species- Mus musculus
Engineering the mouse genome
David Ornitz
Time line for mouse genetic engineering
Development of chimeras between embryos with different genotypes !Transgenic mice first derived by infecting embryos with retroviruses !First DNA injection into mouse eggs !!First embryonic stem cells developed !Germline contribution of ES cells !First genetic modification of an ES cell (HPRT gene) !Improved vectors for homologous recombination
1960s !!1974, 1976 !!1980 1981 !1981 !1984 !1987 !!1987 !
Tarkowski, Mintz, Gardner !!Jaenisch and Mintz !!Gordon, Brinster, Constantini, Lacy, Wagner Martin, Evans, Kaufman !Bradley !Smithies !!!Thomas and Capecchi.
Time line for mouse genetic engineering - cont.
Phenotypic consequences of targeted genes !Conditional gene targeting-cre/lox !Conditional gene targeting-flip/FRT !Multiple conditional alleles, cre, flip !Somatic cloning of mice !Lentiviral vectors for transgenesis !RNAi in mice !Sleeping Beauty transposon mutagenesis !Conditional Mouse Knockout Project !Genomic editing
1990+ !1992/1993 !1996 !1998- !1998 !2002 !2002 !2005 !2006 - !2010 -
Marth, Rajewsky !Dymecki !Martin !Wakayama et al !Lois, Baltimore !Conklin,Rosenquist !Jenkins,Copeland !EUCOMM, KOMP
The Nobel Prize in Physiology or Medicine 2007
"for their discoveries of principles for introducing specific gene modifications in mice by the use of embryonic stem cells"
Mario R. Capecchi Sir Martin J. Evans Oliver Smithies
How do we analyze gene function in mice?
!Gene addition (transgenic approach)
Permits GOF, DN and knockdown experiments
Ectopic (spatial or temporal) expression
Allows gene regulatory elements to be tested
Allows populations of cells to be marked with a reporter gene
!Targeted mutations
Specific genes can be targeted
Unexpected phenotypes (lethal phenotype may result prior to the spatial and temporal site of interest)
Must be very careful to make a null allele
!Tissue-specific (conditional) targeted mutations
Provides some of the best features of gene targeting and transgenic approaches
May be combined with enhancer trap and gene trap experiments.
An effective method to circumvent embryonic lethality.
Breeding mice
gestation period-19 days
(range is 18-21 days depending on strain)
age at weaning-21 days
sexual maturity-females 4-5 weeks, males-6-8 weeks
birthweight-1 gm
weaning-8-12 gm
adult-30-40 gm
Preimplantation mouse development
Aggregation chimerasBefore the use of microinjection aggregation chimeras were the only way to genetically modify cells and test them during mouse
development
Morula aggregation,
used to make chimeras between two different genetic backgrounds
ES/EC cell chimera
add genetically modified cells to a mouse
Routes for Introducing Genes into Mice
1) Microinjection of DNA into zygotes
2) Injection of embryos with recombinant virus
3) Transfection of ES cells with cloned DNA
Selection,Characterization
Chimeraformation
Transgenic Mice
Transgenic Mice: Gene addition
!Random insertion of DNA into the mouse genome
!Permits GOF, DN and knockdown experiments
!Allows gene regulatory elements to be tested
!Allows populations of cells to be marked with a reporter gene
!Occasionally allows endogenous genes to be trapped
!!
Components of a Transgene
!
promoter + enhancer
gene coding sequence or cDNA
polyadenylation signal
promoter cDNA splice/poly A
Things that are good:
introns
!Things that are bad:
plasmid sequence, lack of introns
example: Elastase Promoter
!cell-type specific expression
200 bp is sufficient for expression
Pr/En hGH Pr/En splice/poly Apoly A v-ras
cDNA
Transgenic mouse issues:
Tissue specificity
ectopic expression
chromosomal integration site may affect expression
!Temporal specificity
Level of expression
Insertional mutagenesis
How to make a transgenic mouse1. Fusion Gene Construct 2. Superovulated Female
PromoterATG
Coding Sequence p(A)
Microinjection
3. Germline Integration
Fertilized Eggs
TRANSGENIC MOUSE
4. DNA Analysis
5. Breeding
from Manipulating the Mouse Embryo
a laboratory manual, CSHL press
http://mgc.wustl.edu/
http://mgc.wustl.edu
Homologous recombination using embryonic stem cells
• First completely unbiased experiment of gene function
in an entire mammalian organism.
• Discover unanticipated early embryonic roles
!Potential problems:
!• Embryonic lethality
• Redundancy
!
Events leading to the development of
Embryonic Stem Cells
!Teratoma
!tumors composed of various tissues foreign to their site of origin.
!can be formed by transplanting pieces of embryos to extra uterine sites.
!Teratocarcinoma
!undifferentiated malignant stem cells, metastasize, lethal
!made by transplanting day 6-7 mouse embryos under the kidney capsule
!resulting tumors can be passaged and cultured to yield embryonal
carcinoma cells
Embryonic Stem Cells-cont.EC cell lines
variety of stages of differentiation and variable capacity to differentiate
!exponential growth and feeder cells are required to prevent differentiation
!differentiation can be induced by aggregation
!differentiation can be induced by drugs, RA or DMSO.
ES cells
!a normal pleuripotent cell line isolated from normal embryo without
passing through a tumor stage.
!when reintroduced into the embryonic environment ES cells can generate
high grade chimeras.
!essential to grow on feeder cells (STO fibroblasts or MEFs).
!LIF/DIA is required to maintain pleuripotency of ES cells.
Establishment of ES cell lines:
transfer intact blastocysts into culture
grow to stage of early post implantation embryo
dissociate embryonic from extraembryonic tissue
continue to culture ICM.
2 days after
disaggregation
of ICM
4 days after
disaggregation
First passage
Chimeric mouse
ES cells derived from 129/SV strain, agouti coat color!injected into a C57/B6 blastocyst.!!Mate chimeric mouse to ‘Black mouse’ (C57/B6J)!identify agouti offspring!
Gene Knockout
exonexonexonexon
exonexonexonexon
genetic engineering using embryonic stem cells
critical exon
X
Practical issues for basic gene targeting:
✴ length of homology
✴ probes to detect homologous recombination
✴ vector design (with or without negative selection)
Target gene
Targeting vector
Targeted allele
homologous recombinationTarget gene
Targeting vector
Targeted allele
random integration
Homolgous recombination vs. random integration
Issues in interpreting targeted mutationsMust be very careful to make a null allele
haplotype insufficient
recessive
!Prove that an allele is null
gene expression
protein expression
assay for activity of protein
!Other types of alleles
hypomorphic allele
dominant negative
linked random mutation - generate multiple ES lines
recessive
!!
Xu, X., Weinstein, M., Li, C., Naski, M., Cohen, R. I.,
Ornitz, D. M., Leder, P., and Deng, C. (1998). Fibroblast
growth factor receptor 2 (FGFR2)-mediated regulation loop
between FGF8 and FGF10 is essential for limb induction,
Development 125, 753-765.
Arman, E., Haffnerkrausz, R., Chen, Y., Heath, J. K., and
Lonai, P. (1998). Targeted disruption of fibroblast growth
factor (Fgf) receptor 2 suggests a role for fgf signaling in
pregastrulation mammalian development, Proc. Natl. Acad.
Sci., U S A 95, 5082-5087.
Issues in interpreting targeted mutations - cont.Neighboring gene effect
!✴ PGK promoter - neo may influence a nearby gene
!✴ remove the selection cassette to avoid this potential problem
!Unexpected phenotype
!✴ lethal phenotype may result prior to the developmental
stage of interest
Targeted
allele
PGK-Neo
Cell, Vol. 85, 1–4, April 5, 1996, Copyright 1996 by Cell Press!Know Your Neighbors: Three Phenotypes in Null Mutants of the Myogenic bHLH Gene MRF4!E. N. Olson,* H.-H. Arnold,† P. W. J. Rigby,‡ and B. J. Wold§ c
loxP loxP flox = flanked by lox
Removing the Neo selection cassette
exon
X
exonPGK-NEOexon
exonexonexonexon
genetic engineering using embryonic stem cells
Xexonexonexon
critical exon
germline promoter - Cre recombinase
PGK-NEO
X
Advanced gene targeting issues
!Targeting one allele versus both alleles
!Gene replacement using recombinases
!Knockin mice
Conditional tissue-specific targeted mutations
!✴ provides some of the best features of gene targeting and
transgenic approaches
!
✴ may be combined with enhancer trap and gene trap experiments
!
✴ the targeted gene can be modified using cre and flip recombinases
!
✴ may be used in conjunction with inducible promoters
exon
critical exon
loxP loxP flox = flanked by lox
exon
X
exonexonexon
Xexonexonexon
critical exon
Regulated activation/inactivation of a gene using CreER fusion proteins
tissue specific promoter -CreER
recombinase
+ tamoxifennuclear translocation
Cytosol
EUCOMM gene targeting vector
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
Cre
null, reporter allele
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
Flp
conditional allele
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homologySA-T2A-CreER-PA
Genomic Editing
Zinc finger nucleases (ZFNs)
TAL effector nucleases (TALENs)
CRISPR/Cas9
General principle is to target a non-specific nuclease (FokI) to a specific DNA sequence
!
Double stranded break will induce non-homologous end joining which can disrupt gene function
!
Single stranded breaks (nicks) can induce homology-directed repair with a double or single stranded DNA template
Genomic Editing
Modular assembly of individual zinc fingers
Left and Right target sequence with 5 nt spacer
Zinc finger nucleases (ZFNs)
Rémy, 2010
L
R
TAL Effector Nucleases (TALENs)
GATGCATGCACTGTAGTCACTGCA GCT…GTT
TALEN repeats
(DNA binding domain)
FokI nuclease
domain
FokI nuclease
domain
cleavage
within
spacer region
DNA target
TALEN repeats
(DNA binding domain)
L
R
Nonspecific FokI nuclease domain fused to a customizable DNA-binding domain to target a single genomic locus
!FokI nuclease functions as a dimer to cleave double stranded DNA
- can form unwanted dimers
- off-target mutagenesis is relatively frequent
!Obligate heterodimeric FokI nuclease domains (“KK” and “EL”)
- can reduce the formation of unwanted homodimers
- may have improved specificities
!Single stranded cuts (nickases) can be promoted by
inactivating the catalytic activity of one monomer of a ZFN or TALEN dimer
TAL Effector Nucleases (TALENs)
KK and EL are two obligatory heterodimeric FokI variants
!kk and el are catalytically inactive monomers (D450A mutations)
!L-KK/R-EL and L-EL/R-KK are active ZFN pairs
!nickases can be formed, either by pairing L-KK with R-el or L-kk with R-EL
Kim et. al., 2012
Nickase design (single strand break)
CRISPR/Cas9 SystemCRISPR (clustered regularly interspaced short palindromic repeats)
!Streptococcus pyogenes SF370 type II CRISPR locus - 4 genes:
Cas9 nuclease
two noncoding CRISPR RNAs (crRNAs)
trans-activating crRNA (tracrRNA)
precursor crRNA (pre-crRNA) array containing nuclease guide
!Facilitates RNA-guided site-specific DNA cleavage
!Cas9 nucleases can be directed by short guide RNAs (gRNA) to induce precise cleavage at endogenous genomic loci
!Cas9 can also be converted into a nicking enzyme
!Multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome
Cong et al., Science 2013; Mali et al, Nature Methods 2013
Cas9-sgRNA targeting complexes
sgRNA (short guide RNA)
Target recognition and cleavage require protospacer sequence complementary to the spacer and presence of the appropriate NGG PAM sequence at the 3′ of the protospacer
PAM - Protospacer-adjacent motif
Type II CRISPR specificity suggest that target sites must perfectly match the PAM sequence NGG and the 8- to 12-base “seed sequence” at the 3′ end of the gRNA.
!The importance of the remaining 8 to 12 bases is less well understood and may depend on the binding strength of the matching gRNAs or on the inherent tolerance of Cas9 itself.
Mali et al, Nature Methods, 2013
Cas9-sgRNA targeting complexes sgRNA (short guide RNA)
Target recognition and cleavage require protospacer sequence complementary to the spacer and presence of the appropriate NGG PAM sequence at the 3′ of the protospacer
Cas9 enables programmable localization of dsDNA, RNA and proteins. Proteins can be targeted to any dsDNA sequence by simply fusing them to Cas9nuclease-null
PAM - Protospacer-adjacent motif
Fgf14 is a non-secreted cytoplasmic
protein with no known biochemical or
biological function.
Fgf14 is expressed in the central nervous
system of embryonic and adult mice.
mligl
mligl
Fgf14 targeting
9kb
4.5kb
9kb7.5kb
ES clones
5' 3'
WT
K/O
Δ Neo
6.3kbNeo
WT
K/O
Δ Neo
6.3kbNeo
Wild type locus
Targeted locus Exon2-LacZ
1kb
In situ and northern blot anaylsis of FGF14 expression
FGF14 in situ LacZ in situ
wt
-/-
28s
18s
wt -/- -/+ wt -/- -/+northern blot
Fgf14 expression patterns in basal ganglia!hippocampus and cortex
CPu
GPSN
CC DG
Fgf14-/- WT
In vivo foot printing
WT
Fgf14-/-
Accelerating rotorod
0
50
100
150
200
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
+/+
+/-
-/-
Sensory Motor Tests
Missense mutation in the human FGF14 gene
Van Swieten, J. C., Brusse, E., De Graaf, B. M., Krieger, E., Van De Graaf, R., De
Koning, I., Maat-Kievit, A., Leegwater, P., Dooijes, D., Oostra, B. A., and Heutink, P.
(2003) A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia, Am J Hum Genet 72, 191-199
Dalski, A., Atici, J., Kreuz, F. R., Hellenbroich, Y., Schwinger, E., and Zuhlke, C. (2005) Mutation analysis in the fibroblast growth factor 14 gene: frameshift mutation and polymorphisms in patients with inherited ataxias, Eur J Hum Genet 13, 118-120
Brusse, E., de Koning, I., Maat-Kievit, A., Oostra, B. A., Heutink, P., and van Swieten,
J. C. (2005) Spinocerebellar ataxia associated with a mutation in the fibroblast growth factor 14 gene (SCA27): A new phenotype, Mov Disord 21, 396-401.
Missense mutation in the human FGF14 gene
Large, three-generation Dutch family
!Childhood-onset postural tremor
!Slowly progressive cerebellar ataxia
Only moderate cerebellar atrophy in older patients
!Dyskinesia
!Low IQ and deficits in memory
!Autosomal dominant
!Mutation in the FGF14 gene
T1-weighted MRI
(van Swieten et al, Am. J. Hum. Genet., 72:191-199, 2003)
Qing Wang
JL Lou
Maolei Xiao
Marie Kozel
Fernanda Laezza
Benjamin Gerber
Kelvin Yamada
Jeanne Nerbonne
!
Behavioral Tests
Mark Bardgett
David Wozniak
Behavior Core
Dept. of Psychiatry
Top Related