino acids downstream of3. An alignment of the amino acid sequences of CHRNB2

rom various species showed that the V337G mutation is

Figure 1 Interictal EEG recordings of the patient with themutation in exon 5 of the CHRNB2 gene. The EEG showed spikeand slow wave complexes in the right frontal leads when thepatient was drowsy and � waves in occipital leads were reduced.

igure 2 Sequencing chromatographs of exon 5 of the CHRNB2 gene showing the heterozygous mutation T-to-G resulting in theubstitution of Val to Gly at amino acid position 337. Sequence from a sporadic NFLE patient without the mutation is shown above.

A novel CHRNB2 mutation in sporadic epilepsy 97

B2. Dark shaded background indicates conserved regions. An arrowation (V337G).

Figure 3 Alignment of partial amino acid sequences of CHRNabove the sequences indicates the position of the missense mut

located in an evolutionary conserved region (Fig. 3). Thehydrophobicity of the protein at the mutation site andthe neighboring regions is decreased when compared tothe wild-type protein (Fig. 4). Secondary structure pre-diction indicated that the V337G substitution significantlyaltered the structure of the surrounding region. In the wild-type CHRNB2, amino acid positions 334—348 form two betastrands. In the same region of the mutated protein, threealpha helixes and one beta strand are predicted to bepresent (Fig. 5). No mutations were found in the analyzedregions of CHRNA4 or CHRNA2 in these non-familial NFLEpatients.

Discussion

This study identified a novel mutation, V337G, of CHRNB2in a NFLE patient with limb stiffening during sleep peri-ods and an abnormal EEG. This the first identification of aCHRNB2 mutation in a non-familial NFLE patient. To date,eight mutations in three nAChR subunit genes have beenassociated with ADNFLE. S252F (Saenz et al., 1999), 263insL(Steinlein et al., 1997), S256L (Hirose et al., 1999) and T265I(Leniger et al., 2003) were identified in CHRNA4. V287L (De

Fusco et al., 2000), V287M (Phillips et al., 2001), and I312M(Bertrand et al., 2005) were identified in CHRNB2; and I279N(Aridon et al., 2006) were identified in CHRNA2. Severalmutations have been proven to reduce the Ca2+ depen-

Figure 4 Comparison of the hydrophobicities of the wild-typeand V337G mutant CHRNB2. The hydrophobicity profiles wereplotted using DNAMAN 5.2.2 program. The arrow indicates themutation site.

Figure 5 The protein secondary structures of part of the M3—M4 loop containing the V337G mutation. Predicted protein structuresecondary was designed in the CLC Main Workbench 3 program. The mutated amino acid is shadowed.

9

dct2trm(2ltl2la2ipgmbmlhNairtnefiatcw

atvsimnpmifmsl

oetiaspeso

A

Tg&N

R

A

B

C

C

D

G

G

H

H

K

L

L

L

8

ence of the �4�2 acetylcholine response in vitro, whichould trigger seizures by increasing the �4�2-mediated glu-amate release during such bouts (Rodrigues-Pinguet et al.,003). So far, NFLE mutations are largely restricted to theransmembrane domains, which could indicate the uniqueequirement for the conductance of the channel. Only oneutation has been found in the M3—M4 loop of CHRNA4

R308H) in a Chinese sporadic NFLE patient (Chen et al.,009). In this study, the CHRNB2 V337G mutation was alsoocated in the M3—M4 loop. The conductance of Cys-loopype ligand-gated ion channels is influenced by amino acidsocated within the transmembrane domain (Hales et al.,006). There is strong evidence that the M3—M4 intracel-ular loop is also associated with receptor desensitizationnd channel conductance (Gee et al., 2007; Kracun et al.,008). Evidence has also demonstrated that the M3—M4ntracellular loop domain of nAChR subunits can exert arofound influence on receptor folding, assembly, and tar-eting (Kracun et al., 2008; Lo et al., 2008). The V337Gutation identified in our study decreased the hydropho-icity and altered the protein secondary structure. Theutant protein with the V337G substitution in the evo-

utionarily conserved region of the M3—M4 loop probablyas impaired nAChR function and is the possible cause ofFLE in the single individual. In sporadic NFLE patients,CHRNA4 S252L and a R308H mutation have been found

n a Lebanese female patient and a Chinese male patient,espectively. In addition, it has not been previously reportedhat the CHRNB2 and CHRNA2 genes are associated withon-familial NFLE patients (Chen et al., 2009; Phillipst al., 2000). To the best of our knowledge, this is therst study to establish that CHRNB2 is potentially associ-ted with sporadic NFLE. Further investigation is neededo identify the causative nature and the pathophysiologi-al mechanism of this new mutation potentially associatedith NFLE.

Familial and non-familial NFLE patients are muchlike in their clinical characteristics, which implies thathe genetic basis of the two types should not beery different. The detection of CHRNA4 mutations inporadic NFLE patients has gone some way to validat-ng this assumption. In the present study, the CHRNB2utation in a sporadic NFLE patient demonstrates that

on-familial NFLE have a similar genetic background andathogenesis to familial NFLE. Since the first CHRNA2utation I279N was reported in an ADNFLE Italy fam-

ly, no other CHRNA2 mutations have been found in NFLEamilies or non-family NFLE cases (Gu et al., 2007). Noutation in CHRNA2 was found in this study. We can

peculate that CHRNA2 mutations are rare in NFLE popu-ations.

In our study, the screening of 105 NFLE cases identifiednly one mutation. In a German ADNFLE family, the pen-trance rate of the �4-T265I mutation was only 29%, andhe author considered the mode of inheritance in this fam-ly not to be an autosomal dominant pattern, but rather

major gene effect (Leniger et al., 2003). It has beenuggested that some other genetic factors may affect the

athogenicity of non-familial and even familial NFLE. Thexact genetic defects in familial and non-familial NFLEhould be investigated in future studies with larger numbersf cases.

P

H. Liu et al.

cknowledgments

his work was supported by The National Basic Research Pro-ram of China (2010CB529504), Important National ScienceTechnology Specific Projects (2009ZX09308-006), and the

ational Nonprofit Institute Research Grant of NRIFP.

eferences

ridon, P., Marini, C., Di Resta, C., Brilli, E., De Fusco, M., Politi,F., Parrini, E., Manfredi, I., Pisano, T., Pruna, D., Curia, G.,Cianchetti, C., Pasqualetti, M., Becchetti, A., Guerrini, R.,Casari, G., 2006. Increased sensitivity of the neuronal nicotinicreceptor alpha 2 subunit causes familial epilepsy with nocturnalwandering and ictal fear. Am. J. Hum. Genet. 79, 342—350.

ertrand, D., Elmslie, F., Hughes, E., Trounce, J.,Sander, T., Bertrand, S., Steinlein, O.K., 2005.The CHRNB2 mutation I312M is associated withepilepsy and distinct memory deficits. Neurobiol. Dis. 20,799—804.

hen, Y., Wu, L., Fang, Y., He, Z., Peng, B., Shen, Y., Xu, Q., 2009.A novel mutation of the nicotinic acetylcholine receptor geneCHRNA4 in sporadic nocturnal frontal lobe epilepsy. Epilepsy Res.83, 152—156.

ho, Y.W., Motamedi, G.K., Laufenberg, I., Sohn, S.I., Lim, J.G.,Lee, H., Yi, S.D., Lee, J.H., Kim, D.K., Reba, R., Gaillard, W.D.,Theodore, W.H., Lesser, R.P., Steinlein, O.K., 2003. A Koreankindred with autosomal dominant nocturnal frontal lobe epilepsyand mental retardation. Arch. Neurol. 60, 1625—1632.

e Fusco, M., Becchetti, A., Patrignani, A., Annesi, G., Gam-bardella, A., Quattrone, A., Ballabio, A., Wanke, E., Casari,G., 2000. The nicotinic receptor beta 2 subunit is mutant innocturnal frontal lobe epilepsy. Nat. Genet. 26, 275—276.

ee, V.J., Kracun, S., Cooper, S.T., Gibb, A.J., Millar, N.S., 2007.Identification of domains influencing assembly and ion channelproperties in alpha 7 nicotinic receptor and 5-HT3 receptor sub-unit chimaeras. Br. J. Pharmacol. 152, 501—512.

u, W., Bertrand, D., Steinlein, O.K., 2007. A major role of thenicotinic acetylcholine receptor gene CHRNA2 in autosomaldominant nocturnal frontal lobe epilepsy (ADNFLE) is unlikely.Neurosci. Lett. 422, 74—76.

ales, T.G., Dunlop, J.I., Deeb, T.Z., Carland, J.E., Kelley, S.P.,Lambert, J.J., Peters, J.A., 2006. Common determinants of sin-gle channel conductance within the large cytoplasmic loop of5-hydroxytryptamine type 3 and �4�2 nicotinic acetylcholinereceptors. J. Biol. Chem. 281, 8062—8071.

irose, S., Iwata, H., Akiyoshi, H., Kobayashi, K., Ito, M., Wada,K., Kaneko, S., Mitsudome, A., 1999. A novel mutation ofCHRNA4 responsible for autosomal dominant nocturnal frontallobe epilepsy. Neurology 53, 1749—1753.

racun, S., Harkness, P.C., Gibb, A.J., Millar, N.S., 2008. Influenceof the M3—M4 intracellular domain upon nicotinic acetylcholinereceptor assembly, targeting and function. Br. J. Pharmacol. 153,1474—1484.

eniger, T., Kananura, C., Hufnagel, A., Bertrand, S., Bertrand, D.,Steinlein, O.K., 2003. A new Chrna4 mutation with low pene-trance in nocturnal frontal lobe epilepsy. Epilepsia 44, 981—985.

indstrom, J., 1996. Neuronal nicotinic acetylcholine receptors. IonChannels 4, 377—450.

o, W.Y., Botzolakis, E.J., Tang, X., Macdonald, R.L., 2008. Aconserved Cys-loop receptor aspartate residue in the M3—M4cytoplasmic loop is required for GABAA receptor assembly. J.

Biol. Chem. 283, 29740—29752.

hillips, H.A., Favre, I., Kirkpatrick, M., Zuberi, S.M., Goudie,D., Heron, S.E., Scheffer, I.E., Sutherland, G.R., Berkovic,S.F., Bertrand, D., Mulley, J.C., 2001. CHRNB2 is the second

S

S

SH.A., Sutherland, G.R., Scheffer, I.E., Berkovic, S.F., 1995. A

A novel CHRNB2 mutation in sporadic epilepsy

acetylcholine receptor subunit associated with autosomal dom-inant nocturnal frontal lobe epilepsy. Am. J. Hum. Genet. 68,225—231.

Phillips, H.A., Marini, C., Scheffer, I.E., Sutherland, G.R., Mulley,J.C., Berkovic, S.F., 2000. A de novo mutation in sporadic noc-turnal frontal lobe epilepsy. Ann. Neurol. 48, 264—267.

Provini, F., Plazzi, G., Tinuper, P., Vandi, S., Lugaresi, E., Montagna,P., 1999. Nocturnal frontal lobe epilepsy. A clinical and poly-graphic overview of 100 consecutive cases. Brain 122 (Pt 6),1017—1031.

Rodrigues-Pinguet, N., Jia, L., Li, M., Figl, A., Klaassen, A., Truong,A., Lester, H.A., Cohen, B.N., 2003. Five ADNFLE mutationsreduce the Ca2+ dependence of the mammalian �4�2 acetyl-choline response. J. Physiol. 550, 11—26.

Sadtler, S., Laube, B., Lashub, A., Nicke, A., Betz, H., Schmalzing,G., 2003. A basic cluster determines topology of the cytoplas-

mic M3—M4 loop of the glycine receptor alpha1 subunit. J. Biol.Chem. 278, 16782—16790.

Saenz, A., Galan, J., Caloustian, C., Lorenzo, F., Marquez, C.,Rodriguez, N., Jimenez, M.D., Poza, J.J., Cobo, A.M., Grid, D.,

99

Prud’homme, J.F., Lopez de Munain, A., 1999. Autosomal dom-inant nocturnal frontal lobe epilepsy in a Spanish family witha Ser252Phe mutation in the CHRNA4 gene. Arch. Neurol. 56,1004—1009.

cheffer, I.E., Bhatia, K.P., Lopes-Cendes, I., Fish, D.R., Marsden,C.D., Andermann, E., Andermann, F., Desbiens, R., Keene, D.,Cendes, F., Manson, J.I., Constantinou, J.E.C., Mchntosh, A.,Berkovic, S.F., 1995. Autosomal dominant nocturnal frontal lobeepilepsy. A distinctive clinical disorder. Brain 118 (Pt 1), 61—73.

teinlein, O.K., Magnusson, A., Stoodt, J., Bertrand, S., Weiland, S.,Berkovic, S.F., Nakken, K.O., Propping, P., Bertrand, D., 1997. Aninsertion mutation of the CHRNA4 gene in a family with autoso-mal dominant nocturnal frontal lobe epilepsy. Hum. Mol. Genet.6, 943—947.

teinlein, O.K., Mulley, J.C., Propping, P., Wallace, R.H., Phillips,

missense mutation in the neuronal nicotinic acetylcholine recep-tor alpha 4 subunit is associated with autosomal dominantnocturnal frontal lobe epilepsy. Nat. Genet. 11, 201—203.