Neuron, Volume 84
Supplemental Information
Antisense Proline-Arginine RAN Dipeptides Linked
to C9ORF72-ALS/FTD Form Toxic Nuclear Aggregates
that Initiate In Vitro and In Vivo Neuronal Death
Xinmei Wen, Wenzhi Tan, Thomas Westergard, Karthik Krishnamurthy, Shashirekha S.
Markandaiah, Yingxiao Shi, Shaoyu Lin, Neil A. Shneider, John Monaghan, Udai B.
Pandey, Piera Pasinelli, Justin K. Ichida, and Davide Trotti
1
SUPPLEMENTARY ITEMS
1. Supplementary Figure Legends:
Figure S1 (related to Figure 1) shows the randomized codon sequences
encoding the different DRPs. Modules of DRP-encoding specific 25-long
repeats are shown. The modules are repeated in the construct to achieve the
desired DRP length.
Figure S2 (related to Figure 1) shows validation of DRP constructs, expression
analysis and localization of di-peptide repeat proteins.
Figure S3 (related to Figure 2) shows time-lapse imaging approach employed for
survival analysis of neurons in culture.
Figure S4 (related to Figure 1) shows survival analysis of different neuronal
types transfected with DRP constructs, including untagged constructs. ALS-
linked mutation selective toxicity is also shown here.
Figure S5 (related to Figure 2) shows the schematics of plasmid containing
intronic G4C2 repeats expansion, characterization of the constructs and their
expression.
Figure S6 (related to Figure 4) shows additional images of nuclear localization of
PR50 and GR50 and association with nucleolar proteins.
Figure S7 (related to Figure 7) shows representative snapshots, which
demonstrates persistence of PR aggregates after neuron degeneration.
Figure S8 (related to Figure 8) shows western blots and immunocytochemistry
performed to characterize the new commercial anti-PR antibody and subjective
2
assessment of PR staining of an investigator blinded with respect to human
tissue samples.
2. Supplementary Experimental Procedures
3. Supplementary References
3
Figure S1. Randomized codon sequences encoding the different DRPs. Randomized
codons sequences encoding the indicated DRPs. Sequences represent individual modules
4
that are repeated in the construct to achieve the desired encoded DRP length. The cloning
strategy is described in Supplementary Experimental Procedures.
5
Figure S2. Validation of DRP constructs and cellular localization of C9RAN DRPs.
(A) Validation of DRP constructs by immunoblotting using transiently transfected NSC34
6
cells. DRP constructs (50 repeats long) in pcDNA3.1 vectors were transfected in NSC34
cells (1 g DNA/well). Cells homogenates were prepared 48 hours post-transfection and
analyzed on Tricine 10-20% gradient gels. (B) Analysis of DRPs expression levels was done
by probing western blot of NSC34 cell homogenates with anti-GFP antibody. Among
different DRPs, the arginine–rich dipeptides PR and GR showed consistently lower
expression levels. (C) Immunofluorescence performed on NSC34 cells transfected with
different DRPs. Confocal microscopy on cells stained with anti-GFP antibody at 48 hours
post-transfection. Calibration bar is 20 m. (D) Confocal microscopy imaging of cortical
neurons co-transfected at DIV10 with the indicated DRP and synapsin-driven Td-tomato
construct to aid visualization of neurons. Cortical neurons were imaged 48 hours post-
transfection. Expression levels of Td-tomato reporter protein were noticed to be
consistently lower in PR-expressing neurons. Exposure settings were uniform throughout
confocal analysis. Arrows point at aggregates within the soma and neurites (GA50) and
nucleus (GR50 and PR50). Calibration bar is 20 m. (E) DRP constructs (50 repeats long) in
pcDNA3.1 vectors were transfected in primary rat motor neurons at DIV5 (0.5 g
DNA/well). Neurons were imaged by confocal microscopy 24 hours post-transfection.
Calibration bar is 20 m. Arrows point at aggregates within neurites (GA50) and nucleus
(GR50 and PR50). Calibration bar is 20 m.
7
Figure S3. Time-lapse imaging of individual neurons in culture. (A) Schematic of live-
cell longitudinal tracking experiments. Primary cortical neurons are transfected at DIV 10
8
and transfected neurons (Td-tomato+) in the same optical field are imaged at a 24h interval
for up to 9 days post-transfection. To monitor individual neurons, a synapsin promoter
driven Td-Tomato construct was co-transfected as a sensitive reporter of survival. (B)
Representative images of cortical neurons co-transfected with Td-tomato reporter construct
driven by synapsin promoter and GFP-control construct. Calibration bar is 100 m. (C)
Cortical neurons were imaged at transfection day 0 in bright field, which corresponds to
DIV10. Image shows full maturation of the cortical neurons in vitro. The same neurons in
the optical field were then imaged for 8 consecutive days post-transfection at 24-hour
intervals using Td-tomato as fluorescent reporter. Arrows point at 4 neurons that were
successfully transfected in this field. Time-lapse images show the increased expression of the
Td-tomato reporter construct in those neurons that allows visualization of the in vitro
neurites’ network. Calibration bar is 100 m.
9
Figure S4. Survival analysis of different DRPs transfected in motor and hippocampal
neurons. (A) Representative live-cell images of motor neurons co-transfected with Td-
10
Tomato (0.1 g/well; red fluorescence signal shown in top panels) and PR50 cDNA plasmids
(0.4 g/well; green fluorescence in bottom panels). Motor neuron with aggregates died,
while motor neuron with diffused PR50 expression (orange arrow and inlet) did not undergo
neurodegeneration. Calibration bar is 20 μm. (B) Kaplan-Meier survival analysis suggested
that both PR50 and GR50 were toxic to primary motor neurons compared to control
(***P<0.001). Although a trend was observed for GA50 expressing motor neurons difference
with control did not reach significance. At least 40 neurons were followed/group; n=3
independent experiments. (C) Kaplan-Meier survival analysis of hippocampal neurons
transfected with different DRP constructs showed that PR50 was toxic to hippocampal
neurons. At least 80 neurons were followed/group; n=3 independent experiments. (D)
However, hippocampal neurons were less vulnerable to PR50 compared to cortical neurons.
*P<0.05, ***P<0.001. (E) Expression levels of GFP were quantified 72 hours post-
transfection by confocal microscopy measuring immunofluorescence intensity in each
neurons. At least 20 cortical and hippocampal neurons were imaged and quantified (Image J).
Camera acquisition parameters were set the same between the two groups (unpaired t-test;
P=0.0824). Data shown are as mean+s.e.m. (F) Expression of untagged PR50 causes cortical
neuron death, which is not significantly different from that caused by GFP- PR50 as shown
by Kaplan-Meier survival analysis. At least 40 neurons/group; n = 4-6 experiments;
***P<0.001. (G) Immunoflurescence analysis using α-PR antibody shows that untagged
PR50 forms nuclear aggregates. Td-Tomato signal indicates a neuron transfected with
untagged PR50. (H) Western blot using lysates of NSC34 transfected with untagged PR50
shows that untagged PR50 is recognized by α-PR antibody and runs at predicted molecular
weight. (I, J) Survival analysis of primary cortical and motor neurons transfected with
human wild type SOD1 or the ALS-linked SOD1-G93A mutant. Expression of ALS-linked
11
mutant SOD1-G93A did not affect survival of cortical neurons (I), while it was neurotoxic
to motor neurons (J). At least 80 cortical and 40 motor neurons are followed/group; at least
3 independent experiments. ***P<0.001.
12
Figure S5. Generation of GFP plasmids containing intronic G4C2 repeats expansion.
(A) Schematic of GFP construct harboring intronic GGGGCC repeat expansions. The
13
insert has been subcloned into the GFP splicing reporter plasmid, pGint (plasmid 24217;
Addgene; pEGFP-N1 vector backbone) (B) Restriction analysis showing the correct
calculated size for the R0, R21 and R42 inserts. Lanes indicate individual bacterial colonies
from which the DNA has been extracted. Confirmation of the presence or absence of
GGGGCC repeat sequences in R0, R21 and R42 constructs was obtained by sequencing.
Analysis of the R21 and R42 sequence was only partially successful due to their high GC
content. (C) Representative images of co-transfection strategy. Cortical neurons were co-
transfected with 0.2 g of Td-tomato cDNA and 0.8 g of R42 cDNA constructs/well at
DIV10 and live imaged over time. Each neuron expressing Td-tomato fluorescent protein
also expressed GFP from the R42 construct. Calibration bar is 100 m. (D)
Immunoblotting analysis of NSC34 cells transfected with R0-42 constructs showed that the
presence of G4C2 repeats in the intronic sequence of the construct did not affect GFP
expression in NSC34 cells, suggesting correct splicing. (E) Fluorescent in situ hybridization
(FISH) analysis shows RNA nuclear inclusions detected in NSC34 cells transfected with
R21-42 constructs. R0 construct serving as control did not produce nuclear inclusions.
DAPI was used to stain the nucleus. Cells were fixed and in situ hybridized with Cy3-linked
(CCCCGG)4 probe. Red staining represents positive hybridization of the probe. Calibration
bar is 5 m.
14
Figure S6. Nuclear localization of PR50 and GR50 and association with nucleolin. (A)
Immunofluorescence staining of PR50 transfected motor neuron with SMI32 and nucleolin
15
showed that PR nuclear aggregates co-localized with nucleolin. DAPI: blue; Nucleolin: red;
GFP-CTRL or GFP-PR50: green; SMI32: magenta. (B) 3D reconstructions of cortical
neurons transfected with PR50 and stained for nucleolin. Nuclear aggregates formed by PR
appeared enclosed by nucleolin. DAPI: blue; Nucleolin: red; GFP-PR50: green. (C, D) PR
nucleolar staining was confirmed by its co-localization with fibrillarin. Orthogonal view
showing co-localization of PR nuclear aggregates and fibrillarin. DAPI: blue; GFP-PR50:
green; Fibrillarin: magenta. Calibration bars are 10 m. (E) 3D reconstruction of cortical
neurons transfected with GR50 and stained for nucleolin. DAPI: blue; Nucleolin: red; GFP-
GR50: green. Calibration bars are 10 m.
16
Figure S7. PR aggregates persist in the dish after the neuron has degenerated and
lost membrane integrity. Motor neurons were co-transfected at DIV 5 with Td-Tomato
17
and GFP-PR50 and monitored over time. At 24 hours post-transfection, distinct nuclear
aggregates were detected. At 28 hours post-transfection, nuclear aggregates became more
prominent and the soma swelled. At 36 hours post-transfection, the motor neuron lost its
membrane integrity and died, while prominent PR aggregates remained. Calibration bar is
100 m.
18
Figure S8. Nuclear localization of PR aggregates in spinal cord tissues from C9 ALS
and C9 ALS/FTD patients. (A, B) Characterization of the α-PR antibody from
19
ProteinTech. HEK-293 cells were transfected with DRP constructs and the control
construct, and cell lysates were subjected to immunoblotting. The α-PR antibody from
ProteinTech recognized poly-PR at predicted molecular weight with decent specificity. Actin
was used as a loading control. Immunofluorescence analysis suggests that the α-PR antibody
from ProteinTech specifically recognizes poly-PR. DAPI: blue; GFP-PR50: green; α-PR: red.
Calibration bar is 10 μm. (C) Intensity of nuclear and extranuclear PR staining in human
tissues was quantified subjectively by 3 blinded investigators. 10 representative 15-slice z-
series images from each patient (a total of 80 images) were randomized for each investigator.
The investigators ranked the PR fluorescent levels as absent, light, moderate, or heavy. The
rankings were added up and taken as a percent of images quantified. - = 0%; +/- = 1 – 25%;
+ = 26 – 50%; ++ = 51 – 75%; +++ = 76 – 100%. (D) Orthogonal view of nuclear PR
inclusion in C9-ALS/FTD patient spinal cord section. DAPI: blue; PR: red. Calibration bar
is 10 μm.
20
SUPPLEMENTARY EXPERIMENTAL PROCEDURES
Plasmids. Intronic G4C2 repeats constructs were generated by synthesizing (GGGGCC)21
sequence (Integrated DNA technology) containing upstream XmaI and downstream
NgoMIV sites and cloned between BamHI and SalI sites of pGint plasmid (Bonano et al.,
2007). To expand the length of GGGGCC repeats, a NheI/NgOMIV fragment was inserted
into the same vector with NheI/XmaI cut. C9RAN dipeptide repeat flag-EGFP vectors
were created by annealing the TTAAG
GCCACCATGGATTACAAGGATGACGACGATAAGAAGCTTTGGCGGCGGTACC
GAGCTCGGATCCACTACTCCAGTGTGGTGG sequence and
AATTCCACCACACTGGAGTAGTGGATCCGAGCTCGGTACCGCCGCCAAAGCTT
CTTATCGTCGTCATCCTTGTAATCCATGGTGGCC into AflII/EcoRI cut pEGFP
vector (Tan et al., 2013). Sense poly-GA, GP, GR peptides were made from oligos
containing BamHI-HindIII-XmaI-25 repeats of randomized exon codons-NgOMIV-KpnI
SalI inserted into pGint cut with BamHI/SalI. The repeats were expanded multiple times to
create up to 400 repeats using the same strategy we used for the intronic G4C2 repeat
expansions. The different exonic RAN dipeptide constructs were generated by subcloning
into HindIII/KpnI sites of the flag-EGFP vector. Antisense poly-PA, PR peptides were
made from oligos containing BamHI-HindIII-NgOMIV-25 repeats of randomized exon
codons-XmaI-KpnI-SalI inserted into pGint cut with BamHI/SalI. Repeats were expanded
by subcloning of XmaI/SalI fragments into NgOMIV/SalI vector. Constructs encoding
poly-PA or poly-PR at different lengths were generated using the strategy described for the
sense constructs. Constructs encoding untagged PR50 were generated by subcloning PR
sequence (length=50 repeats) from PR50 – pGint construct into pcDNA 3.1 between XhoI
and EcoRI. Short hairpin RNAs targeting C9ORF72 (Open Biosystem, #RHS4531-
21
NM_018325) and non-silencing control shRNAs (Open Biosystem, #RHS4346) were
purchased from Open Biosystem.
Longitudinal live-cell imaging analysis. Longitudinal live-cell imaging was performed on
neuronal cultures (human and rat). Survival and risk of death analyses were performed on
images acquired by an automated imaging system consisting of an inverted Nikon Eclipse Ti
microscope equipped with PerfectFocus, a Tokai Hit stage top incubator with gas and
temperature controller and a CoolSNAP ES2 High-performance CCD camera. Stage and
shutter movements, focusing and image acquisition are fully automated and controlled by PC
running NIS-elements Ar microscope imaging software (Nikon). With automated
microscopy, tens of individual neurons were imaged from each group at regular 24-h
intervals. Td-tomato fluorescence served as a sensitive survival marker for cortical,
hippocampal and motor neurons as well, as loss of fluorescence, retraction of neurites or
disruption of the plasma membrane indicates cell death. It also has the advantage of
assessing all forms of cell death, apoptotic and non-apoptotic, in the same assay, thereby
rendering them more sensitive to gauge neurotoxicity (Strebel et al., 2001). Both GFP and
Td-tomato signals were monitored over time. DRPs aggregation and neuronal survival data
were extracted from files generated with automated imaging by visual inspection.
iPSC-derived neurons. XCell’s Human Neuro Kit containing cryo-preserved, pre-
differentiated mixed population neurons derived from a footprint-free, karyotype normal
iPSC line was purchased from XCell Science (cat.# XN-001-S-NH). Mature neurons were
obtained within 8 days following manufacturer’s protocol. At 8 days post-seeding, the cell
22
population contained >98% neurons and <1% GFAP-positive cells. Cells were transfected
with the DRP constructs following the protocol reported for rat neurons.
Human-induced motor neurons from C9ORF72 patients and controls. Induced motor
neurons were derived from iPSCs generated from two C9ORF72-ALS patients (Coriell ID
ND06769 and ND10689) and controls (ND03231 and ND12133) using the forced
expression of ASCL1, BRN2, MYT1L, NGN2, LHX3, ISL1, and NEUROD1 and culturing
in N3 medium containing DMEM/F12, 1% N2 (Life Technologies), 2% B27 (Life
Technologies), penicillin/streptomycin (Genesee Scientific), 10 ng/ml bFGF (Peprotech), 10
ng/ml GDNF, 10 ng/ml BDNF, and 10 ng/ml CNTF (all R&D Systems) for 15 days as
previously described (Son et al., 2011). iPSCs were derived using episomal plasmids as
described (Okita et al., 2011) and used for induced motor neuron generation at passage 7 or
greater. Induced motor neurons were labeled by co-transduction of a lentivirus expressing
channelrhodopsin-YFP under the control of the Hb9 enhancer. Cells were fixed 15 days
post-transduction using 4% PFA/PBS and permeabilized using 0.05%Tween-20/PBS. After
blocking with 10%FBS/0.01%Tween-20/PBS, cells were incubated with primary antibody
overnight in 4 OC and then incubated with Alexa Fluro conjugated secondary antibody.
Image was taken using Zeiss LSM780 confocal microscopy and modified with ImageJ. For
survival analysis, the starting number of iMNs in each well was determined by counting at
the peak of iMN formation at day 15 post-transduction. Induced MNs were counted again at
days 20, 25, 30, and 35 and the number of iMNs surviving was determined by dividing the
number of iMNs remaining in each well at each time point by the starting number of iMNs
in that well at day 15. Each patient or control sample was assayed in biological triplicate and
Kaplan-Meier survival analysis was performed.
23
Analysis of human samples. Lymphoblasts from one C9ORF72-ALS patient (Coriell ID
ND06769) and one neurologically normal population control (Coriell ID ND11463) were
obtained from Coriell. Postmortem samples were donated to the New York Brain Bank by
patients and their families cared for in the Eleanor and Lou Gehrig ALS Center at Columbia
University (Three control individuals with no neurological disease, three C9ORF72 ALS
cases and two ALS non-C9ORF72 cases). The clinical diagnosis of ALS was confirmed by
neuropathological studies. The presence or absence of the C9ORF72 hexanucleotide
expansion was determined by repeat primed PCR analysis of blood DNA. For
immunofluorescence analysis, 5 μm frozen sections were obtained from flash frozen spinal
cord tissues. Prior to fixation and permeabilization, slides were equilibrated in room
temperature PBS for 5 minutes. Tissues were then fixed and permeabilized with ice-cold
acetone at -20°C for 15 minutes. Slides were washed three times with PBS and then the
tissues blocked with 10% goat serum, 0.5% BSA, and 0.5% Triton x-100 for 1hr. Tissues
were then incubated for 1hr with indicated primary antibodies in 2% goat serum, 0.5% BSA,
and 0.5% Triton x-100. Slides were washed three times with PBS and then the tissues
incubated for 1h with goat raised secondary antibody in 2% goat serum, 0.5% BSA, and
0.5% Triton x-100. A secondary not specific to the primary antibodies was added to
highlight tissue artifacts and distinguish specific binding. Slides were washed three times with
PBS and coverslips mounted with Prolong Gold Antifade Reagent with DAPI and imaged
analyzed by Olympus, Fluoview FV1000. Primary antibodies used include α-PR (gift from
Dr. Petrucelli, 1: 1,000), α-PR (ProteinTech#23979-1-AP, 1:1,000), α-nucelophosmin
(Millipore#MABE937, 1:100).
24
Western Blots. For detection of DRPs, protein extracts were run on 10-20% Trincine gels
and transferred to PVDF membranes with 0.2 m pore size. For detection of other proteins,
proteins extracts were run on Any KD Glycine gels and transferred to nitrocellulose
membranes. Following primary antibodies were used at indicated dilutions: α-GA, α-GP, α-
GR, α-PA and α-PR antibodies (gifts from Dr. Petrucelli, 1:1,500), α-GFP (Clontech
#632381, 1:3,000), α-PARP (Cell Signaling #9542, 1:1,000), α-GAPDH (Fitzgerald #10R-
G109a, 1:10,000), α-C9ORF72 (Sigma #HPA023873, 1:150), α-Actin (Sigma#A2103,
1:1,000), α-PR (ProteinTech#23979-1-AP, 1:3,000).
Dot Blots. Transfected NSC34 and cortical neurons were collected at 24h to 72h post-
transfection and lysed in 0.1% SDS-RIPA buffer. Equal amount of cell lysates were loaded
onto nitrocellulose membranes, and membranes were allowed to dry at room temperature.
Then, the membranes were immunoblotted with indicated antibodies using the same
protocol as western blotting.
Fluorescent In Situ Hybridization. RNA fluorescent in situ hybridization (FISH) was
done according to the protocol reported in Donnelly et al. (2013) with modifications. Briefly,
cells transfected with R0-42 transcripts were fixed in 4% PFA in PBS and permeabilized
with 0.3% Triton for 15 min. at room temperature and hybridized for 35 min. at 70 C with
0.5 nM (CCCCGG)4 probe.
Fly transgenesis and experiments. Transgenic flies that carry GAL4-activatable genes
encoding RAN proteins were made by phiC31 mediated integration of C9RAN-protein-
PUASTattb at a defined attP site on the 3rd chromosome (86F8). The attP site is carried by
25
fly stock number 24749 at the Bloomington Drosophila Stock Centre (Bischof et al., 2007).
The strains were stabilized using the 3rd chromosome balancers TM6B and TM3 for motor
neuron and eye studies respectively. Eye expression was induced by crossing C9RAN
protein flies with the GMR GAL4 strain (Lanson et al., 2011) at 25C. Motor neuron
expression was induced by crossing C9RAN protein flies with the OK371 GAL4 strain at
25C (Mahr and Aberle, 2006). Muscle expression was induced by crossing C9RAN protein
flies with the MHC GAL4 strain at 25 C. Eye phenotype were scored based on 4 criteria:
reduction in size of the eye, loss of pigmentation in the eye, disruption of the ommatidial
array; altered hair growth between the ommatidia. Each criteria was scored 1 to 4 depending
on the severity. Signicant difference between the genotypes was assessed using one way
ANOVA and Scheffe's post-hoc test. For the viability assay C9RAN protein flies containing
the TM6b balancer were crossed with OK371 GAL4 driver flies. Viability of F1 C9RAN
protein expressors was normalized to viability of F1 TM6b. For western blot analysis
thoraxes were collected C9RAN protein flies, snap frozen, crushed to dust on dry ice,
suspended in RIPA buffer, sonicated to further promote cellular lysis, suspended in laemli
buffer and subjected to acrylamide gel electrophoresis. Proteins were transferred to a
nitrocellulose membrane by western blot and detected using the following antibodies FLAG
M2 (Sigma Aldrich #F1804, 1:500), GFP B2 (Santa Cruz Biotechnology #sc-9996, 1:500),
Tubulin (Sigma Aldrich #T5168, 1:10,000). For immunofluorescence analysis third instar
larvae of flies that express GFP tagged C9RAN proteins in motor neurons were pinned to a
silicon bed in a petri dish full of PBS and flayed so that the larval brain was visible. These
larvae were fixed for 1 hour in 3 % formaldehyde in PBS and then probed with the
following antibodies: anti-Lamin (Developmental Studies Hybridoma Bank #ADL84.12,
26
1:200), anti-mouse Alexafluor546 (Invitrogen A11030, 1:500). Imaging was done on an
Olympus confocal microscope.
Quantitative PCR. Total RNA was extracted from Drosophila melanogaster (wandering
third instar larvae OK371-GAL4 motor neuron expressors, day-one-white-pre-pupae GMR-
GAL4 eye expressors) using trizol reagent (Life technologies). Total RNA was used as
template for reverse transcription using oligo dT to produce cDNA (Revertaid first strand
cDNA synthesis kit, Thermo scientific). Quantitative PCR was done on a 7500 Real-Time
PCR system (Life technologies). The RAN50 mRNA levels were normalized against alpha
Tubulin 84b mRNA levels. RAN50 mRNA was detected using a primer/probe set that
targets the 3'UTR of PUASTattb-inserted transgenes (F: TGG TGT GAC ATA ATT GGA
CAA AC; R: ACT AGA TGG CAT TTC TTC TGA GC; Probe: /56-FAM/CT GAT GAA
T/Zen/G GGA GCA GTG GTG GAA/3IABkFQ/). Alpha Tubulin 84b mRNA was
detected using the following primer/probe set (F: CCT CGA AAT CGT AGC TCT ACA C;
R: ACC AGC CTG ACC AAC ATG; Probe: /56-FAM/TC ACA CGC G/Zen/A CAA
GGA AAA TTC ACA GA/3IABkFQ/).
SUPPLEMENTARY REFERENCES
Bischof, J., Maeda, R.K., Hediger, M., Karch, F., and Basler, K. (2007). An optimized
transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl
Acad Sci U S A 104, 3312-3317.
Bonano, V.I., Oltean, S., and Garcia-Blanco, M.A. (2007). A protocol for imaging alternative
splicing regulation in vivo using fluorescence reporters in transgenic mice. Nat Protoc 2,
2166-2181.
27
Mahr, A., and Aberle, H. (2006). The expression pattern of the Drosophila vesicular
glutamate transporter: a marker protein for motoneurons and glutamatergic centers in the
brain. Gene expression patterns : GEP 6, 299-309.
Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S., Hong, H.,
Nakagawa, M., Tanabe, K., Tezuka, K., et al. (2011). A more efficient method to generate
integration-free human iPS cells. Nature methods 8, 409-412.
Son, E.Y., Ichida, J.K., Wainger, B.J., Toma, J.S., Rafuse, V.F., Woolf, C.J., and Eggan, K.
(2011). Conversion of mouse and human fibroblasts into functional spinal motor neurons.
Cell Stem Cell 9, 205-218.
Strebel, A., Harr, T., Bachmann, F., Wernli, M., and Erb, P. (2001). Green fluorescent
protein as a novel tool to measure apoptosis and necrosis. Cytometry 43, 126-133.
Tan, W., Naniche, N., Bogush, A., Pedrini, S., Trotti, D., and Pasinelli, P. (2013). Small
peptides against the mutant SOD1/Bcl-2 toxic mitochondrial complex restore mitochondrial
function and cell viability in mutant SOD1-mediated ALS. J Neurosci 33, 11588-11598.
Top Related