Download - RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Transcript
Page 1: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

RNA localization

and translation

J. Dictenberg, Ph.DJ. Dictenberg, Ph.D

Biological Sciences, 833NBiological Sciences, 833N

Page 2: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

I. Introduction to messenger RNA (mRNA) localization

II. Motor dependent localization of mRNA in yeast:The paradigm for molecular motor dependenttransport of mRNAs

III. Progress & parallels in other cells where molecularmotors are involved in mRNA transport and

localizationFibroblastsNeurons

Page 3: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Dogma of genetic flow in cells

3'

5'

5'

DNADNA

mRNAmRNA

proteinprotein

mRNAmRNA

NucleusNucleus

CytoplasmCytoplasm

mRNA is a messenger of genetic information inthat it encodes for proteins

Page 4: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

mRNA localization: regulation of gene expression in the cytoplasmmRNA localization: regulation of gene expression in the cytoplasm

AA D

E

Drosophila Drosophila oocyteoocyte XenopusXenopus embryo embryo

FF GG H IE

Budding YeastBudding Yeast

FibroblastFibroblast

NanosNanos mRNA mRNA fatVgfatVg mRNA mRNA XpatXpat mRNA mRNA ASH1ASH1 mRNA mRNA

Panels A –D, F,G modified from Kloc M , Zearfoss, R., and Etkin, L. Cell 108:535 (2002).Panel E provided by Amber Wells. Panels H,I from Huettelmaier, et al., Nature 438:512-515 (2005).

NeuronsNeurons-actin-actin mRNA mRNA -actin-actin mRNA mRNA -actin-actin

ZBP1ZBP1

Page 5: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Why Localize mRNA?Why Localize mRNA?

1.1. ItIt’’s an efficient means of sortings an efficient means of sortingproteinsproteins

2.2. Spatial-temporal regulation of geneSpatial-temporal regulation of geneexpressionexpression

3.3. Determination of asymmetry inDetermination of asymmetry indevelopmentdevelopment

4.4. Promote assembly of proteinPromote assembly of proteincomplexescomplexes

5.5. Prevent inappropriate interactionsPrevent inappropriate interactions

Page 6: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

AAAAAA5’- -3’

ProteinProteinCoding sequenceCoding sequence

33’’ untranslated region (UTR) untranslated region (UTR)

ZipcodeZipcode Cis Cis acting factors are found inacting factors are found inthe mRNA sequencethe mRNA sequence

TransTrans acting factors interact with acting factors interact withthe mRNA sequence (e.g. proteins)the mRNA sequence (e.g. proteins)

How do mRNAs localize in cells?

AAAAAA AAAAAA

AAAAAA

AAAAAA

AA

AA

AA

mRNAmRNAlocalizationlocalization

PerinuclearPerinuclear

DistancesDistancestraveled:traveled:4 to >2004 to >200μμmm

nucleusnucleus cytoplasmcytoplasm

In a cell, mRNAs are localizedIn a cell, mRNAs are localizedseveral microns from the nucleusseveral microns from the nucleus

Trans acting factors bind to Trans acting factors bind to ciscis acting elements found in the mRNA acting elements found in the mRNAsequence to facilitate transport, localization and protein expressionsequence to facilitate transport, localization and protein expression

Page 7: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Untranslated regions are important!

Red - +3’UTRGreen - -3’UTRBlue - Nucleii

Page 8: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Ash1Ash1mRNA inmRNA inyeastyeast

Hunchback &Hunchback &caudalcaudal mRNA in mRNA inDrosophilaDrosophilaembryosembryos

nanosnanos mRNA inmRNA inDrosophilaDrosophilaoocytesoocytes

examplesexamples

MyosinMyosin

Type VType V

nonenonenonenoneMotorMotorproteinprotein

ActinActinActinActinCytoskeletalCytoskeletalsystemsystem

yesyesNoNoYes Yes –– anchoring anchoringCytoskeletonCytoskeletondependent ?dependent ?

Models of how mRNA localize

Biology of the Cell (2002) Alberts et al. 4th edition

DiffusionDiffusion& Trapping& Trapping

LocalizedLocalizedDegradation/Degradation/ProtectionProtection

ActiveActiveTransportTransport

Page 9: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Requirements for the Active Transport of mRNA

1. Molecular Motor Proteins2. Polarized Cytoskeleton3. A way in which to bind to

mRNA molecules (directlyor indirectly)

++

++

++++

++

++

--

--

Shav-Tal Shav-Tal & Singer (2005) J. Cell Science 118:4077-81& Singer (2005) J. Cell Science 118:4077-81

HirokawaHirokawa & &TakemuraTakemura (2005) (2005)Nature Rev. NeuroscienceNature Rev. Neuroscience 6:201 6:201

Page 10: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

The cytoskeleton is highly dynamic

Page 11: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Thermodynamics governs cytoskeletal activities

Page 12: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Tubulin and actin structures

Page 13: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Subunit concentration is a critical determinant of activity

Page 14: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Dynamic instability due to structural differences at ends

Page 15: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Part II

Motor Protein Dependent Localization of mRNA in Yeast:

The only model system in which a molecular motor protein is known todirectly move mRNAs

++++

++

--

--

--Shav-Tal Shav-Tal & Singer (2005) J. Cell Science 118:4077-81& Singer (2005) J. Cell Science 118:4077-81

Page 16: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Life Cycle of Budding Yeast

MotherMothercellcell

BudBud

DaughterDaughtercellcell

ActinActincablescables

ActinActinpatchespatches

Saccharomyces cerevisiae Saccharomyces cerevisiae (Brewer(Brewer’’s yeast)s yeast)

++

++++

++++

++++

Page 17: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

ASH1ASH1 mRNA localizes Ash1 protein mRNA localizes Ash1 protein

2 m

mother celldiploid

cell

daughter cell

mother cell

Ash1p

Ash1 Protein Represses Mating-Type Switching in the Daughter CellAsh1 Protein Represses Mating-Type Switching in the Daughter Cell

Amon A. Cell 84:651 (1996)

Haploid cells

aa

/a/amating

ASH1 mRNA Ash1p-myc DAPI Nomarski

Long RM, et al. Science 277:383 (1997)

Daughter cellDaughter cell

Mother cellMother cell

budding

Ash1p : Asymmetric Synthesis of HO endonucleasetranscriptional repressor protein

Page 18: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

The ASH1The ASH1 mRNA Zipcodes mRNA Zipcodes

ASH1ASH155’’UTRUTR 33’’UTRUTR

E1E1 E2AE2A E2BE2B E3E3

Chartrand Chartrand P, et al. P, et al. Curr BiolCurr Biol 9:285 (1999)9:285 (1999)

ASH1ASH1 mRNA Zipcodes are essential for its localization mRNA Zipcodes are essential for its localization

Pascal Pascal ChartrandChartrand: in : in KlocKloc M, et al. M, et al. CellCell 108:535 (2002) 108:535 (2002)

Stem-loop structure is essential

Page 19: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

SHESHE mutants delocalize mutants delocalize ASH1ASH1 mRNA mRNAShe : Swi5p-dependent HO expression

She 1p is a type V myosin (Myo4p)She 1p is a type V myosin (Myo4p)

Long RM, et al. Long RM, et al. ScienceScience 277:383 (1997) 277:383 (1997)

Page 20: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

18 myosin18 myosinfamilyfamily

membersmembers

NOWNOW……....

There are There are 2424 ! !Foth Foth et al. (2006)et al. (2006) PNAS PNAS 103:3681-6103:3681-6

Myosin Family Tree

Tyska & Mooseker (2003) TICB 13:447

Class V myosins

Biology of the Cell (2002) Alberts et al. 4th ed

HEADHEADNECKNECK

TAILTAIL

• convert energy from ATP hydrolysis into mechanical energy• bind to and move along actin filaments

Myosin Motors

• Processive• Moves toward the barbed end of actin

Page 21: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Real Time Visualization of RNA MovementReal Time Visualization of RNA Movement

Needed to order the temporal and spatial events inNeeded to order the temporal and spatial events inRNA localizationRNA localization

Requirements:Requirements:in vivo fluorescent labeling of RNAsin vivo fluorescent labeling of RNAs

High numerical aperture, wide-field opticsHigh numerical aperture, wide-field optics

Rapid image acquisition to satisfy Nyquist sampling rateRapid image acquisition to satisfy Nyquist sampling rate

Highly sensitive image sensorHighly sensitive image sensor

Biology of the Cell (2002) Alberts et al. 4th edition

Does the myosin motor activelytransport ASH1 mRNA along actin

filaments ?OR

Could the motor protein capture andanchor ASH1 mRNA in the bud tip?

Page 22: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

A Dual-Reporter System for Labeling RNA inA Dual-Reporter System for Labeling RNA inLiving CellsLiving Cells

Bertrand E, et al. Mol Cell 2:437 (1998)

MS2

ASH13’UTR

6 MS2 Binding site repeatsmRNA

MS2-GFPCoat proteindimerizes

Page 23: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Real-Time Localization of Real-Time Localization of ASH1ASH1 mRNA mRNA

Bertrand E, et al. Mol Cell 2:437 (1998)

Net Distance: 4.4 umTotal Distance: 23 umAvg. Velocity: 200 – 400 nm/secMax. Velocity: ~600nm/sec

Movie available at http://www.singerlab.org/supplements/

2 mmin

wild type She1 (deleted)

Total time: 4 min

Locasome Tracking

Wild typeWild type Myo4p deletedMyo4p deleted

Page 24: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

ASH1ASH1 mRNA Particle Assembly mRNA Particle Assembly

Long RM, et al. Long RM, et al. ScienceScience 277:383 (1997) 277:383 (1997)

Trans acting factors that bind toTrans acting factors that bind tothe the ASH1ASH1 mRNA particle mRNA particle

Model of Model of ASH1ASH1Particle AssemblyParticle Assembly

Modified from Long et al., 2000, EMBO J.19:6592-601

Page 25: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

RNA movement is stochasticRNA movement is stochastic

The movement of RNAs is a probabilisticThe movement of RNAs is a probabilisticphenomenon and follows rules of diffusion.phenomenon and follows rules of diffusion.

Zipcodes increase the probability that the RNAs Zipcodes increase the probability that the RNAswill associate with motors.will associate with motors.

Motor-driven RNAs are more likely to localizeMotor-driven RNAs are more likely to localizeasymmetrically and do not localize by diffusion.asymmetrically and do not localize by diffusion. Localized RNAs ensure correct protein sorting by Localized RNAs ensure correct protein sorting bybeing translated at their final destination. being translated at their final destination.

Therefore, they must be translationally repressedTherefore, they must be translationally repressedduring transport.during transport. (To be discussed in part III) (To be discussed in part III)

Page 26: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Part III

Mechanisms for mRNA localization in fibroblastsand neurons

Shav-Tal Shav-Tal & Singer (2005) J. Cell Science 118:4077-81& Singer (2005) J. Cell Science 118:4077-81

Is motor driven mRNA transport seen in other biological systems?

Page 27: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

cis acting-actin-actin CDSCDS

33’’UTRUTR““ZipcodeZipcode””

TAA TAA ACCACCGGACTGGACTGTTACCAGTTACCAACACCCACACCCACACCCCTGTGATGAAACAAAACCCATAAATGCACACCCCTGTGATGAAACAAAACCCATAAATGC(stop) 1222(stop) 1222 1278 1278

The 3The 3’’UTR ofUTR of -actin -actin mRNAmRNA contains a contains a ““zipcodezipcode”” that is required for that is required forits localizationits localization

-actin mRNA localizes to the leading edge of-actin mRNA localizes to the leading edge ofmigrating fibroblastsmigrating fibroblasts

-actin mRNA localization requires:-actin mRNA localization requires:

an intact actin cytoskeleton an intact actin cytoskeleton (Sundell(Sundell

and Singer, 1990; Hill and Gunning, 1993)and Singer, 1990; Hill and Gunning, 1993)

the 3the 3’’UTR of UTR of -actin = -actin = ““zipcodezipcode””

-actin mRNA-actin protein

DAPI

Page 28: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Detection of Single RNA Molecules in Living CellsDetection of Single RNA Molecules in Living Cells

Data from Fusco D, et al. Curr Biol 13:161 (2003)

Page 29: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Quantification of mRNAs per ParticleQuantification of mRNAs per Particle

Fusco D, et al. Curr Biol 13:161 (2003)

Page 30: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Dynamics of RNA MovementDynamics of RNA Movement

Fusco D, et al. Curr Biol 13:161 (2003)

Page 31: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Dynamics of RNA Movement:Dynamics of RNA Movement:4 types of particle motility4 types of particle motility

Fusco D, et al. Curr Biol 13:161 (2003)

10 μm

2 μm

Page 32: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Directed Movement of RNADirected Movement of RNA

Fusco D, et al. Curr Biol 13:161 (2003)

Page 33: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Diffusive Movement of RNADiffusive Movement of RNA

Fusco D, et al. Curr Biol 13:161 (2003)

Page 34: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Corralled Movement of RNACorralled Movement of RNA

Fusco D, et al. Curr Biol 13:161 (2003)

Page 35: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

mRNA particles containing the mRNA particles containing the b-actin b-actin zipcode show morezipcode show more““directeddirected”” motility events motility events

Fusco D, et al. Curr

Biol 13:161 (2003)

Mean Squared Distance (MSD) Particle Analysis of mRNAsMean Squared Distance (MSD) Particle Analysis of mRNAs

Page 36: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Model for ß-actin mRNA Transport andModel for ß-actin mRNA Transport and

Localization in FibroblastsLocalization in Fibroblasts

Shav-Tal & Singer (2005) J. Cell Sci. 118:4077

Page 37: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p
Page 38: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

cis acting

trans actingtrans actingZBP1ZBP1

-actin-actin CDSCDS

33’’UTRUTR““ZipcodeZipcode””

TAA TAA ACCACCGGACTGGACTGTTACCAGTTACCAACACCCACACCCACACCCCTGTGATGAAACAAAACCCATAAATGCACACCCCTGTGATGAAACAAAACCCATAAATGC(stop) 1222(stop) 1222 1278 1278

ZBP1 binds toZBP1 binds to the 3 the 3’’UTR of UTR of -actin-actin mRNA mRNA

• Zipcode binding protein (Zipcode binding protein (ZBP1ZBP1) is an essential trans-acting) is an essential trans-actinglocalization factor that binds to the localization factor that binds to the ““zipcodezipcode””

•• inhibiting the interaction of ZBP1 with the zipcode using anti- inhibiting the interaction of ZBP1 with the zipcode using anti-sense sense oligosoligos results in: results in:1.1. delocalization of delocalization of -actin mRNA (diffuse cytoplasmic-actin mRNA (diffuse cytoplasmic

and and perinuclearperinuclear pools remain) pools remain)2.2. loss of cell polarity loss of cell polarity3.3. loss of directed cell motility loss of directed cell motility

Page 39: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Homology Domains Predicted by Sequence Analysis ofHomology Domains Predicted by Sequence Analysis ofZIPCODE BINDING PROTEIN-1 (ZBP1)ZIPCODE BINDING PROTEIN-1 (ZBP1)

RRM 1 RRM2 KH1 KH3 KH4KH2

Flexible Region(loop)

Flexible Region(loop)

NES NLS

• 3 nM affinity• KH3&KH4 responsible for RNA binding• SELEX regenerates the zipcode• Protein footprints on the zipcode• co-localizes with b-actin mRNA in nucleus and cytoplasm• requires RNA binding for localization and granule formation• will redirect b-actin mRNA when fused to membrane targeting sequence

Ross AF, et al. Mol. Cell. Biol. 17:2158 (1997) & Farina KL, et al. J. Cell Biol. 160:77 (2003), Oleynikov&Singer, Curr. Biol.13: 199 (2003)

A founding member of a large family of developmentally expressed proteinsA founding member of a large family of developmentally expressed proteinsimportant in RNA localization and regulation.important in RNA localization and regulation.

Page 40: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Delocalizing Delocalizing -actin -actin mRNA using anti-sense mRNA using anti-sense oligosoligosdestroys cell polarity and directed cell movementdestroys cell polarity and directed cell movement

Shestakova E, et al. PNAS 98:7045 (2001)

10 m

sense anti-sense

RhodamineactinFITC

phalloidin

centroidperimeterperimeter

Page 41: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Yeast and mammalian fibroblasts share an Yeast and mammalian fibroblasts share an actoacto--myosin based localization of mRNAsmyosin based localization of mRNAs

Modified from Long et al., 2000,EMBO J. 19:6592-601

Modified from Long et al., 2000,EMBO J. 19:6592-601

ShavShav-Tal & Singer (2005) J. Cell Science 118:4077-81-Tal & Singer (2005) J. Cell Science 118:4077-81 ShavShav-Tal & Singer (2005) J. Cell Science 118:4077-81-Tal & Singer (2005) J. Cell Science 118:4077-81

Myosin IIB??

Page 42: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Comparison of mRNA MovementsComparison of mRNA Movements

Page 43: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

-actin -actin mRNA localization in neurites is dependent on amRNA localization in neurites is dependent on afunctional zipcode and on growth factor stimulationfunctional zipcode and on growth factor stimulation

Starved+ AntisenseStarved+ Antisense

NT-3 + AntisenseNT-3 + Antisense

Starved+ Reverse ASStarved+ Reverse AS

NT-3 + Reverse ASNT-3 + Reverse AS

Bassell et al. (1998) J. Neurosci. 18:251-65Zhang et al. (2001) Neuron 31:261-75

Anti-sense oligonucleotides directed againstthe zipcode delocalizes b-actin mRNA andimpairs association with zipcode bindingproteins (e.g. ZBP1)

Anti-senseReverse AS

Page 44: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

The localization of The localization of -actin mRNA in -actin mRNA in neuritesneurites is is zipcodezipcodedependentdependent

Starved+ AntisenseStarved+ Antisense

NT-3 + AntisenseNT-3 + Antisense

Starved+ Reverse ASStarved+ Reverse AS

NT-3 + Reverse ASNT-3 + Reverse AS

Bassell et al. (1998) J. Neurosci. 18:251-65Zhang et al. (2001) Neuron 31:261-75

Page 45: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

-actin mRNA and ZBP1 co-localize in neurites as-actin mRNA and ZBP1 co-localize in neurites asparticles and appear to align along microtubulesparticles and appear to align along microtubules

Zhang et al. (2001) Neuron 31:261-75

-actin & endogenous ZBP1

-actin-actin && EGFP-ZBP1EGFP-ZBP1

Page 46: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Kinesin: an ATPase that is a microtubule-based motorKinesin: an ATPase that is a microtubule-based motor

kinesin: a plus-end directed motor involved in fastaxonal transport of vesicles

T. Hays et al. (2001)

Previous reports show that kinesin is required for neurite outgrowth formation

Page 47: RNA localization and translation - Biologybiology.hunter.cuny.edu/cellbio/Feinstein Cell Bio 2013... · 2010-05-18 · 2 m mother cell diploid cell daughter cell mother cell Ash1p

Kinesin-I binds through its light chains to theKinesin-I binds through its light chains to the

vesicular cargo receptor vesicular cargo receptor SydSyd