Supplementary Information
Polymerase Synthesis of Oligonucleotides Containing a Single
Chemically Modified Nucleobase for Site-Specific Redox
Labelling
Petra Ménová, Hana Cahová, Medard Plucnara, Luděk Havran, Miroslav Fojta, Michal Hocek
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S1
Contents:
Supplementary Information ........................................................................................................ 0
Contents: ................................................................................................................................. 1
Supplementary tables ............................................................................................................. 2
Table S1. Sequences of oligonucleotides used and synthesized in this study.[a]
............... 2
Table S2. MALDI-TOF analyses of ON products. ........................................................... 3
Table S3. Melting temperatures of DNA duplexes. .......................................................... 4
Supplementary figures ............................................................................................................ 5
Denaturing PAGE analyses of product of polymerase syntheses of ONs bearing a
single modification by SNI-PEX ..................................................................................... 5
Electrochemistry ............................................................................................................. 12
Synthesis of dGNO2
TP and dGNH2
TP .................................................................................... 13
Experimental ........................................................................................................................ 15
General remarks ............................................................................................................. 15
Synthesis of 2'-deoxy-5-(3-nitrophenyl)-7-deazaguanosine 5'-O-triphosphate (dG
NO2TP) ....................................................................................................................... 16
2'-deoxy-5-(3-nitrophenyl)-7-deazaguanosine (dGNO2
)................................................... 16
2'-deoxy-5-(3-nitrophenyl)-7-deazaguanosine 5'-O-triphosphate (dGNO2
TP) ................ 16
Biochemistry ................................................................................................................... 18
MALDI-TOF spectra of ON products .......................................................................... 21
References ............................................................................................................................ 27
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S2
Supplementary tables
Table S1. Sequences of oligonucleotides used and synthesized in this study.[a]
Primers Sequence
prim 5‘-CATGGGCGGCATGGG-3‘
primC 5‘-CATGGGCGGCATGGGC-3‘
primC-1 5‘-CATGGGCGGCATGGC-3‘
primT 5‘-CATGGGCGGCATGGT-3‘
primA 5‘-CATGGGCGGCATGGA-3‘
Templates
MonoA 5‘-(bio)-CTAGCATGAGCTCAGTCCCATGCCGCCCATG-3‘
MonoC 5‘-(bio)-CTAGCATGAGCTCAGGCCCATGCCGCCCATG-3‘
MonoG 5‘-(bio)-CTAGCATGAGCTCAGCCCCATGCCGCCCATG-3‘
MonoT 5‘-(bio)-CTAGCATGAGCTCAGACCCATGCCGCCCATG-3‘
MonogAa 5‘-(bio)-CTAGCATGAGCTCATTCCCATGCCGCCCATG-3‘
MonogAc 5‘-(bio)-CTAGCATGAGCTCAGTCCCATGCCGCCCATG-3‘
MonogAt 5‘-(bio)-CTAGCATGAGCTCAATCCCATGCCGCCCATG-3‘
MonocAa 5‘-(bio)-CTAGCATGAGCTCATTGCCATGCCGCCCATG-3‘
MonocAt 5‘-(bio)-CTAGCATGAGCTCAATGCCATGCCGCCCATG-3‘
MonocAc 5‘-(bio)-CTAGCATGAGCTCAGTGCCATGCCGCCCATG-3‘
MonotAt 5‘-(bio)-CTAGCATGAGCTCAATACCATGCCGCCCATG-3‘
MonotAa 5‘-(bio)-CTAGCATGAGCTCATTACCATGCCGCCCATG-3‘
MonoaAa 5‘-(bio)-CTAGCATGAGCTCATTTCCATGCCGCCCATG-3‘
MonogGa 5‘-(bio)-CTAGCATGAGCTCATCCCCATGCCGCCCATG-3‘
MonogGc 5‘-(bio)-CTAGCATGAGCTCAGCCCCATGCCGCCCATG-3‘
MonotGc 5‘-(bio)-CTAGCATGAGCTCAGCACCATGCCGCCCATG-3‘
MonogCa 5‘-(bio)-CTAGCATGAGCTCATGCCCATGCCGCCCATG-3‘
MonogCt 5‘-(bio)-CTAGCATGAGCTCAAGCCCATGCCGCCCATG-3‘
MonotCt 5‘-(bio)-CTAGCATGAGCTCAAGACCATGCCGCCCATG-3‘
MonogTa 5‘-(bio)-CTAGCATGAGCTCATACCCATGCCGCCCATG-3‘
MonogTc 5‘-(bio)-CTAGCATGAGCTCAGACCCATGCCGCCCATG-3‘
MonotTc 5‘-(bio)-CTAGCATGAGCTCAGAACCATGCCGCCCATG-3‘
MonoC-short 5‘-(bio)-GCCCATGCCGCCCATG-3’
MonogA-short 5‘-(bio)-TCCCATGCCGCCCATG-3‘
MonocA-short 5‘-(bio)-TGCCATGCCGCCCATG-3‘
MonotA-short 5‘-(bio)-TACCATGCCGCCCATG-3‘
MonoaA-short 5‘-(bio)-TTCCATGCCGCCCATG-3‘
PEX products
ON1 5‘-CATGGGCGGCATGGGACTGAGCTCATGCTAG-3‘
ON2 5‘-CATGGGCGGCATGGGCCTGAGCTCATGCTAG-3‘
ON3 5‘-CATGGGCGGCATGGGGCTGAGCTCATGCTAG-3‘
ON4 5‘-CATGGGCGGCATGGGTCTGAGCTCATGCTAG-3‘
ON5 5‘-CATGGGCGGCATGGGC-3‘
ON6 5‘-CATGGGCGGCATGGGAATGAGCTCATGCTAG-3‘
ON7 5‘-CATGGGCGGCATGGGACTGAGCTCATGCTAG-3‘
ON8 5‘-CATGGGCGGCATGGGATTGAGCTCATGCTAG-3‘
ON9 5‘-CATGGGCGGCATGGCAATGAGCTCATGCTAG-3‘
ON10 5‘-CATGGGCGGCATGGCATTGAGCTCATGCTAG-3‘
ON11 5‘-CATGGGCGGCATGGCACTGAGCTCATGCTAG-3‘
ON12 5‘-CATGGGCGGCATGGTATTGAGCTCATGCTAG-3‘
ON13 5‘-CATGGGCGGCATGGTAATGAGCTCATGCTAG-3‘
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S3
ON14 5‘-CATGGGCGGCATGGAAATGAGCTCATGCTAG-3‘
ON15 5‘-CATGGGCGGCATGGGGATGAGCTCATGCTAG-3‘
ON13 5‘-CATGGGCGGCATGGGGCTGAGCTCATGCTAG-3‘
ON17 5‘-CATGGGCGGCATGGTGCTGAGCTCATGCTAG-3‘
ON18 5‘-CATGGGCGGCATGGGCATGAGCTCATGCTAG-3‘
ON19 5‘-CATGGGCGGCATGGGCTTGAGCTCATGCTAG-3‘
ON20 5‘-CATGGGCGGCATGGTCTTGAGCTCATGCTAG-3‘
ON21 5‘-CATGGGCGGCATGGGTATGAGCTCATGCTAG-3‘
ON22 5‘-CATGGGCGGCATGGGTCTGAGCTCATGCTAG-3‘
ON23 5‘-CATGGGCGGCATGGTTCTGAGCTCATGCTAG-3‘
[a] Italics: parts forming duplex with the primer; bold: position of the modification in the
product; bio = biotin.
Table S2. MALDI-TOF analyses of ON products.
ON calcd. [M+H]
+
found [M+H]
+
ON1 ANO2
9738.4 Da 9738.5 Da
ON1 ANH2
9708.4 Da 9708.8 Da
ON2 CNO2
9715.4 Da 9715.3 Da
ON2 CNH2
9685.4 Da 9685.8 Da
ON3 GNO2
9754.4 Da 9754.5 Da
ON3 GNH2
9724.4 Da 9724.6 Da
ON4 UNO2
9716.4 Da 9716.0 Da
ON4 UNH2
9686.4 Da 9686.8 Da
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S4
Table S3. Melting temperatures of DNA duplexes.
Complementary strand
Base pair
Tm Tm Tm[a]
ON1 A ON1 ANO2
MonoT A 79.6(7) 79.1(5) - 0.5
MonoG C 78.8(4) 79.7(6) +0.9
MonoC G 81.1(5) 80.9(5) - 0.2
MonoA T 82.2(5) 80.9(4) - 1.3
ON2 C ON2 CNO2
MonoT A 82.8(7) 81.2(7) - 1.6
MonoG C 82.8(4) 80.6(5) - 2.2
MonoC G 85.1(5) 82.9(5) - 2.2
MonoA T 83.1(5) 82.3(4) - 0.8
ON3 G ON3 GNO2
MonoT A 80.8(5) 80.7(5) - 0.1
MonoG C 82.6(4) 82.5(5) - 0.1
MonoC G 80.9(6) 80.6(5) - 0.3
MonoA T 80.6(5) 80.1(5) - 0.5
ON4 T ON4 UNO2
MonoT A 82.1(5) 81.2(6) - 0.9
MonoG C 77.4(4) 79.2(5) +1.8
MonoC G 80.5(4) 80.1(5) - 0.4
MonoA T 77.2(5) 79.1(5) +1.9
[a] Tm = Tm(ON X
mod) – Tm(ON X).
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S5
Supplementary figures
Denaturing PAGE analyses of product of polymerase syntheses of ONs bearing a single
modification by SNI-PEX
Figure S1. Denaturing PAGE analysis of products of polymerase synthesis of ONs bearing a
single modification (ANO2
(a), ANH2
(b), and AFc
(c)) by SNI-PEX. Diluted DNA polymerase
was necessary for successful SNI (0.02 U/µL for ANO2
, 0.004 U/µL for ANH2
, standard
conditions for AFc
). Experiments are supplemented with a primer (p). Lane 1: positive control
for SNI (only natural dATP present); lane 2: negative control for SNI (no dNTPs present);
lane 3: SNI of AX (only A
X present); lane 4: negative control for PEX (absence of natural
dATP); lane 5: positive control for PEX (all natural dNTPs present); lane 6: PEX with primer
extended with AX (all natural dNTPs present). For reaction conditions, see the Experimental.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S6
Figure S2. Denaturing PAGE analysis of products of polymerase synthesis of ONs bearing a
single modification (CNO2
(a), CNH2
(b), and CFc
(c)) by SNI-PEX using one-base-longer
primer (primC) in order to incorporate one redox label only. Experiments are supplemented
with a primer (p). Lane 1: positive control for SNI (only natural dCTP present); lane 2:
negative control for SNI (no dNTPs present); lane 3: SNI of CX (only C
X present); lane 4:
negative control for PEX (absence of natural dCTP); lane 5: positive control for PEX (all
natural dNTPs present); lane 6: PEX with primer extended with CX (all natural dNTPs
present). For reaction conditions, see the Experimental.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S7
Figure S3. Denaturing PAGE analysis of products of polymerase synthesis of ONs bearing a
single modification (GNO2
(a), GNH2
(b), and GFc
) by SNI-PEX. Experiments are
supplemented with a primer (p). Lane 1: positive control for SNI (only natural dGTP present);
lane 2: negative control for SNI (no dNTPs present); lane 3: SNI of GX (only G
X present);
lane 4: negative control for PEX (absence of natural dGTP); lane 5: positive control for PEX
(all natural dNTPs present); lane 6: PEX with primer extended with GX (all natural dNTPs
present). For reaction conditions, see the Experimental.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S8
Figure S4. Denaturing PAGE analysis of products of polymerase synthesis of ONs bearing a
single modification (UNO2
(a), UNH2
(b), and UFc
(c)) by SNI-PEX. Experiments are
supplemented with a primer (p). Lane 1: positive control for SNI (only natural dTTP present);
lane 2: negative control for SNI (no dNTPs present); lane 3: SNI of UX (only U
X present);
lane 4: negative control for PEX (absence of natural dTTP); lane 5: positive control for PEX
(all natural dNTPs present); lane 6: PEX with primer extended with UX (all natural dNTPs
present). For reaction conditions, see the Experimental.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S9
Figure S5. Denaturing PAGE analysis of products of polymerase synthesis of ONs bearing a
single modification (CNO2
(a), CNH2
(b), and CFc
(c)) by SNI-PEX into a sequence containing
two Cs in a row. Only one-base longer template is used for SNI. The SNI is followed by
magnetoseparation, a full-length template is added and the one-base extended primer is fully
extended with natural dNTPs. Experiments are supplemented with a primer (p). Lane 1:
positive control for SNI (only natural dCTP present, template MonoC-short); lane 2: SNI of
CX (only C
X present, template MonoC-short); lane 3: positive control for PEX (all natural
dNTPs present, template MonoC); lane 4: PEX with primer extended with CX (all natural
dNTPs present, template MonoC-short). For reaction conditions, see the Experimental.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S10
Figure S6. Denaturing PAGE analysis of products of polymerase synthesis of ONs bearing a
single modification (CNH2
) by SNI-PEX into a sequence containing two Cs in a row, using a
standard-length primer and 1 equiv. of CNH2
. The polymerase is unable to incorporate only
one base into a homo-C sequence and a mixture of primer, primer extended with one CNH2
and primer extended with two CNH2
s is obtained. Experiments are supplemented with a primer
(p). Lane 1: positive control for SNI (only natural dCTP present); lane 2: negative control for
SNI (no dNTPs present); lane 3: SNI of CX (only C
X present); lane 4: negative control for
PEX (absence of natural dCTP); lane 5: positive control for PEX (all natural dNTPs present);
lane 6: PEX with primer extended with CX (all natural dNTPs present). For reaction
conditions, see the Experimental.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S11
Figure S7. Denaturing PAGE analysis of products of polymerase synthesis of ONs bearing a
single modification (ANO2
(a) and ANH2
(b)) by SNI-PEX using the standard concentration of
DNA polymerase (0.1 U/µL). Modified AX are the best substrates for Vent(exo-) DNA
polymerase and the polymerase incorporates more AXs in a row regardless the template
sequence, thus forming mismatch pairs. Experiments are supplemented with a primer (p).
Lane 1: positive control for SNI (only natural dATP present); lane 2: negative control for SNI
(no dNTPs present); lane 3: SNI of AX (only A
X present); lane 4: negative control for PEX
(absence of natural dATP); lane 5: positive control for PEX (all natural dNTPs present); lane
6: PEX with primer extended with AX (all natural dNTPs present). For reaction conditions,
see the Experimental.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S12
Electrochemistry
Figure S8 Examples of electrochemical responses of ANO2
-modified ON products.
Left panel: ex situ cyclic voltammograms of the ONs with sequences shown in the legend; red
letters indicate the modified base. The CVs consist of three segments indicated by arrows: the
first from -0.2 to -0.64 V, the second from -0.64 to +0.1 V and the third one from +0.1 to -0.2
V. In the first catodic scan the nitro group is reduced irreversibly with four electrons to
hydroxylamino group, giving rise to the peak NO2red
. The hydroxylamine gives reversible
electrochemistry, being oxidized in the anodic scan (segment 2) with two electrons to nitroso
derivative (peak NHOHox
) and the latter in the cathodic segment 3 reduced back to
hydroxylamine (NOred
). Black and blue curves correspond to monoincorporation products
(full length ON1 after the two-step PEX and that with a single ANO2
incorporation only,
respectively). Dashed red curve corresponds to a single-step PEX reaction in the presence of
dANO2
TP, dCTP, TTP and dGTP (i.e. full length ON bearing five nitro groups, showing
proportionality between number of nitro tags incorporated and signal intensity), the green
curve is negative PEX control (the same dNTP mixture but with no polymerase added,
demonstrating that only incorporated NO2 groups, but not residual dANO2
TP from the reaction
mixture, give the signal).
Right panel: details of NO2red
peaks obtained for full length products of ANO2
monoincorporation in different sequence contexts (see legend in the panel). For peak
potentials corresponding to these and other combinations see Table 1 in the article.
-0.6 -0.4 -0.2 0.0
-0.10
-0.05
0.00
0.05
I [
A]
E [V]
NO2red
NHOHox
NOred
-0.6 -0.5 -0.4 -0.3
-0.015
-0.010
-0.005
0.000
I [
A]
CAT
GAC
GAT
CAA
E [V]
NO2red
CATGGGCGGCATGGGACAGAGCTCATGCTAGCATGGGCGGCATGGGACATGGGCGGCATGGGACAGAGCTCATGCTAGCATGGGCGGCATGGG (negative PEX)
1 3
2
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S13
Synthesis of dGNO2
TP and dGNH2
TP
The aqueous Suzuki cross-coupling reaction on guanosine derivatives is rather challenging
due to the fact that the guanine moiety has an acidic proton, which under reaction conditions
(high pH, high temperature) may be deprotonated to give an anion that can coordinate to
palladium.1 We have previously reported the synthesis of both guanosine derivatives
dGNO2
TP and dGNH2
TP, however, the reaction yields were very low and the products
contained a high proportion of the corresponding diphosphate.2 Here, we report on an
improved synthesis of both compounds, leading to higher yields and lower diphosphate
content.
Our standard synthetic approach to modified nucleoside triphosphates consists of
triphosphorylation of an iodo nucleoside and a following cross-coupling reaction. For
dGNO2
TP it turned out better to start with the cross-coupling reaction on the iodo nucleoside
dGI and then proceed with triphosporylation. The desired dG
NO2TP was obtained as a pure
compound in an 18% overall yield.
Scheme S1. Synthesis of dGNO2
TP.
However, this concept failed when applied to the synthesis of dGNH2
TP. While the Suzuki
cross-coupling of the 7-iodo-7-deaza-2´-deoxyguanosine dGI with 3-aminophenylboronic
acid proceeded well, affording the 3-aminophenyl nucleoside in a 57% yield, the following
triphosphorylation did not work under any conditions applied, presumably due to the presence
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S14
of aromatic amino group. Therefore, the triphosphorylation had to be accomplished before the
cross-coupling reaction. Iodo triphosphate dGITP was obtained in a 51% yield according to a
known procedure.3 Lower reaction temperature (100 °C) and higher acetonitrile content (2:1
CH3CN:H2O) together with a higher excess of the boronic acid (5 equiv.) led to the desired
triphosphate dGNH2
TP in 41% yield. The triphosphate contained 25 % of diphosphate, which
could be separated by perfusion chromatography on POROS reverse-phase column. The
overall yield of dGNH2
TP was 16 %.
Scheme S2. Synthesis of dGNH2
TP.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S15
Experimental
General remarks
NMR spectra were recorded using a 500 MHz (1H at 500 MHz,
13C at 125.7 MHz,
19F at
470.3 MHz) spectrometer, in D2O or DMSO-d6. Chemical shifts are given in ppm (scale
and coupling constant (J) in Hz. Both low resolution and high resolution mass spectra were
performed using electrospray ionization. Semi-preparative separation of nucleosides and
nucleoside triphosphates was performed by HPLC on a column packed with 10 µM C18
reversed phase (Phenomenex, Luna C18(2)).
3-Amino- and 3-nitrophenylboronic acids were purchased from Sigma Aldrich, and 7-iodo-7-
deaza-2´-deoxyguanosine was purchased from Chembiotech. Synthesis and characterization
data for 2'-deoxy-5-(3-nitrophenyl)-7-deazaadenosine 5'-O-triphosphate (dANO2
TP)4 , 7-(3-
aminophenyl)-2'-deoxy-7-deazaadenosine 5'-O-triphosphate (dANH2
TP)4 , 2'-deoxy-5-(3-
nitrophenyl)cytidine 5'-O-triphosphate (dCNO2
TP)4 , 5-(3-aminophenyl)-2'-deoxycytidine 5'-
O-triphosphate (dCNH2
TP)4 , 2'-deoxy-5-(3-nitrophenyl)uridine 5'-O-triphosphate
(dUNO2
TP)4 , 5-(3-aminophenyl)-2'-deoxyuridine 5'-O-triphosphate (dU
NH2TP)
4 , and for 2'-
deoxy-7-iodo-7-deazaguanosine 5'-O-triphosphate (dGITP)
3 were reported previously.
Synthetic oligonucleotides (primers Prim, and PrimC; PEX templates MonoA, MonoC-short,
MonoC, MonoG, and MonoT; biotinylated PEX templates MonoA-bio, MonoC-short-bio,
MonoC-bio, MonoG-bio, and MonoT-bio; for sequences see Table S1) were purchased from
Sigma-Aldrich. DNA polymerase Vent(exo-), as well as natural nucleoside triphosphates
(dATP, dCTP, dGTP, dTTP) were purchased from New England Biolabs. KOD XL DNA
polymerase was obtained from Merck and Pwo DNA polymerase from Peqlab. Streptavidin
magnetic particles were obtained from Roche. All solutions for the PEX experiments were
prepared in Milli-Q water. The primer was labeled using [γ32
P]-ATP according to standard
techniques.5
Mass spectra of the prepared ONs were measured by MALDI-TOF, on Reflex IV (Bruker
Daltonics, Germany) with nitrogen UV laser (337 nm). UV spectra were measured on Varian
CARY 100 Bio spectrophotometer and on NanoDrop1000 (ThermoScientific).
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S16
Synthesis of 2'-deoxy-5-(3-nitrophenyl)-7-deazaguanosine 5'-O-triphosphate (dGNO2
TP)
2'-deoxy-5-(3-nitrophenyl)-7-deazaguanosine (dGNO2
)
A water-acetonitrile mixture (2:1, 4 mL) was added through a septum to an argon-purged vial
containing 7-iodo-7-deaza-2'-deoxyguanosine dGI (75 mg, 0.19 mmol), 3-nitrophenylboronic
acid (10 equiv., 317 mg, 1.90 mmol), and Cs2CO3 (5 equiv., 310 mg, 0.95 mmol). After the
solids had dissolved, a solution of Pd(OAc)2 (10 mol%, 4.3 mg, 0.019 mmol) and TPPTS
(5 equiv. to Pd, 54 mg, 0.095 mmol) in water-acetonitrile mixture (2:1, 0.5 mL) was added
and the resulting mixture was stirred at 120 °C for 30 min. The crude reaction mixture was
evaporated with silica gel (2 g) and subsequently separated by column chromatography on
silica gel using dichloromethane-chloroform 14:1 as a mobile phase. The fractions containing
the product were evaporated and dried under vacuum at 80 °C. Compound dGNO2
was
obtained as a yellow solid (58 mg, 78 %).
1H NMR (499.8 MHz, DMSO-d6): 2.12 (ddd, 1H, Jgem = 13.1, J2'b,1' = 5.8, J2'b,3' = 2.5, H-2'b);
2.47 (ddd, 1H, Jgem = 13.1, J2'a,1' = 8.4, J2'a,3' = 5.7, H-2'a); 3.50, 3.56 (2 × ddd, 2 × 1H,
Jgem = 11.6, J5',OH = 5.6, J5',4' = 4.9, H-5'); 3.78 (td, 1H, J4',5' = 4.9, J4',3' = 2.5, H-4'); 4.33 (m,
1H, J3',2' = 5.7, 2.5, J3',OH = 3.8, J3',4' = 2.5, H-3'); 4.92 (t, 1H, JOH,5' = 5.6, OH-5'); 5.23 (d, 1H,
JOH,3' = 3.8, OH-3'); 6.39 (dd, 1H, J1'2' = 8.4, 5.8, H-1'); 6.41 (bs, 2H, NH2); 7.593 (s, 1H,
H-8); 7.595 (ddd, 1H, J5,4 = 8.2, J5,6 = 7.8, J5,2 = 0.3, H-5-C6H4NO2); 8.01 (ddd, 1H, J4,5 = 8.2,
J4,2 = 2.4, J4,6 = 1.0, H-4-C6H4NO2); 8.39 (ddd, 1H, J6,5 = 7.8, J6,2 = 1.8, J6,4 = 1.0,
H-6-C6H4NO2); 9.01 (ddd, 1H, J2,4 = 2.4, J2,6 = 1.8, J2,5 = 0.3, H-2-C6H4NO2); 10.53 (bs, 1H,
NH). 13
C NMR (125.7 MHz, DMSO-d6): 39.20 (CH2-2'); 62.09 (CH2-5'); 71.07 (CH-3');
82.32 (CH-1'); 87.33 (CH-4'); 97.21 (C-4a); 116.90 (CH-8); 118.04 (C-5); 120.39
(CH-4-C6H4NO2); 122.11 (CH-2-C6H4NO2); 129.44 (CH-5-C6H4NO2); 133.62
(CH-6-C6H4NO2); 136.32 (C-1-C6H4NO2); 148.23 (C-3-C6H4NO2); 152.53 (C-7a); 153.06 (C-
2); 159.10 (C-4). MS (ESI+): m/z (%): 410.1 (100) [M+Na]
+. HRMS (ESI
+): m/z [M + H]
+
calculated for C17H18O6N5 388.12516; found 388.12519.
2'-deoxy-5-(3-nitrophenyl)-7-deazaguanosine 5'-O-triphosphate (dGNO2
TP)
Dry POCl3 (2 equiv., 7.2 µL, 0.077 mmol) was added to a solution of dGNO2
(15 mg,
0.039 mmol) in dry trimethyl phosphate (750 µL) at 0 °C under argon atmosphere. The
reaction mixture was stirred at 0 °C for 7 hours. Next, an ice-cold solution of
(NHBu3)2H2P2O7 (5 equiv., 106 mg, 0.193 mmol) and tributylamine (75 µL, 0.420 mmol) in
anhydrous DMF (750 µL) was added. The reaction mixture was stirred at -4 °C for 1 hour.
The reaction was quenched with aqueous solution of TEAB (2M, 1 mL) and the mixture was
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S17
concentrated under reduced pressure. The residue was five times co-evaporated with water.
The product was purified on semi-preparative HPLC on a C18 column with a linear gradient
of 0.1 M TEAB in H2O to 0.1 M TEAB in H2O/MeOH 1:1 as eluent. The obtained
triphosphate was converted to sodium salt using ionex (Dowex 50WX8 in Na+ cycle) and
freeze-dried from water. Compound dGNO2
TP was obtained as yellow solid (6.4 mg, 23 %).
NMR data are in accord with those in the literature.2
1H NMR (499.8 MHz, D2O, pD = 7.1, refdioxane = 3.75 ppm): 2.43 (ddd, 1H, Jgem = 14.0,
J2'b,1' = 6.2, J2'b,3' = 3.0, H-2'b); 2.71 (ddd, 1H, Jgem = 14.0, J2'a,1' = 7.8, J2'a,3' = 6.5, H-2'a); 4.14,
4.18 (2 × m, 2 × 1H, H-5'); 4.21 (m, 1H, H-4'); 4.76 (overlapped with HDO signal, H-3'); 6.47
(dd, 1H, J1'2' = 7.8, 6.2, H-1'); 7.40 (s, 1H, H-8); 7.59 (t, 1H, J5,4 = J5,6 = 8.1, H-5-C6H4NO2);
8.08 (bd, 1H, J6,5 = 8.1, H-6-C6H4NO2); 8.11 (dd, 1H, J4,5 = 8.1, J4,2 = 2.0, H-4-C6H4NO2);
8.70 (t, 1H, J2,4 = J2,6 = 2.0, H-2-C6H4NO2). 13
C NMR (125.7 MHz, D2O, pD = 7.1,
refdioxane = 69.3 ppm): 40.85 (CH2-2'); 68.35 (d, JC,P = 7.0, CH2-5'); 73.96 (CH-3'); 85.67
(CH-1'); 87.78 (d, JC,P = 9.7, CH-4'); 100.53 (C-5); 120.04 (CH-8); 121.72 (C-7); 124.07
(CH-4-C6H4NO2); 125.82 (CH-2-C6H4NO2); 132.07 (CH-5-C6H4NO2); 136.82
(CH-6-C6H4NO2); 137.60 (C-1- C6H4NO2); 150.48 (C-3-C6H4NO2); 155.08 (C-4); 155.67
(CH-2); 163.76 (C-6). 31
P {1H} NMR (202.3 MHz, D2O, pD = 7.1, refphosphate buffer =
2.35 ppm): -21.27 (b, P); -10.29 (d, J = 18.8, P); -6.62 (b, P).
Synthesis of 7-(3-aminophenyl)-2'-deoxy-7-deazaguanosine 5'-O-triphosphate (dGNH2
TP)
7-(3-aminophenyl)-2'-deoxy-7-deazaguanosine 5'-O-triphosphate (dGNH2
TP)
A water-acetonitrile mixture (1:2, 500 µL) was added through a septum to an argon-purged
vial containing 7-iodo-7-deaza-2'-deoxyguanosine 5'-O-triphosphate dGITP (36 mg,
0.05 mmol), 3-aminophenylboronic acid (5 equiv., 46 mg, 0.26 mmol), and Cs2CO3 (5 equiv.,
85 mg, 0.26 mmol). After the solids had dissolved, a solution of Pd(OAc)2 (10 mol%, 1.1 mg,
0.005 mmol) and TPPTS (5 equiv. to Pd, 14.2 mg, 0.025 mmol) in water-acetonitrile mixture
(1:2, 300 µL) was added and the resulting mixture was stirred at 100 °C for 30 min. The crude
reaction mixture was several times co-evaporated with water. The product was purified on
semi-preparative HPLC on a C18 column with a linear gradient of 0.1 M TEAB in H2O to
0.1 M TEAB in H2O/MeOH 1:1 as eluent. The obtained triphosphate was converted to
sodium salt using ionex (Dowex 50WX8 in Na+ cycle) and freeze-dried from water.
Compound dGNH2
TP was obtained as white solid (11.4 mg, 32 %). NMR data are in accord
with those in the literature.2
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S18
1H NMR (499.8 MHz, D2O, pD = 7.1, refdioxane = 3.75 ppm): 2.39 (ddd, 1H, Jgem = 14.0, J2'b,1'
= 6.3, J2'b,3' = 3.2, H-2'b); 2.69 (ddd, 1H, Jgem = 14.0, J2'a,1' = 7.7, J2'a,3' = 6.3, H-2'a); 4.14, 4.18
(2 × m, 2 × 1H, H-5'); 4.22 (m, 1H, H-4'); 4.74 (dt, 1H, J3',2' = 6.3, 3.2, J3',4' = 3.2, H-3'); 6.47
(dd, 1H, J1'2' = 7.7, 6.3, H-1'); 6.80 (bd, 1H, J4,5 = 7.5, H-4-C6H4NH2); 7.21 (m, 2H,
H-2,6-C6H4NH2); 7.24 (s, 1H, H-8); 7.26 (bt, 1H, J5,4 = J5,6 = 7.5, H-5-C6H4NH2). 13
C NMR
(125.7 MHz, D2O, pD = 7.1, refdioxane = 69.3 ppm): 40.81 (CH2-2'); 68.34 (d, JC,P = 5.7,
CH2-5'); 73.98 (CH-3'); 85.61 (CH-1'); 87.72 (d, JC,P = 8.8, CH-4'); 100.65 (C-5); 117.97
(CH-4-C6H4NH2); 119.02 (CH-8); 119.11 (CH-2-C6H4NH2); 122.64 (CH-6-C6H4NH2);
123.69 (C-7); 132.13 (CH-5-C6H4NH2); 137.19 (C-1-C6H4NH2); 148.21 (C-3-C6H4NH2);
154.80 (C-4); 155.53 (CH-2); 163.75 (C-6). 31
P {1H dec.} NMR (202.3 MHz, D2O, pD = 7.1,
refphosphate buffer = 2.35 ppm): -21.40 (t, J = 19.3, P); -10.35 (d, J = 19.3, P); -6.68 (d, J = 19.3,
P).
Biochemistry
Single nucleotide incorporation and primer extension (SNI-PEX) for analysis by
polyacrylamide gel electrophoresis
The reaction mixture (10 µL) contained 5'-32
P-labelled primer (3 µM, 0.5 µL), template
(3 µM, 0.75 µL), Vent(exo-) DNA polymerase (2 U/µL, amount specified in Table S4), and
modified dNTP (4 µM, 0.5 µL) in ThermoPol buffer (10×, 1 µL) supplied by the
manufacturer with the enzyme. The reaction mixture was incubated at 60 °C for 5 min. For
the subsequent extension, a mixture of natural dNTPs (4 mM, 0.5 µL) was added and the
reaction mixture was incubated for further 20 min. The reaction was stopped by the addition
of PAGE stop solution (20 µL, 80% [v/v] formamide, 20mM EDTA, 0.025% [w/v]
bromophenol blue, 0.025% [w/v] xylene cyanol) and heated at 95 °C for 5 min. Aliquots
(2 µL) were subjected to vertical electrophoresis in 12.5% denaturing polyacrylamide gel
containing 1x TBE buffer (pH 8) and 7M urea at 45 mA for 50 min. The gels were dried
(85 °C, 70 min), audioradiographed and visualized by phosphorimager (Typhoon 9410,
Amersham Biosciences).
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S19
Table S4. Amount of Vent(exo-) DNA polymerase for single nucleotide incorporation
experiments.
dNTP Vent(exo-)
ANO2
0.020 U/µL
ANH2
0.004 U/µL
CNO2
, CNH2
G
NO2, G
NH2
UNO2
, UNH2
0.100 U/µL
Preparative single nucleotide incorporation and primer extension (SNI-PEX) for
electrochemical and thermal studies
The reaction mixture (200 µL) contained primer (10 µM, 27 µL), 5´-biotinylated template
(10 µM, 27 µL), Vent(exo-) DNA polymerase (2 U/µL, 10 µL for all modified dNTPs), and
modified dNTP (40 µM, 8.8 µL) in ThermoPol buffer (10×, 20 µL) supplied by the
manufacturer with the enzyme. The reaction mixture was incubated at 60 °C and 450 rpm for
8 min. For the subsequent extension, a mixture of natural dNTPs (10 mM, 27 µL) was added
and the reaction mixture was incubated for further 20 min. The reaction was stopped by
cooling to 4 °C.
Streptavidin magnetic particles (Roche, 100 μL) were washed with Binding buffer TEN100
(10 mM Tris, 1 mM EDTA, 100 mM NaCl, pH 7.5) (3 × 500 μL). The reaction mixture after
the extension was diluted with the Binding buffer TEN100 (200 μL), the solution was added to
the pre-washed magnetic beads and the resulting mixture was incubated for 20 min at 18 °C
and 1200 rpm. After the incubation, the magnetic beads were collected on a magnet
(PureProteome Magnetic Stand, Merck) and the solution was discarded. The beads were
washed successively with Wash buffer TEN1000 (10 mM Tris, 1 mM EDTA, 1 M NaCl,
pH 7.5) (2 × 500 μL), and water (3 × 500 μL). Then water (50 μL) was added and the sample
was denatured for 2 min at 65 °C and 900 rpm. The beads were collected on a magnet and the
solution was transferred into a clean vial.
MALDI-TOF characterization of oligonucleotides
Oligonucleotides were characterized by MALDI-TOF mass spectrometry. A mixture of
3-hydroxypicolinic acid (HPA)/picolinic acid (PA)/ammonium tartrate in the ratio 8/1/1 in
50% acetonitrile was used as matrix for MALDI-TOF measurement. Then 2 μL of the matrix
and 1 μL of the sample were mixed on MTP 384 polished steel target by use of anchor-chip
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S20
desk. The acceleration tension in reflectron mode was 19.5 kV and range of measurement
3−13 kDa.
Measuring of melting temperatures of DNA duplexes
Single-stranded oligonucleotides were prepared according to the large-scale SNI-PEX
protocol (vide infra). The samples for Tm measurement were prepared by mixing a
functionalized ssON (0.2 nmol), commercial complementary or partially complementary
strand (MonoA, MonoC, MonoG or MonoT; 0.2 nmol) in phosphate buffer (pH 6.7, 50 mM)
to the final volume of 120 µL. The concentrations of ssONs were determined from
absorbance at 260 nm and estimated extinction coefficients that were calculated using online
calculator by IDT Biophysics.6 Melting experiments were conducted on a Varian CARY 100
Bio spectrophotometer using Thermal application software. The absorbance values at 260 nm
were monitored in the temperature range of 95–25 °C. Both heating (denaturation) and
cooling (renaturation) transition curves were recorded at a controlled rate of temperature
change of 0.5 °C/min. Melting profile of the buffer alone was subtracted from the raw
absorbance versus temperature curves of DNA samples. Four melting curves were collected
for each DNA duplex and evaluated separately. The reported melting temperatures were
obtained as means of the four measurements.
Electrochemical analysis
Single-stranded monoincorporation and strand extension products isolated by
magnetoseparation protocol (vide supra) were analysed by ex situ (adsorptive transfer
stripping) cyclic voltammetry (CV) at hanging mercury drop electrode (HMDE). The ONs
were accumulated at the HMDE from 5 L aliquots containing 0.2 M NaCl for 60 s. The
electrode was then rinsed with deionized water and placed in the electrochemical cell. CV
settings: scan rate 0.5 V/s, initial potential -0.2 V, negative switching potential -0.64 V,
positive switching potential +0.1 V, final potential -0.2 V. Background electrolyte: 0.5 M
ammonium formate, 0.05 M sodium phosphate, pH 6.8. All measurements were performed at
ambient temperature in deaerated solution using an Autolab analyzer (Eco Chemie, The
Netherlands) in connection with VA-stand 663 (Metrohm, Herisau, Switzerland). The three-
electrode system was used with Ag/AgCl/3M KCl electrode as a reference and platinum wire
as an auxiliary electrode.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S21
MALDI-TOF spectra of ON products
General remarks:
Peaks at [M – 125] can be assigned to dethymination.
Peaks at [M + 313.2] can be assigned to product extended with additional adenosine (which is
the best substrate for Vent(exo-) DNA polymerase).
Fragmentation of XNO2
modified products corresponds with literature data for mass spectra of
nitrocompounds to contain peaks at M – 16.7
Figure S8. MALDI-TOF spectrum of ON1 ANH2
.
[M+H]+ (calc.) = 9708.4 Da, M (found) = 9708.8 Da.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S22
Figure S9. MALDI-TOF spectrum of ON1 ANO2
.
[M+H]+ (calc.) = 9738.4 Da, M (found) = 9738.5 Da.
Figure S10. MALDI-TOF spectrum of ON2 CNH2
.
[M+H]+ (calc.) = 9685.4 Da, M (found) = 9685.8 Da.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S23
Figure S11. MALDI-TOF spectrum of ON2 CNO2
.
[M+H]+ (calc.) = 9715.4 Da, M (found) = 9715.3 Da.
Figure S12. MALDI-TOF spectrum of ON3 GNH2
.
[M+H]+ (calc.) = 9724.4 Da, M (found) = 9724.6 Da.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S24
Figure S13. MALDI-TOF spectrum of ON3 GNO2
.
[M+H]+ (calc.) = 9754.4 Da, M (found) = 9754.5 Da.
Figure S14. MALDI-TOF spectrum of ON4 UNH2
.
[M+H]+ (calc.) = 9686.4 Da, M (found) = 9686.8 Da.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S25
Figure S15. MALDI-TOF spectrum of ON4 UNO2
.
[M+H]+ (calc.) = 9716.4 Da, M (found) = 9716.0 Da.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S26
NMR spectra of compound dGNO2
Figure S16. 1H NMR spectrum of compound dG
NO2.
Figure S17. 13
C NMR spectrum of compound dGNO2
.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
S27
References
1. E. C. Western, K. H. Shaughnessy, J. Org. Chem., 2005, 70, 6378–88.
2. P. Horáková, H. Macíčková-Cahová, H. Pivoňková, J. Špaček, L. Havran, M. Hocek, M.
Fojta, Org. Biomol. Chem., 2011, 9, 1366–1371.
3. J. Ludwig, Acta Biochim. Biophys. Acad. Sci. Hung., 1981, 16, 131–133.
4. H. Cahová, L. Havran, P. Brázdilová, H. Pivoňková, R. Pohl, M. Fojta, M. Hocek, Angew.
Chem. Int. Ed. 2008, 47, 2059–2062.
5. H. Macíčková-Cahová, M. Vrábel, M. Hocek, Curr. Protoc. Chem. Biol., 2010, 2, 1–14.
6. A. V. Tataurov, Y. You, R. Owczarzy, Biophys. Chem., 2008, 133, 66–70.
7. a) T. Ramdahl, K. Urdal, Anal. Chem., 1982, 54, 2256–2260; b) J. B. Kyzioł, Z.
Daszkiewicz, J. Hetper, J. Mass Spectrom., 2005, 22, 1096–9888.
Electronic Supplementary Material (ESI) for Chemical CommunicationsThis journal is © The Royal Society of Chemistry 2013
Top Related