Download - T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Transcript
Page 1: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Francis K. Lee, M.Sc, Ph.D.Senior Service Fellow (Research Microbiologist)

Newborn Screening Translation Research Initiative, CDCEmeritus Professor of Pediatrics, Emory University School of Medicine

Newborn Screening Molecular WorkshopJune 28-30, 2011

T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

National Center for Environmental Health · Division of Laboratory SciencesNewborn Screening and Molecular Biology Branch

Page 2: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Severe Combined Immunodeficiency (SCID) is characterized by the absence of both humoral and cellular immunity At least 15 different genes known to cause SCID when mutated All have profound defects in T lymphocyte differentiation and function

Maternal antibodies wane during first months of life - affected infants develop infections (common / opportunistic pathogens) Recurrent infections, chronic diarrhea, sepsis, FTT Death usually before 1 year of age

Overview of SCID – the Condition

SCID has been called “Bubble Boy Disease”

Treatment and prevention of infections can prolong life but are not curative

Best hope for SCID patients is Hematopoietic Stem Cell Transplant before the onset of infections

Page 3: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

SCID classification X-linked SCID: Mutation in the γ chain common to IL-2, IL-4, IL-

7, IL-9, IL-17 & IL-21 receptors Autosomal Recessive SCID:

Adenosine Deaminase deficiency (20q13.11)Jak3 tyrosine kinase deficiency (19p13.1)RAG 1 or 2 defect (11p13)IL-7R deficiency ( chain) (5p13)

Purine Nucleoside Phosphorylase deficiency (14q13)MHC II deficiency (16p13, 1q21, 13q)CD3 and CD3 mutations (11q23)CD45 deficiencyZAP-70 deficiency- (2q12)Artemis (10p)

Page 4: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Mutations in IL2R gamma chain

NHIGRI, NIH: Genbank accession number L19546

Page 5: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Common Feature: ABSENT/NON-FUNCTIONAL T CELLSTRECs: Reduced in All Forms of SCID

IL2R T- B+ NK-JAK3 T- B+ NK-IL7R T- B+ NK+CD45 T- B+ NK+RAG1 T- B- NK+RAG2 T- B- NK+ARTEMIS T- B- NK+ADA T- B- NK-Reticular Dysgenesis T- B+ NK+SCID, multiple bowel atresias T- B+/- NK+SCID, congenital abnormalities T- B+/- NK+Severe DiGeorge Syndrome T- B+/- NK+CD3 Deficiency T+/- B+ NK+CD8 Deficiency T+ B+ NK+Severe Ataxia Telangiectasia T+/- B+/- NK+

Unknown geneticDefect ~5-25%

Page 6: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Prevalence of the disease 1:100,000 or greaterSCID: 1:50,000-1:100,000

Can the disorder be detected by routine physical exam?SCID: Baby appears normal at birth.

Does the disease cause serious medical complications?SCID: 100% fatal within the first year of life

Is there a cheap, sensitive and specific screening test?SCID: Real time PCR to enumerate T cell receptor excision circles

Is there a confirmatory test?SCID: Lymphocyte subpopulation analysis

Does early detection improve outcome?SCID: Early HSCT decreases mortality from SCID

SCID Meets NBS Criteria

Page 7: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Optimal Test to Screen for severe

T cell lymphopenia (SCID) Must detect low/absent T cells Use existing NBS screening cards Inexpensive, sensitive and specific

Low rate of false positive testsLittle need for retesting

• Real Time PCR (RT-PCR): enumeration of T cell receptor excision circles (TREC - surrogate marker for recently produced T cells) using DNA extracted from newborn blood spots collected routinely on all newborns

Page 8: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

The T cell Receptor Excision Circle (TREC) assay differs from other molecular assays used in NBS: Phenotype assay: TREC is a molecular marker for T cell production in thymus

Quantitative assay: require higher level of precision

results influence d by• DNA extraction efficiency• PCR efficiency

Overview of TREC Assay for SCID

Page 9: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

T cell receptor excision circles (TREC) are by-products of the

rearrangement of T cell receptor (TCR) genes during

thymocyte maturation in the thymus

TRECs are episomal DNA and do not replicate during mitosis

Peripheral blood TREC levels reflect T lymphocyte production

in the thymus

TREC Assay: Real Time PCR

Variations in TREC Assay procedures can be based on: Primers and Probes

DNA extraction procedures

Overview of TREC Assay for SCID (cont.)

Page 10: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Alpha chain V segments

Delta chain V/D/J segments

Alpha chain J segments

Alpha chain constant region

TCR–Delta deletion in rearrangement of T cell receptor geneVα

1Vα2

Vαn δRecVδ1Vδ/Dδ/Jδ

ψЈα Jα2Jα1 Jα3 Jαn Cα

δRec-ΨJα Coding joint

Signal joint δRec-ΨJα

TREC

≈≈≈ ≈

↓Vα–Јα–Cα

rearrangement↓TCR alpha chain transcription, translation , expression

≈≈

≈ ≈≈≈

Chromosomal 14TCR α/δ chain loci

Episomal DNA (δRec-ΨJα TREC)

Chromosomal 14TCR α chain locus

Chromosomal 14TCR α/δ chain loci

Page 11: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

GTGTCCTCACCCGTGAAA GTCCACGGATACGTAGTGGCAC

5’

3’

≈δRec

ΨЈα

5’ -------AAAGGTGCCCACTCCTGTGCACGGTGATGCATAGGCACCTG-------3’

Orientation of δRec and ΨЈα sequences in genomic DNA

Orientation of δRec and ΨЈα sequences in TREC DNA

Signal Joint

Forward Primer Direction → ← Reverse Primer Direction

Page 12: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

DBS DNA

Extraction

TREC sequence

Amplification

Amplicons Quantificati

on

DBS DNA Extraction

Real time PCR

DBS In SituPCR

Amplicons Quantificatio

n

DBSIn Situ Real time PCR

Classical Conventional PECDC

Technical Approaches to TREC Assays

Page 13: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

TREC Measurement: qPCR

NBS Card

Dried blood spots (DBS)

3 mm punch

96 well plate

Extract

DNA*

Enumerate

TRECs by real-time

qPCR

0

1

2

3

4

5

0 10 20 30 40 50

Fluo

resc

ence

(dR

n)

Cycles

Cord Bloods TREC Amplification Plots

Page 14: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

In Situ Real Time PCR Assay for TREC

Punch one 2.0 mm discs from DBS specimen into PCR tubes

Wash with 125 µl of DNA purification solution S1(shake for 15 minutes at room temp)

Wash with 125 µl of DNA elution solution S2(shake for 5 minutes at room temp)

Page 15: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

In Situ Real Time PCR Assay for TREC (cont.)

0.00 0.50 1.00 1.50 2.00 2.50 3.0026

28

30

32

34

36

38

f(x) = − 3.14088301371599 x + 36.606966827678R² = 0.963610371552069

TREC-HeLa DBS calibrators

log10(cell#/μl blood)

CT#

Discard S2 wash bufferAdd 15 μl of qPCR mastermix (contains complete mix of primers & probe)

Run qPCR in Stratagene MX3000p:45 deg for 5 min, 95 deg for 20 min 45 cycles of [ 95 deg x 15 sec + 60 deg x 1 min ]

0

1

2

3

4

5

0 10 20 30 40 50

Fluo

resc

ence

(dR

n)

Cycles

Cord Bloods TREC Amplification Plots

Page 16: T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

Quality Assurance

Use of TREC Reference Materials

National Center for Environmental HealthNewborn Screen and Molecular Biology Branch