RESEARCH ARTICLES◥
HEART DISEASE
Rare variant in scavenger receptor BIraises HDL cholesterol and increasesrisk of coronary heart diseasePaolo Zanoni,1* Sumeet A. Khetarpal,1* Daniel B. Larach,1*William F. Hancock-Cerutti,1,2 John S. Millar,1 Marina Cuchel,1
Stephanie DerOhannessian,1 Anatol Kontush,2 Praveen Surendran,3
Danish Saleheen,3,4,5 Stella Trompet,6,7 J. Wouter Jukema,7,8 Anton De Craen,6
Panos Deloukas,9 Naveed Sattar,10 Ian Ford,11 Chris Packard,12
Abdullah al Shafi Majumder,13 Dewan S. Alam,14 Emanuele Di Angelantonio,3
Goncalo Abecasis,15 Rajiv Chowdhury,3 Jeanette Erdmann,16 Børge G. Nordestgaard,17
Sune F. Nielsen,17 Anne Tybjærg-Hansen,18 Ruth Frikke Schmidt,19 Kari Kuulasmaa,20
Dajiang J. Liu,21 Markus Perola,20,22 Stefan Blankenberg,23,24 Veikko Salomaa,20
Satu Männistö,20 Philippe Amouyel,25 Dominique Arveiler,26 Jean Ferrieres,27
Martina Müller-Nurasyid,28,29 Marco Ferrario,30 Frank Kee,31 Cristen J. Willer,32
Nilesh Samani,33,34 Heribert Schunkert,35 Adam S. Butterworth,3
Joanna M. M. Howson,3 Gina M. Peloso,36 Nathan O. Stitziel,37 John Danesh,3,9
Sekar Kathiresan,36 Daniel J. Rader,1† CHD Exome+ Consortium,‡CARDIoGRAM Exome Consortium, Global Lipids Genetics Consortium
Scavenger receptor BI (SR-BI) is the major receptor for high-density lipoprotein (HDL)cholesterol (HDL-C). In humans, high amounts of HDL-C in plasma are associated with alower risk of coronary heart disease (CHD). Mice that have depleted Scarb1 (SR-BIknockout mice) have markedly elevated HDL-C levels but, paradoxically, increasedatherosclerosis. The impact of SR-BI on HDL metabolism and CHD risk in humans remainsunclear. Through targeted sequencing of coding regions of lipid-modifying genes in 328individuals with extremely high plasma HDL-C levels, we identified a homozygote for a loss-of-function variant, in which leucine replaces proline 376 (P376L), in SCARB1, the geneencoding SR-BI. The P376L variant impairs posttranslational processing of SR-BI andabrogates selective HDL cholesterol uptake in transfected cells, in hepatocyte-like cellsderived from induced pluripotent stem cells from the homozygous subject, and in mice.Large population-based studies revealed that subjects who are heterozygous carriers ofthe P376L variant have significantly increased levels of plasma HDL-C. P376L carriers havea profound HDL-related phenotype and an increased risk of CHD (odds ratio = 1.79, which isstatistically significant).
The strong inverse association betweenamounts of high-density lipoprotein (HDL)cholesterol (HDL-C) and coronary heartdisease (CHD) risk has generated interestin a potential causal relationship between
HDL metabolism and CHD. However, clinicaltrials with drugs that raise HDL-C levels, niacinand cholesteryl ester transfer protein (CETP)inhibitors, have produced disappointing results(1). Furthermore, recent studies of human geneticvariants that are associated with HDL-C levelshave generally failed to show association withCHD (2, 3).Most notably, a loss-of-function variantin LIPG, a gene encoding an endothelial lipasethat, in the heterozygous state, raises HDL-Cby ~5 mg/dl, was found to have no associationwith CHD (4). Although these previous studiessuggest that higher HDL-C levels may not becausally protective against CHD, we reasonedthat additional human genetic analyses might
provide mechanistic insight into the complexrelationship between HDL and CHD.The scavenger receptor class BI (SR-BI), encoded
by the gene SCARB1, was discovered to be anHDL receptor two decades ago (5). SR-BI pro-motes the selective uptake of HDL cholesterylesters (HDL-CEs) into cells, particularly hepato-cytes and steroidogenic cells (5, 6). In mice, over-expression of SR-BI in the liver reduces levels ofHDL-C (7–10), and genetic deletion of SR-BI re-sults in higher HDL-C levels (11–13). Remarkably,these geneticmanipulations inmice have effectson atherosclerosis opposite to those predicted byhuman epidemiological data: Overexpression re-duces atherosclerosis despite the lower HDL-Clevels (14–16), and gene deletion increases athero-sclerosis despite the higher HDL-C levels (17–20).One potential explanation relates to the flux ofcholesterol from macrophages through the re-verse cholesterol transport (RCT) pathway; SR-BI
overexpression increases macrophage RCT, andSR-BI knockout reduces macrophage RCT (21).The human relevance of these observations hasbeen unclear.
Identification of SCARB1 P376Lhomozygote and association withextremely high HDL-C
We hypothesized that humans with extremelyhigh levels of HDL-Cmay harbor loss-of-functionvariants in SCARB1 and undertook a targeted re-sequencing discovery experiment in 328 partic-ipants with very high HDL-C (>95th percentile,meanHDL-C of 106.8mg/dl) and a control groupof 398 subjects with lowHDL-C (<25th percentile,mean HDL-C of 30.4 mg/dl). In this cohort, wesequenced the exons of ~990 genes locatedwithin300 kb of each of the 95 loci with significant as-sociations (P < 5 × 10−8) with plasma lipid levelsidentified by the Global Lipids Genetics Consor-tium as of 2010 (22). Among the high HDL-Csubjects, we identified a homozygote for SCARB1P376L (g.125284671 G>A, c.1127 C>T, p.P376L,rs74830677), a 67-year-old female with anHDL-Cof 152 mg/dl, and confirmed this finding bySanger sequencing. This subject harbored no mu-tations in other high HDL-C genes such as CETPand LIPG. In addition to this homozygote, fourP376L heterozygotes were identified by targetedsequencing in the high HDL-C group; no hetero-zygotes were found in the low HDL-C group (P =0.008, Fisher’s exact test).To identify additional P376L carriers, we geno-
typed an expanded cohort of very high versus lowHDL-C subjects. Among 524 additional subjectswith very highHDL-C (meanHDL-C 95.0mg/dl),we identified 11 heterozygotes for P376L; whereasamong 758 subjects with lowHDL-C (meanHDL-C 33.5 mg/dl), we identified 3 heterozygotes. Intotal, our combined sequencing and genotypingfor discovery of the P376L variant showed thatthis variant is significantly overrepresented in sub-jects with high HDL-C [minor allele frequency(MAF) = 0.010 in high HDL-C versus 0.0013 inlow HDL-C controls, P = 0.000127, Fisher’s exacttest, Table 1].Because this variant is present on the exome
array,we expandedour analysis to theGlobal LipidGenetics Consortium exome array data in >300,000individuals. The P376L variant was very rare inthis population (MAF of ~0.0003). It was signifi-cantly associated with higher HDL-C levels with arelatively large effect size (beta = 8.4 mg/dl; P =1.4× 10−15).Notably, this variantwasnot associatedwith plasma levels of low-density lipoprotein cho-lesterol (LDL-C) or triglycerides (TGs) (table S1).Thus, we conclude that SCARB1 P376L is asso-ciated specifically with elevated HDL-C levels.
HDL-related phenotypes ofSCARB1 P376L homozygoteand heterozygotes
We next recruited the P376L homozygote, eightheterozygous carriers, and both high HDL-C andnormal HDL-C noncarrier controls for deepphenotyping of HDL metabolism and relatedtraits. All of the P376L study participants were of
RESEARCH
1166 11 MARCH 2016 • VOL 351 ISSUE 6278 sciencemag.org SCIENCE
on M
arch
29,
201
6D
ownl
oade
d fr
om o
n M
arch
29,
201
6D
ownl
oade
d fr
om o
n M
arch
29,
201
6D
ownl
oade
d fr
om o
n M
arch
29,
201
6D
ownl
oade
d fr
om o
n M
arch
29,
201
6D
ownl
oade
d fr
om o
n M
arch
29,
201
6D
ownl
oade
d fr
om
European ancestry, almost exclusively of Ashke-nazi Jewish descent. Clinical characteristics andlipid profiles of the subjects are reported in Table2. Fast protein liquid chromatography (FPLC)analysis of plasma lipoproteins confirmed theincrease in large HDL particles in the homo-zygote (Fig. 1A). Cholesterol and apolipoproteinA-I (apoA-I) levels in HDL were significantlyincreased in the homozygote and heterozygotes
compared with controls, but HDL apoA-II levelswere not elevated (Table 2 and Fig. 1B). Therewere no differences between P376L carriers andcontrols in the absolute amount of HDL free cho-lesterol or the ratio of free-to-esterified cholesterolin their HDL (Fig. 1C). P376L heterozygotes had a2.8-fold increase and the homozygote a 6.1-foldincrease in large HDL-2b particles compared withnoncarrier controls (Fig. 1D). There was moreapoA-I (Fig. 1E and fig. S2) and apoC-III (Fig.1F) in largeHDL particles in the homozygote andheterozygous carriers. Cholesterol efflux capacitywas similar in carriers and controls (Fig. 1G). Incontrast to the infertility phenotype of Scarb1-deficient female mice (18), the P376L homozygotehad two healthy children and reported no fertilityimpairment.We also did not observe the steroido-genic or platelet phenotypes reported in Scarb1-deficient mice (see supplementary materials).
SCARB1 P376L results in completeloss of function of SR-BI
Given the profoundHDLphenotype of the P376Lcarriers, we sought to understand the impact ofthe variant on SR-BI function. We generatedinduced pluripotent stem cells (iPSCs) using pe-ripheral bloodmononuclear cells from the P376Lhomozygote and a noncarrier control. We nextdifferentiated these cells into hepatocyte-likecells (HLCs) to study HDL metabolism in thesetting of endogenous cellular SCARB1 expression.HLCs differentiated through this protocol reca-pitulate phenotypes of cultured primary hepato-cytes such as albumin and VLDL (very low densitylipoprotein) secretion (23–26). The cell lines fromthe control donor and the P376L homozygous sub-ject demonstrated expression of hepatocyte-specificgenes ALB (albumin) and AFP (alpha-fetoprotein)and exhibited comparableSCARB1gene expression(fig. S3). Compared with control iPSC hepatocytelines, those from the P376L homozygote demon-strated a profound reduction in selective choles-terol uptake from HDL in vitro (Fig. 2A). Similarresults were observed in experiments with COS7cells transfected with plasmids expressing wild-type (WT) or the P376L variant of SCARB1 (fig. S3,
A and B), along with defective binding to HDL invitro at 4°C (fig. S4, C and D).To evaluate the physiological impact of the
P376L variant onHDL-C levels and catabolism invivo, we used adeno-associated virus (AAV) vec-tors to direct hepatic overexpression ofWTSR-BIor the P376L variant inmice with depleted Scarb1[Scarb1 knockout (KO) mice]. The two groups ofmice demonstrated similar hepatic expressionlevels of Scarb1mRNA (fig. S5A) andSR-BI protein(fig. S5B). Mice expressing WT Scarb1 demon-strated a robust 73% decrease in HDL-C. In con-trast, mice expressing the P376L variant had noreduction in HDL-C; their HDL-C levels werecomparable to those in the control AAV-null in-jected mice (Fig. 2B). Although the clearance of125I-labeled HDL protein was not different amongthe three groups, the clearance of [3H]HDL-CEwas much slower in mice expressing the P376Lvariant compared with those expressing WT SR-BI andwas comparable to that in the controlmice(Fig. 2, C andD). SelectiveHDL-CE clearance fromplasma was increased by WT SR-BI but was un-detectable in the P376L-expressing mice (Fig. 2Eand fig. S5C), as was hepatic uptake of [3H]CE at24 hours (fig. S5D). This indicates that the P376Lsequence variant results in complete loss of thecanonical function of SR-BI—namely, selectiveuptake of HDL-CE.We hypothesized that the markedly reduced
HDL-CE uptake could be because of aberrant pro-cessing of the P376L SR-BI protein, which leadsto impaired cell surface localization. To test this,we isolated cell surface proteins from COS7 cellstransfected with WT and P376L SR-BI using bio-tinylation and found markedly reduced cell sur-face SR-BI in the P376L transfected cell lysatesafter streptavidin cell surface protein pull-downassays (fig. S4E). Given that SR-BI undergoes N-glycosylation in the endoplasmic reticulumconcom-itant with proper folding, we hypothesized thataltered posttranslational modification may under-lie its reduced cell surface localization (27–29).Wemeasured the molecular weights of SR-BI formsafter endoglycosidase-H (Endo-H) treatment oftransfected COS7 (fig. S4E) and iPSC-derivedHLC
SCIENCE sciencemag.org 11 MARCH 2016 • VOL 351 ISSUE 6278 1167
1Departments of Genetics and Medicine, Division of TranslationalMedicine and Human Genetics, Perelman School of Medicine,University of Pennsylvania, Philadelphia, PA 19104, USA.2INSERM UMR 1166 ICAN, Université Pierre et Marie Curie Paris6, Hôpital de la Pitié, Paris, France. 3CardiovascularEpidemiology Unit, Department of Public Health and PrimaryCare, University of Cambridge, Cambridge, UK. 4Department ofBiostatistics and Epidemiology, Perelman School of Medicine,University of Pennsylvania, Philadelphia, PA 19104, USA. 5Centrefor Non-Communicable Diseases, Karachi, Pakistan.6Department of Gerontology and Geriatrics, Leiden UniversityMedical Center, Leiden, Netherlands. 7Department of Cardiology,Leiden University Medical Center, Leiden, Netherlands. 8TheInteruniversity Cardiology Institute of the Netherlands, Utrecht,Netherlands. 9Wellcome Trust Sanger Institute, GenomeCampus, Hinxton, UK. 10Institute of Cardiovascular and MedicalSciences, British Heart Foundation, Glasgow CardiovascularResearch Centre, University of Glasgow, Glasgow, UK.11Robertson Center for Biostatistics, University of Glasgow,Glasgow, UK. 12Glasgow Clinical Research Facility, WesternInfirmary, Glasgow, UK. 13National Institute of CardiovascularDiseases, Sher-e-Bangla Nagar, Dhaka, Bangladesh.14International Centre for Diarrhoeal Disease Research,Mohakhali, Dhaka, Bangladesh. 15Center for Statistical Genetics,Department of Biostatistics, University of Michigan School ofPublic Health, Ann Arbor, MI 48109, USA. 16Institute forIntegrative and Experimental Genomics, University of Lübeck,Lübeck 23562, Germany. 17Department of Clinical Biochemistry,Herlev Hospital, Copenhagen University Hospital, Herlev,Denmark. 18Copenhagen University Hospital, University ofCopenhagen, Copenhagen, Denmark. 19Department of ClinicalBiochemistry, Rigshospitalet, Copenhagen University Hospitals,Copenhagen, Denmark. 20Department of Health, NationalInstitute for Health and Welfare, Helsinki, Finland. 21Departmentof Public Health Sciences, College of Medicine, PennsylvaniaState University, Hershey, PA 17033, USA. 22Institute ofMolecular Medicine FIMM, University of Helsinki, Helsinki,Finland. 23Department of General and Interventional Cardiology,University Heart Center Hamburg, Hamburg, Germany.24University Medical Center Hamburg-Eppendorf, Hamburg,Germany. 25Department of Epidemiology and Public Health,Institut Pasteur de Lille, Lille, France. 26Department ofEpidemiology and Public Health, University of Strasbourg,Strasbourg, France. 27Department of Epidemiology, ToulouseUniversity-CHU Toulouse, Toulouse, France. 28Institute ofGenetic Epidemiology, Helmholtz Zentrum München–GermanResearch Center for Environmental Health, Neuherberg,Germany. 29Department of Medicine I, Ludwig-Maximilians-University Munich, Munich, Germany. 30Research Centre inEpidemiology and Preventive Medicine, Department of Clinicaland Experimental Medicine, University of Insubria, Varese, Italy.31UKCRC Centre of Excellence for Public Health, QueensUniversity, Belfast, Northern Ireland. 32Department ofComputational Medicine and Bioinformatics, Department ofHuman Genetics, and Department of Internal Medicine,University of Michigan, Ann Arbor, MI 48109, USA. 33Departmentof Cardiovascular Sciences, University of Leicester, Leicester,UK. 34National Institute for Health Research (NIHR) LeicesterCardiovascular Biomedical Research Unit, Glenfield Hotel,Leicester, UK. 35Deutsches Herzzentrum München, TechnischeUniversität München, Munich, Germany. 36Broad Institute andCenter for Human Genetic Research, Massachusetts GeneralHospital, Boston, MA 02114, USA. 37Department of Medicine,Division of Cardiology, Department of Genetics, and theMcDonnell Genome Institute, Washington University School ofMedicine, St. Louis, MO 63110, USA.*These authors contributed equally to this work. †Correspondingauthor. E-mail: [email protected] ‡For each consortiumand study, authors and affiliations are listed in the supplementarymaterials.
Table 1. Association of SCARB1 P376L with HDL-C in high versus low HDL-C cohorts. Carriersof the P376L variant were ascertained from the Penn High HDL Study through two approaches,
targeted sequencing of the SCARB1 gene in a total of 726 subjects (328 high HDL-C and 398 low
HDL-C subjects) and genotyping on the exome array (Illumina) in an additional 1282 subjects (524 high
HDL-C subjects and 758 low HDL-C subjects). The association of the P376L variant with the high HDL-Ccohort from both approaches individually and combined together was tested using Fisher’s exact test.
N, number of participants; NonC, noncarriers; Het, heterozygotes; Hom, homozygotes.
Discovery cohort
High HDL-C
(>95th percentile) (N)
Low HDL-C
(<25th percentile) (N) Association
(P)Total NonC Het Hom Total NonC Het Hom
Targeted sequencing
of SCARB1328 323 4 1 398 398 0 0 0.008398
. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .
Exome array genotyping 524 513 11 0 758 755 3 0 0.005296. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .
Combined 852 836 15 1 1156 1153 3 0 0.000127. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .
RESEARCH | RESEARCH ARTICLES
lysates, as well as mouse liver lysates expressingWT or mutant SR-BI (Fig. 2, F and G). Higher-molecular-weight forms representN-glycosylationmodified Endo-H–resistant and partially sensitiveforms at the cell surface after modification byalpha-mannosidase II in the Golgi apparatus (28).
In the iPSC-derived differentiated HCLs from theP376L homozygote (Fig. 2F), we found much lesstotal cellular SR-BI in themutant cell lines relativeto that of WT cells, despite comparable SCARB1gene expression (fig. S3C). After Endo-H treatment,the SR-BI from SCARB1 WT cell and liver lysates
across models was predominantly the partiallysensitive form, along with small amounts of thefully resistant form. In contrast, the SR-BI from celland tissue lysates across P376L-expressing groupswas all the immature, fully Endo-H–sensitive form(Fig. 2, F and G, and fig. S4F). Together, these data
1168 11 MARCH 2016 • VOL 351 ISSUE 6278 sciencemag.org SCIENCE
Table 2. Characteristics of SCARB1 P376L carriers and controls re-cruited for deep phenotyping. Demographic, plasma lipid, and apolipo-
protein traits measured from one P376L homozygote, eight heterozygotes,and noncarrier controls from subjects identified from sequencing or geno-
typing of the Penn High HDL Study cohort for deep phenotyping. Lipid
measurements from plasma were performed using an autoanalyzer. Whereapplicable, data are presented as means ± SD. Numbers correspond to
groups for comparison.Group 1, normal HDL-C controls; group 2, high HDL-Ccontrols; group 3, SCARB1 P376L heterozygotes.Tested: ANOVA or chi-square.
Groups: Comparison between groups by number with Tukey’s multiple com-
parison. *Significant at P < 0.05. **Significant at P < 0.05 by chi-square but not
ANOVA. Dash indicates no significant comparison. BMI, body mass index; PTA,phosphotungstate precipitation method; VLDL, very low density lipoprotein;
Lp(a), lipoprotein a.
MeasureGroup
P376L Hom
Significance
1 2 3 Tested Groups
Number of subjects 11 10 8 1 -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
Age (years) 61.6 (9.7) 64.2 (12.5) 67.5 (15.3) 65 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
Sex (M/F) 6/5 5/5 6/2 0/1 n.s.** -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
BMI (kg/m2) 26.4 (2) 22.9 (1.3) 25.6 (3.9) 21 * 1/2.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
TC (mg/dl) 185.8 (22.3) 215.8 (29.9) 228 (33.2) 280 * 1/3.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
Glucose (mg/dl) 93.5 (2.9) 91.6 (7.0) 98.8 (5.3) 86 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
LDL-C (mg/dl) 109.1 (17.3) 97.4 (21.6) 116.6 (27.1) 109 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
HDL-C (PTA) (mg/dl) 51 (11.4) 110.1 (19.8) 86.9 (19.9) 152 * 1/2, 1/3, 2/3.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
TG (mg/dl) 121.2 (35) 71.5 (32.3) 99.5 (23.7) 57 * 1/2.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
Alcohol >1/day (n) 4 4 2 0 n.s.** -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
VLDL-C (mg/dl) 26.9 (8.8) 19 (6.2) 23.1 (9.2) 13 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
Lp(a) (mg/dl) 22.3 (18.8) 19 (22.7) 15.9 (21.2) 17 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
apoA-I (mg/dl) 172.2 (33.3) 241.7 (41.2) 229.6 (36.1) 327 * 1/2, 1/3.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
apoA-II (mg/dl) 40.5 (7) 49.5 (11.5) 46.6 (5.5) 45 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
apoB (mg/dl) 99.7 (13.4) 82.8 (17.1) 95.9 (18.2) 92 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
apoC-II (mg/dl) 4.32 (1.55) 6.09 (2.69) 4.49 (2.17) 5.3 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
apoC-III (mg/dl) 11.4 (4.3) 15.5 (6.9) 13.7 (2.7) 16.1 n.s. -.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
apoE (mg/dl) 4.52 (0.89) 6.03 (1.86) 4.94 (1.12) 6.4 * 1/2.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .
Fig. 1. HDL composition and functionality in a SCARB1 P376L homozygote, heterozygous carriers, and controls. (A) FPLC fractionation of plasmalipoproteins from the P376L homozygote subject (red) and from a control with normal HDL-C. (B) Cholesterol, apoA-I, and apoA-II content in total HDL. (C) Freecholesterol (FC) and esterified cholesterol (CE) in total HDL (left) and the FC/CE ratio in total HDL (right). (D) HDL subclass concentrations after separation bydensity-gradient ultracentrifugation. (E) ApoA-I content in the same HDL subclasses. (F) ApoC-III content in the same HDL subclasses. (G) Cholesterol effluxcapacity from macrophages of the THP-1 cell line. All data are reported as means ± SD.
RESEARCH | RESEARCH ARTICLES
are consistent with amodel in which the P376Lsequence variant alters the endogenous post-translational N-glycosylation of SR-BI to preventeither transit from the ER to the Golgi or fur-ther posttranslational modifications in the Golgi,which ultimately result in reduced cell surfaceexpression.
SCARB1 P376L is associatedwith increased risk of CHDin humans
Despite a profound increase in HDL-C, SR-BI de-ficiency inmice causes accelerated atherosclerosis(17–20). The relationship of reduced SR-BI func-tion to atherosclerotic cardiovascular disease inhumans has not been established. The P376Lhomozygous subject did not have clinical CHD,but her carotid intimal-medial thickness (cIMT)was 0.789mm (left-right average), which is in the
>75th percentile for females of her age; in addi-tion, she had detectable plaque throughout theleft internal carotid artery and at the bifurcationof her right internal carotid artery. cIMTmeasure-mentswere not significantly different in the P376Lheterozygotes compared with both groups of con-trols (fig. S8), but because of small sample size, thestatistical power is limited.To achieve greater statistical power to address
this question, we performed a meta-analysis oflarge exome array genotyping studies of CHDcases and healthy controls to determine the re-lationship of the P376L variant with risk of CHD(Table 3). Among 16 sample sets from two con-sortia [the CARDIoGRAM Exome Consortiumand the CHD Exome+ Consortium], we testedthe association between P376L carrier status andCHD in 137,995 individuals. Across 49,846 CHDcases and 88,149 CHD controls, we found that
P376L carriers had a significantly higher risk ofCHD compared with noncarriers [odds ratio fordisease among carriers = 1.79; P= 0.018] (Table 3).Thus, carriers of this SCARB1 P376L variant havesignificantly increased HDL-C levels and a sig-nificantly increased risk of CHD.
Discussion
Studies ofmice haveprovided important insightsinto the effects of SR-BI on HDL metabolism,RCT, and atherosclerosis. These studies revealedthat overexpression of SR-BI reduces HDL-C(7–10) and reduces atherosclerosis (14–16), where-as gene deletion of SR-BI increases HDL-C (11–13)and accelerates atherosclerosis (17–20). The clin-ical relevance of these findings has remaineduncertain, however. Studies of injected labeledHDL-CE in humans suggested that the majorityof the HDL-CE was transported to the liver via
SCIENCE sciencemag.org 11 MARCH 2016 • VOL 351 ISSUE 6278 1169
Fig. 2. SCARB1 P376L is a null variant in vitro and in vivo. (A) [3H]Cholesterol ether (CEt) uptake (left) and selective cholesterol uptake fromHDL(right) in iPSC-derived HLCs from the P376L homozygote versus a noncarriercontrol. Cells were incubated with [3H]CEt and 125I-labeled tyramine cellobiose(TC) dual-labeled human HDL. All values are normalized to relative ALB geneexpression in each cell line. All data represent mean values for wells ofrespective cell lines ± SD. (B) PlasmaHDLcholesterol levels before and 12 daysafter AAVadministration to Scarb1 KOmice. (C) [3H]Cholesterol ether (CEt)clearance (left) and fractional catabolic rate (right) from plasma of Scarb1KO mice injected with null or SR-BI AAVs after administration of [3H]CE/125I-labeled TC dual-labeled human HDL. (D) 125I-labeled TC clearance (left) andfractional catabolic rate (right) from plasma after administration of dual-labeled HDL. (E) Selective cholesterol uptake in mice expressing null, SR-BI
WT, or P376L measured by relative differences in 3H- and 125I-labeled frac-tional catabolic rates. (F) Sensitivity to Endo-H in P376L homozygous versusnoncarrier iPSC-derived HLCs. Cell lysates of each genotype were treatedwith Endo-H to remove complex N-linked glycans from mature forms ofproteins and then immunoblotted for SR-BI. Molecular weights of differentforms of SR-BI after Endo-H treatment are given on the left. (G) SR-BI Endo-Hsensitivity from liver lysates from mice expressing null, SR-BI WT, or SR-BIP376L AAV. Lysates were treated with Endo-H, followed by immunoblotting forSR-BI. Molecular weights of different forms of SR-BI after Endo-H treatmentare given on the left. (A)Mean values for wells of respective cell lines ± SD; [(B)to (E)] means ± SD for each of the three groups. *P < 0.05; ** P < 0.01; ***P <0.001 by analysis of variance (ANOVA) [(B) and (C)]; plasma clearance,unpaired t test (E).
RESEARCH | RESEARCH ARTICLES
CETP-mediated exchange to apoB-containing lipo-proteins rather than by direct uptake from HDLby the liver (30), which brings into question theimportance of hepatic SR-BI in human physiology.Common genetic variants near the SCARB1 locuswere found to be significantly associated withplasma HDL-C levels, which suggests that SR-BImay play a role in HDL metabolism in humans(22, 31). A family with a rare SCARB1 variant inwhich serine replaces proline 297 (P297S) was re-ported in which the heterozygous carriers of thevariant had modestly elevated HDL-C levels (31).However, the variant retains substantial SR-BIactivity, no homozygotes were identified, the ap-parent effect on HDL-C was modest, and therewas insufficient power to address its effects onatherosclerosis.Through sequencing of subjects with extremely
high plasma levels ofHDL-C, we identified a homo-zygote for a P376L variant in SR-BI. Our comple-mentary approaches consistently demonstratedthat this variant confers virtually complete loss offunction of SR-BI. Our results demonstratemanysimilarities in the consequences of SR-BI deficiencyonHDL composition betweenmice and humans,including a shift toward large, buoyant HDL par-ticles and a significant increase in apoA-I, butnot apoA-II, in plasma and HDL (12, 32, 33). Thehomozygote is a woman who had two healthy
children without fertility issues or delivery com-plications, which suggests that, in humans, SR-BIdeficiency may not impair reproductive functionin the same manner as it does in mice (18, 34). Inmice, SR-BI–mediated CE uptake from HDL is acritical process underlying steroid hormone syn-thesis in adrenal and gonadal tissues, and SR-BIdeficiency alters adrenal cholesterol content, im-pairs adrenal glucocorticoid response under stress,and can lead to fasting-induced hypoglycemia(6, 35, 36). We did not observe any differencesin fasting glucose, serum cortisol, adrenocortico-tropic hormone, or female gonadal hormones inP376L heterozygous subjects versus controls, andwe saw only a modest increase in testosterone inmale P376L heterozygotes relative to noncarriers.We postulate that differences in expression orcapacity for up-regulation of apoB-containinglipoprotein receptors relative to SR-BI betweenmouse models and humans in steroidogenic tis-sues may account, at least partially, for the lackof recapitulation of some of the phenotypes ofSR-BI deficiency in mice. We also observed nodifferences in platelet levels, cholesterol content,and activation from the P376L carriers, despitereports of thrombocytopenia and altered plateletactivity in Scarb1 KOmice (31). These results sug-gest a relatively different contribution of SR-BI toplatelet function betweenmice and humans. Note
that the phenotypes of human SCARB1 P376Lhomozygote (elevated HDL-C and large HDL par-ticles but relatively normal steroidogenesis, re-productive viability, and platelet function) arecomparable to those observed inmice lacking PDZdomain containing 1 (PDZK1), an adaptor pro-tein for SR-BI (37).Perhaps the most important finding of our
study is that, despite the elevation in HDL-C,P376L carriers exhibit increased risk of CHD, asdo Scarb1 KO mice. Our results are consistentwith a growing theme inHDLbiology that steady-state concentrations of HDL-C are not causallyprotective against CHD and that HDL functionand cholesterol fluxmay bemore important thanabsolute levels. Using an in vivo assay of macro-phage RCT, we previously showed that Scarb1KO mice have impaired macrophage RCT eventhough they have elevatedHDL-C levels (21). Ourresults suggest that reduced hepatic SR-BI func-tion in humans causes impaired RCT, which leadsto increased risk of CHDdespite elevation inHDL-C levels. However, SR-BI is also expressed in vas-cular cell types, including endothelial cells, vascularsmooth muscle cells, and macrophages, whereit could have protective effects against athero-sclerosis as well (38, 39). Our results are alsoconsistent with the previously suggested concept(39) that up-regulation or enhancement of SR-BI
1170 11 MARCH 2016 • VOL 351 ISSUE 6278 sciencemag.org SCIENCE
Table 3. Meta-analysis of association of SCARB1 P376L variant withCHD. CHD cases and healthy controls across the CARDIoGRAM Exome Consor-
tiumandCHDExome+Consortiumweregenotyped for theSCARB1P376Lvariantby using the exome array. BioVU, Vanderbilt University Medical Center Bio-
repository; BHF, British Heart Foundation; GoDARTS-CAD,Genetics of Diabetes
and Audit Research Tayside Study; MHI, Montreal Heart Institute; North German,GermanNorthCoronaryArteryDiseaseStudy;Ottawa,OttawaHeart Study; PAS,
Premature Atherosclerosis Study—Academic Medical Center—Amsterdam;
Penn, University of Pennsylvania CHD Cohort; South German, German South
Coronary Artery Disease Study; WHI-EA, Women's Health Initiative—European
American Cohort; CCHS, Copenhagen City Heart Study; CIHDS/CGPS, Copenha-
gen Ischemic Heart Disease Study/Copenhagen General Population Study; EPIC-
CVD, EuropeanProspective Investigation intoCancer andNutrition—CardiovascularDiseaseStudy;MORGAM,MOnicaRisk,Genetics,ArchivingandMonographProject;
PROSPER, ProspectiveStudyof Pravastatin in theElderly at RiskStudy;WOSCOPS,
West of Scotland Coronary Prevention Study.The association of the P376L variant
with CHD cases was determined using a Mantel-Haenszel fixed-effects meta-analysis; results were odds ratio = 1.79; P = 0.018.
Consortium or study cohortP376L carriers Total Frequency
Cases Controls CHD cases Controls Cases Controls
CARDIoGRAM Exome Consortium.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
BioVU 6 10 4587 16546 0.0013 0.0006.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
BHF 1 0 2833 5912 0.0004 0.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
GoDARTS-CAD 1 0 1568 2772 0.0006 0.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
MHI 0 4 2483 8085 0 0.0005.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
North German 0 1 4464 2886 0 0.0004.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
Ottawa 0 1 1024 2267 0 0.0004.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
PAS 1 1 728 808 0.0014 0.0012.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
Penn 3 0 683 156 0.0044 0.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
South German 4 0 5255 2921 0.0008 0.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
WHI-EA 8 29 2860 14929 0.0028 0.0019.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
CHD Exome+ Consortium.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
CCHS 1 1 2020 6087 0.0003 0.0001.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
CIHDS/CGPS 4 3 8079 10367 0.0003 0.0001.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
EPIC-CVD 4 2 9810 10970 0.0002 0.0001.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
MORGAM 0 0 2153 2118 0 0.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
PROSPER 1 0 640 638 0.0008 0.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
WOSCOPS 0 0 659 687 0 0.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
Total 34 52 49846 88149 0.00068 0.00059.. .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. ... ... .. ... .. ... ... .. ... ... .. .
RESEARCH | RESEARCH ARTICLES
could be a novel therapeutic approach to reduc-ing CHD risk in the general population.
REFERENCES AND NOTES
1. D. J. Rader, A. R. Tall, Nat. Med. 18, 1344–1346 (2012).2. C. L. Haase et al., J. Clin. Endocrinol. Metab. 97, E248–E256
(2012).3. R. Frikke-Schmidt et al., JAMA 299, 2524–2532 (2008).4. B. F. Voight et al., Lancet 380, 572–580 (2012).5. S. Acton et al., Science 271, 518–520 (1996).6. M. Hoekstra, T. J. Van Berkel, M. Van Eck, World J.
Gastroenterol. 16, 5916–5924 (2010).7. N. Wang, T. Arai, Y. Ji, F. Rinninger, A. R. Tall, J. Biol. Chem.
273, 32920–32926 (1998).8. Y. Ueda et al., J. Biol. Chem. 274, 7165–7171 (1999).9. K. F. Kozarsky et al., Nature 387, 414–417 (1997).10. Y. Ji et al., J. Biol. Chem. 274, 33398–33402 (1999).11. M. L. Varban et al., Proc. Natl. Acad. Sci. U.S.A. 95, 4619–4624
(1998).12. A. Rigotti et al., Proc. Natl. Acad. Sci. U.S.A. 94, 12610–12615
(1997).13. M. Brundert et al., Arterioscler. Thromb. Vasc. Biol. 25, 143–148
(2005).14. Y. Ueda et al., J. Biol. Chem. 275, 20368–20373 (2000).15. K. F. Kozarsky, M. H. Donahee, J. M. Glick, M. Krieger, D. J. Rader,
Arterioscler. Thromb. Vasc. Biol. 20, 721–727 (2000).16. T. Arai, N. Wang, M. Bezouevski, C. Welch, A. R. Tall, J. Biol.
Chem. 274, 2366–2371 (1999).17. M. Van Eck et al., J. Biol. Chem. 278, 23699–23705
(2003).18. B. Trigatti et al., Proc. Natl. Acad. Sci. U.S.A. 96, 9322–9327
(1999).19. D. Huszar et al., Arterioscler. Thromb. Vasc. Biol. 20,
1068–1073 (2000).20. A. Braun et al., Circ. Res. 90, 270–276 (2002).21. Y. Zhang et al., J. Clin. Invest. 115, 2870–2874 (2005).22. T. M. Teslovich et al., Nature 466, 707–713 (2010).23. A. Ghodsizadeh et al., Stem Cell Rev. 6, 622–632 (2010).24. M. A. Cayo et al., Hepatology 56, 2163–2171 (2012).25. S. K. Mallanna, S. A. Duncan, Curr. Protocol Stem Cell Biol. 26
(Unit 1G), 4 (2013).26. K. Si-Tayeb et al., Hepatology 51, 297–305 (2010).27. J. Babitt et al., J. Biol. Chem. 272, 13242–13249 (1997).28. M. Viñals, S. Xu, E. Vasile, M. Krieger, J. Biol. Chem. 278,
5325–5332 (2003).29. D. Calvo, D. Gómez-Coronado, M. A. Lasunción, M. A. Vega,
Arterioscler. Thromb. Vasc. Biol. 17, 2341–2349 (1997).30. C. C. Schwartz, J. M. VandenBroek, P. S. Cooper, J. Lipid Res.
45, 1594–1607 (2004).31. M. Vergeer et al., N. Engl. J. Med. 364, 136–145 (2011).32. R. B. Hildebrand et al., Arterioscler. Thromb. Vasc. Biol. 30,
1439–1445 (2010).33. L. Lagrost et al., Arterioscler. Thromb. 13, 815–825 (1993).34. H. E. Miettinen, H. Rayburn, M. Krieger, J. Clin. Invest. 108,
1717–1722 (2001).35. M. Hoekstra et al., J. Lipid Res. 49, 738–745 (2008).36. M. Hoekstra et al., J. Lipid Res. 50, 1039–1046 (2009).37. O. Kocher et al., J. Biol. Chem. 278, 52820–52825 (2003).38. C. Mineo, P. W. Shaul, Curr. Opin. Lipidol. 23, 487–493
(2012).39. A. Rigotti, H. E. Miettinen, M. Krieger, Endocr. Rev. 24, 357–387
(2003).
ACKNOWLEDGMENTS
We appreciate the participation and support of participants of the deepclinical phenotyping studies. We thank E. Mohler for assistance ininterpretation of cIMT results and J. Billheimer and E. Pashos for helpfuldiscussions. We also acknowledge J. Tabita-Martinez for expertassistance with clinical phenotyping studies. This work was supportedin part by an award from the National Center for Research Resources(grant TL1RR024133) and National Center for Advancing TranslationalSciences of the NIH (grant TL1R000138) to support patientrecruitment. D.B.L. was supported by a fellowship from the Doris DukeCharitable Foundation. S.K. has financial relationships with Novartis,Aegerion, Bristol-Myers Squibb, Sanofi, AstraZeneca, Alnylam, Eli Lilly,Leerink Partners, Merck, Catabasis, Regeneron Genetic Center, SanTherapeutics, and Celera. H.S. has financial relationships with MSDSharp and Dohme, Sanofi-Aventis, and Amgen. S.B. has financialrelationships with Boehringer Ingelheim, Bayer, Novartis, Roche, andThermo Fisher. N.S has financial relationships with Amgen, Sanofi,Astrazeneca, and MSD Sharp and Dohme. A.K. has a financialrelationship with Amgen. J.D. has a financial relationship with Novartis.A.T.-H. has financial relationships with Eli Lilly and LGC Genomics.Sequencing data have been deposited in GenBank (SRX1458096).
Genotyping data have been deposited in the Gene Expression Omnibus(GSE76065).
SUPPLEMENTARY MATERIALS
www.sciencemag.org/content/351/6278/1166/suppl/DC1Materials and MethodsSupplementary Text
Figs. S1 to S7Table S1References (40–76)Consortia and Study Author Lists
1 September 2015; accepted 7 January 201610.1126/science.aad3517
CHEMICAL PHYSICS
Wavelike charge densityfluctuations and van der Waalsinteractions at the nanoscaleAlberto Ambrosetti,1,2 Nicola Ferri,1 Robert A. DiStasio Jr.,3* Alexandre Tkatchenko1,4*
Recent experiments on noncovalent interactions at the nanoscale have challenged the basicassumptions of commonly used particle- or fragment-based models for describing van derWaals (vdW) or dispersion forces. We demonstrate that a qualitatively correct description ofthe vdW interactions between polarizable nanostructures over a wide range of finite distancescan only be attained by accounting for the wavelike nature of charge density fluctuations.By considering a diverse set of materials and biological systems with markedly differentdimensionalities, topologies, and polarizabilities, we find a visible enhancement in thenonlocality of the charge density response in the range of 10 to 20 nanometers. Thesecollective wavelike fluctuations are responsible for the emergence of nontrivial modificationsof the power laws that govern noncovalent interactions at the nanoscale.
The assembly of complex nanostructuresand biological systems from simpler build-ing blocks is often driven by noncovalentvan der Waals (vdW) or dispersion interac-tions that arise from electrodynamic corre-
lations between instantaneous charge fluctuationsin matter (1, 2). The influence of vdW forces ex-tends well beyond binding energies and encom-passes the structural (3, 4), mechanical (5, 6),spectroscopic (7), and even electronic (8) signa-tures of condensed matter. A common way tocharacterize vdW interactions is by power laws inthe distanceD between two or more objects (e.g.,atoms, molecules, nanostructures, surfaces, orsolids); themost familiar is arguably the Lennard-Jones potential, which is characterized by a short-range repulsive wall with a D–12 dependence anda long-range attractive tail with aD–6 dependence.Even a slight variation in these power laws canhave a profound impact on observed propertiesand therefore demands an accurate, physicallysound theoretical description.Thus far, both our conceptual understanding
of vdW interactions and the quantitative modelswidely used for describing these quantummechan-ical phenomena are primarily rooted in low-orderintermolecular perturbation theory (IPT), wherein
vdW binding originates from the interactionsbetween transient local multipoles (9), and mac-roscopic Lifshitz theory (10). Although IPT-basedapproaches have had enormous success in describ-ing vdW binding in (small) gas-phase molecularsystems (11, 12), recent advanced experimentaltechniques have produced several findings thatare challenging the basic assumptions of IPT andmacroscopic approaches for nanostructured ma-terials, and are strongly indicative that even ourqualitative understanding of these interactions isincomplete and needs to be substantially revised(13). Examples of such experimental observationsinclude (i) ultra–long-range vdW interactions ex-tending up to tens of nanometers into heteroge-neous dielectric interfaces (14, 15), (ii) completescreening of the vdW interaction between anatomic force microscope (AFM) tip and a SiO2
surface by the presence of one or more layers ofgraphene adsorbed on the surface (16), (iii) super-linear sticking power laws for the self-assemblyof metallic clusters on carbon nanotubes with in-creasing surface area (17), and (iv) nonlinear in-creases in the vdWattraction betweenhomologousmolecules and an Au(111) surface as a function ofmolecular size (18). Satisfactory theoretical expla-nations for these experimental findings eitherrequire ad hoc modifications to IPT [(iii) and(iv)] or are inherently outside the domain of ap-plicability of IPT [(i) and (ii)].To address these issues, we note that the spa-
tial extent of the instantaneous charge densityfluctuations responsible for vdW interactions de-pends rather sensitively on the nature and char-acter of the occupied-to-virtual transitions of the
SCIENCE sciencemag.org 11 MARCH 2016 • VOL 351 ISSUE 6278 1171
1Fritz-Haber-Institut der Max-Planck-Gesellschaft, D-14195Berlin, Germany. 2Dipartimento di Fisica e Astronomia,Università degli Studi di Padova, 35131 Padova, Italy.3Department of Chemistry and Chemical Biology, CornellUniversity, Ithaca, NY 14853, USA. 4Physics and MaterialsScience Research Unit, University of Luxembourg, L-1511Luxembourg.*Corresponding author. E-mail: [email protected] (R.A.D.);[email protected] (A.T.)
RESEARCH | RESEARCH ARTICLES
DOI: 10.1126/science.aad3517, 1166 (2016);351 Science et al.Paolo Zanoni
increases risk of coronary heart diseaseRare variant in scavenger receptor BI raises HDL cholesterol and
This copy is for your personal, non-commercial use only.
clicking here.colleagues, clients, or customers by , you can order high-quality copies for yourIf you wish to distribute this article to others
here.following the guidelines
can be obtained byPermission to republish or repurpose articles or portions of articles
): March 28, 2016 www.sciencemag.org (this information is current as of
The following resources related to this article are available online at
/content/351/6278/1166.full.htmlversion of this article at:
including high-resolution figures, can be found in the onlineUpdated information and services,
/content/suppl/2016/03/09/351.6278.1166.DC1.html can be found at: Supporting Online Material
/content/351/6278/1166.full.html#relatedfound at:
can berelated to this article A list of selected additional articles on the Science Web sites
/content/351/6278/1166.full.html#ref-list-1, 35 of which can be accessed free:cites 74 articlesThis article
/cgi/collection/medicineMedicine, Diseases
subject collections:This article appears in the following
registered trademark of AAAS. is aScience2016 by the American Association for the Advancement of Science; all rights reserved. The title
CopyrightAmerican Association for the Advancement of Science, 1200 New York Avenue NW, Washington, DC 20005. (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week in December, by theScience
on M
arch
29,
201
6D
ownl
oade
d fr
om
www.sciencemag.org/content/351/6278/1166/suppl/DC1
Supplementary Materials for
Rare variant in scavenger receptor BI raises HDL cholesterol and increases risk of coronary heart disease
Paolo Zanoni, Sumeet A. Khetarpal, Daniel B. Larach, William F. Hancock-Cerutti,
John S. Millar, Marina Cuchel, Stephanie DerOhannessian, Anatol Kontush, Praveen Surendran, Danish Saleheen, Stella Trompet, J. Wouter Jukema,
Anton De Craen, Panos Deloukas, Naveed Sattar, Ian Ford, Chris Packard, Abdullah al Shafi Majumder, Dewan S. Alam, Emanuele Di Angelantonio,
Goncalo Abecasis, Rajiv Chowdhury, Jeanette Erdmann, Børge G. Nordestgaard, Sune F. Nielsen, Anne Tybjærg-Hansen, Ruth Frikke Schmidt, Kari Kuulasmaa,
Dajiang J. Liu, Markus Perola, Stefan Blankenberg, Veikko Salomaa, Satu Männistö, Philippe Amouyel, Dominique Arveiler, Jean Ferrieres, Martina Müller-Nurasyid, Marco Ferrario, Frank Kee, Cristen J. Willer, Nilesh Samani, Heribert Schunkert, Adam S. Butterworth, Joanna M. M. Howson, Gina M. Peloso, Nathan O. Stitziel,
John Danesh, Sekar Kathiresan, Daniel J. Rader,* CHD Exome+ Consortium, CARDIoGRAM Exome Consortium, Global Lipids Genetics Consortium
*Corresponding author. E-mail: [email protected]
Published 11 March 2016, Science 351, 1166 (2016) DOI: 10.1126/science.aad3517
This PDF file includes
Materials and Methods Supplementary Text Figs. S1 to S7 Table S1 Full Reference List Consortia and Study Author Lists
Acknowledgments and Contributors
Author Contributions to the Research Article:
P.Z. and S.A.K. performed and analyzed data from cell and animal experiments. S.A.K. and S.D.
analyzed results of Penn sequencing and genotyping studies. M.C. and D.B.L. assisted in design
and recruitment of subjects for deep clinical phenotyping studies. W.F.H-C. and A.K. performed
lipoprotein characterization studies and cholesterol efflux capacity assays. S.A.K. and J.S.M.
performed platelet cholesterol measurement assays. P.S. D.S., S.T., J.W.J., A.D.C., P.D., N.S.,
I.F., C.P. A a.S.M., D.S.A., E.D.A., G.A., R.C., J.E., B.G.N., S.F.N., A.T.H., R.F.S., K.K., D.L.,
M.P., S.B., V.S., S.M., P.A., D.A., J.F., M.M.-N., M.F., F.K., C.J.W., N.S., H.S., A.S.B.,
J.M.M.H., G.M.P., N.O.S., J.D., and S.K. contributed exome array genotyping data and analysis.
D.J.R. funded, conceived and designed the study. P.Z., S.A.K. and D.J.R. wrote the manuscript
with input from all of the authors.
Listing of consortia members who contributed to this Research Article:
______________________________________________________________________________
CHD Exome+ Consortium
Primary Investigator: Adam S. Butterworth, John Danesh, Joanna M. M. Howson, Danish
Saleheen, Praveen Surendran
Contributing groups to CHD Exome+ Consortium and Primary Investigators from these groups:
Copenhagen City Heart Study/CIHDS/CGPS
Sune F. Nielsen, Børge G. Nordestgaard, Ruth Frikke-Schmidt, Anne Tybjærg-Hansen
EPIC-CVD
Adam S. Butterworth, John Danesh, Sarah Watson
PROSPER
Anton De Craen, Stella Trompet, J. Wouter Jukema
WOSCOPS
Ian Ford, Christopher J. Packard, Naveed Sattar
PROMIS
Danish Saleheen, John Danesh
MORGAM
Philippe Amouyel, Dominique Arveiler, Stefan Blankenberg, Marco Ferrario, Jean Ferrieres,
Frank Kee, Kari Kuulasmaa, Satu Männistö, Markus Perola, Veikko Salomaa, Martina Müller-
Nurasyid
BRAVE
Abdulla al Shafi Majumder, Emanuele Di Angelantonio, Rajiv Chowdhury, John Danesh
______________________________________________________________________________
Global Lipids Genetics Consortium
Adam Butterworth, Alanna C. Morrison, Albert V. Smith, Alex P. Reiner, Alexessander Couto
Alves, Aliki-Eleni Farmaki, Alisa Manning, Allan Linneberg, Andrew P. Morris, Anette Varbo,
Ani Manichaikul, Aniruddh P. Patel, Anna Dominiczak, Anne Langsted, Anne Tybjærg-Hansen,
Anne U. Jackson, Annette Peters, Anubha Mahajan, Asif Rasheed, Audrey Y. Chu, Børge G.
Nordestgaard, Bruce M. Psaty, Caroline Hayward, Charles L. Kooperberg, Charlotta Pisinger,
Christian Gieger, Christian M. Shaffer, Christie M. Ballantyne, Claudia Langenberg, Colin N. A.
Palmer, Cramer Christensen, Cristen J. Willer, Dajiang J. Liu, Dan M. Roden, Daniel I.
Chasman, Danish Saleheen, David C. M. Liewald, Dewar Alam, Dominique Arveiler, Dorota
Pasko, Eirini Marouli, Eleftheria Zeggini, Ellen M. Schmidt, Emanuele di Angelantonio, EPIC-
CVD Consortium, Eric Boerwinkle, Erwin P. Bottinger, Francesco Cucca, Franco Giulianini,
Frank Kee, Fredrik Karpe, Frida Renström, Gail Davies, George Dedoussis, Georgio Pistis, Gina
M. Peloso, Goncalo Abecasis, Gorm B. Jensen, Gudny Eiriksdottir, Hanieh Yaghootkar, Harald
Grallert, Hayato Tada, He Zhang, Heather M. Stringham, Helen R. Warren, Hua Tang, Ian Ford,
Ian J. Deary, Ivan Brandslund, J. Wouter Jukema, Jaakko Tuomilehto, James G. Wilson, Jarmo
Virtamo, Jaspal S. Kooner, Jean Ferrieres, Jean-Claude Tardif, Jennifer E. Huffman, Jerome I.
Rotter, Jette Bork-Jensen, Joanna M. M. Howson, Johanna Jakobsdottir, Johanna Kuusisto,
Johanne M. Justesen, John C. Chambers, John Danesh, John M. Connell, John M. Starr, Jonathan
Martin, Jose M. Ordovas, Joshua C. Bis, Joshua C. Denny, Kari Kuulasmaa, Kathleen E.
Stirrups, Kent D. Taylor, Kerrin S. Small, Konstantin Strauch, Kristian Hveem, L. Adrienne
Cupples, Lenore J. Launer, Li An Lin, Lia E. Bang, Lorraine Southam, Marco Ferrario,
Marianne Benn, Marie-Pierre Dubé, Marit E. Jørgensen, Marjo-Riitta Jarvelin, Mark Caulfield,
Mark I. McCarthy, Mark J. Caulfield, Markku Laakso, Markus Perola, Martina Müller-Nurasyid,
Mary F. Feitosa, Matt J. Neville, Megan L. Grove, Melanie Waldenberger, Melissa E. Garcia,
Michael Boehnke, Ming Xu, Morris Brown, Myriam Fornage, Natalie R. van Zuydam, Naveed
Sattar, Neil Poulter, Neil R. Robertson, Nicholas G. D. Masca, Nick J. Wareham, Niels Grarup,
Nilesh J. Samani, Oddgeir L. Holmen, Oluf Pedersen, Panos Deloukas, Patricia B. Munroe, Paul
L. Auer, Paul M. Ridker, Paul W. Franks, Pekka Mäntyselkä, Peter E. Weeke, Peter Sever,
Philippe Amouyel, Philippe Frossard, Pia R. Kamstrup, Praveen Surendran, Rainer Raumaraa
Rajiv Chowdhury, Robert A. Scott, Robin Young, Ruth Frikke-Schmidt, Ruth J.F. Loos,
Sandosh Padmanabhan, Santhi K. Ganesh, Sehrish Jabeen, Sekar Kathiresan, Stavroula Kanoni,
Stella Trompet, Stephen S. Rich, Sune F. Nielsen, Suthesh Sivapalaratnam, Tamara B. Harris,
Tapani Ebeling, The EPIC-InterAct Consortium, Tibor V. Varga, Timo Lakka, Timothy D.
Spector, Timothy M. Frayling, Tõnu Esko, Torben Hansen, Torsten Lauritzen, Veikko Salomaa,
Vilmundur Gudnason, Wei Gao, Wei Zhou, Weihua Zhang, Xiangfeng Lu, Xueling Sim, Y.
Eugene Chen, Yan Zhang, Yanhua Zhou, Yii-Der Ida Chen, Yingchang Lu, Yong Huo
______________________________________________________________________________
CARDIoGRAM Exome Consortium Nathan O. Stitziel, Kathleen E. Stirrups, Nicholas G. D.
Masca, Jeanette Erdmann, Paola G. Ferrario, Inke R. König, Peter E. Weeke, Thomas R. Webb,
Paul L. Auer, Ursula M. Schick, Yingchang Lu, He Zhang, Marie-Pierre Dubé, Anuj Goel,
Martin Farrall, Gina M. Peloso, Hong-Hee Won, Ron Do, Erik van Iperen, Stavroula Kanoni,
Jochen Kruppa, Anubha Mahajan, Robert A. Scott, Christina Willenborg, Peter S. Braund, Julian
C. van Capelleveen, Alex S. F. Doney, Louise A. Donnell, Rosanna Asselta, Piera A. Merlini,
Stefano Duga, Nicola Marziliano, Joshua C. Denny, Christian M. Shaffer, Nour Eddine El-
Mokhtari, Andre Franke, Omri Gottesman, Stefanie Heilmann, Christian Hengstenberg, Per
Hoffmann, Oddgeir L. Holmen, Kristian Hveem, Jan-Håkan Jansson, Karl-Heinz Jöckel,
Thorsten Kessler, Jennifer Kriebel, Karl L. Laugwitz, Eirini Marouli, Nicola Martinelli, Mark I.
McCarthy, Natalie R. Van Zuydam, Christa Meisinger, Tõnu Esko, Evelin Mihailov, Stefan A.
Escher, Maris Alver, Susanne Moebus, Andrew D. Morris, Martina Müller-Nurasyid, Majid
Nikpay, Oliviero Olivieri, Louis-Philippe Lemieux Perreault, Alaa AlQarawi, Neil R. Robertson,
Karen O. Akinsanya, Dermot F. Reilly, Thomas F. Vogt, Wu Yin, Folkert W. Asselbergs,
Charles Kooperberg, Rebecca D. Jackson, Eli Stahl, Konstantin Strauch, Tibor V. Varga,
Melanie Waldenberger, Lingyao Zeng, Aldi T. Kraja, Chunyu Liu, Georg B. Ehret, Christopher
Newton-Cheh, Daniel I. Chasman, Rajiv Chowdhury, Marco Ferrario, Ian Ford, J. Wouter
Jukema, Frank Kee, Kari Kuulasmaa, Børge G. Nordestgaard, Markus Perola, Danish Saleheen,
Naveed Sattar, Praveen Surendran, David Tregouet, Robin Young, Joanna M. M. Howson,
Adam S. Butterworth, John Danesh, Diego Ardissino, Erwin P. Bottinger, Raimund Erbel, Paul
W. Franks, Domenico Girelli, Alistair S. Hall, G. Kees Hovingh, Adnan Kastrati, Wolfgang
Lieb, Thomas Meitinger, William E. Kraus, Svati H. Shah, Ruth McPherson, Marju Orho-
Melander, Olle Melander, Andres Metspalu, Colin N. A. Palmer, Annette Peters, Daniel J.
Rader, Muredach P. Reilly, Ruth J. F. Loos, Alex P. Reiner, Dan M. Roden, Jean-Claude Tardif,
John R. Thompson, Nicholas J. Wareham, Hugh Watkins, Cristen J. Willer, Panos Deloukas,
Nilesh J. Samani, Heribert Schunkert, Sekar Kathiresan
AUTHORS AND AFFILIATIONS BY GROUP CHD Exome+ Consortium
Primary Investigators
Adam S. Butterworth
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
John Danesh
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK. Wellcome Trust Sanger Institute, Genome Campus, Hinxton
CB10 1HH, UK.
Joanna M. M. Howson
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
Danish Saleheen
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK. Department of Biostatistics and Epidemiology, Perelman School
of Medicine, University of Pennsylvania, Philadelphia, PA, USA. Centre for Non-
Communicable Diseases, Karachi, Pakistan.
Praveen Surendran
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK
Contributing groups to CHD Exome+ Consortium and Primary Investigators from these groups:
Copenhagen City Heart Study/CIHDS/CGPS
Sune F. Nielsen
Department of Clinical Biochemistry Herlev Hospital, Copenhagen University Hospital, Herlev,
Denmark.
Børge G. Nordestgaard
Department of Clinical Biochemistry Herlev Hospital, Copenhagen University Hospital, Herlev,
Denmark.
Ruth Frikke-Schmidt
Department of Clinical Biochemistry, Rigshospitalet, Copenhagen University Hospital,
Copenhagen, Denmark.
Anne Tybjærg-Hansen
Copenhagen University Hospital, University of Copenhagen, Copenhagen, Denmark.
EPIC-CVD
Adam S. Butterworth
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
John Danesh
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK. Wellcome Trust Sanger Institute, Genome Campus, Hinxton
CB10 1HH, UK.
Sarah Watson
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
MORGAM
Philippe Amouyel
Department of Epidemiology and Public Health, Institut Pasteur de Lille, Lille, France.
Dominique Arveiler
Department of Epidemiology and Public Health, EA 3430, University of Strasbourg, Strasbourg,
F- 67085, France.
Stefan Blankenberg
Department of General and Interventional Cardiology, University Heart Center Hamburg,
Germany. University Medical Center Hamburg-Eppendorf, Hamburg, Germany.
Marco Ferrario
Research Centre in Epidemiology and Preventive Medicine – EPIMED, Department of Clinical
and Experimental Medicine, University of Insubria, Via O Rossi 9, 21100 Varese, Italy.
Jean Ferrieres
Department of Epidemiology, UMR 1027- INSERM, Toulouse University-CHU Toulouse,
Toulouse, France.
Frank Kee
UKCRC Centre of Excellence for Public Health, Queens University, Belfast, Northern Ireland.
Kari Kuulasmaa
Department of Health, National Institute for Health and Welfare, Helsinki, Finland.
Satu Männistö
Department of Health, National Institute for Health and Welfare, Helsinki, Finland.
Martina Müller-Nurasyid
Institute of Genetic Epidemiology, Helmholtz Zentrum München, German Research Center for
Environmental Health, Neuherberg, Germany
Markus Perola
Department of Health, National Institute for Health and Welfare, Helsinki, Finland. Institute of
Molecular Medicine FIMM, University of Helsinki, Finland.
Veikko Salomaa
Department of Health, National Institute for Health and Welfare, FI-00271, Helsinki, Finland.
Martina Müller-Nurasyid
Institute of Genetic Epidemiology, Helmholtz Zentrum München - German Research Center for
Environmental Health, Neuherberg, Germany. Department of Medicine I, Ludwig-Maximilians-
Universität, Munich, Germany. DZHK (German Centre for Cardiovascular Research), partner
site Munich Heart Alliance, Munich, Germany.
PROSPER
Anton De Craen
Leiden University Medical Center, Leiden, The Netherlands
Stella Trompet
Leiden University Medical Center, Leiden, The Netherlands
J. Wouter Jukema
Leiden University Medical Center, Leiden, The Netherlands
WOSCOPS
Ian Ford
University of Glasgow, Glasgow, Scotland, UK.
Christopher J. Packard
University of Glasgow, Glasgow, Scotland, UK.
Naveed Sattar
University of Glasgow, Glasgow, Scotland, UK.
BRAVE
Abdulla al Shafi Majumder
National Institute of Cardiovascular Diseases, Sher-e-Bangla Nagar, Dhaka, Bangladesh.
Dewan S. Alam
ICDDR, B; Mohakhali, Dhaka 1212, Bangladesh.
Emanuele Di Angelantonio, Rajiv Chowdhury, John Danesh
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
PROMIS
Danish Saleheen
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK. Department of Biostatistics and Epidemiology, Perelman School
of Medicine, University of Pennsylvania, Philadelphia, PA, USA. Centre for Non-
Communicable Diseases, Karachi, Pakistan.
John Danesh
Department of Public Health and Primary Care, Strangeways Research Laboratory, University of
Cambridge, Cambridge CB1 8RN, UK.
Global Lipids Genetics Consortium
Adam Butterworth
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
The National Institute for Health Research Blood and Transplant Unit (NIHR BTRU) in Donor
Health and Genomics at the University of Cambridge, UK.
Alanna C. Morrison
Human Genetics Center, School of Public Health, The University of Texas School Health
Science Center at Houston, Houston, TX 77030, USA.
Albert V. Smith
The Icelandic Heart Association, Kopavogur, Iceland. The University of Iceland, Reykjavik,
Iceland.
Alex P. Reiner
Department of Epidemiology, University of Washington, Seattle WA 98195, USA. Division of
Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle WA 98195, USA.
Alexessander Couto Alves
Faculty of Medicine, School of Public Health, Imperial College London
Aliki-Eleni Farmaki
Department of Nutrition and Dietetics, School of Health Science and Education, Harokopio
University, Athens, Greece. Harokopio University of Athens, Kallithea, Athens, Greece.
Alisa Manning
Broad Institute of the Massachusetts Institute of Technology and Harvard University,
Cambridge, MA 02142, USA
Allan Linneberg
Research Centre for Prevention and Health, Capital Region of Denmark, Copenhagen, Denmark.
Department of Clinical Experimental Research, Glostrup University Hospital, Glostrup,
Denmark. Department of Clinical Medicine, Faculty of Health and Medical Sciences, University
of Copenhagen, Copenhagen, Denmark.
Andrew P. Morris
Department of Biostatistics, University of Liverpool, Liverpool, UK. Wellcome Trust Centre for
Human Genetics, University of Oxford, Oxford, UK.
Anette Varbo
Department of Clinical Biochemistry and The Copenhagen General Population Study, Herlev
and Gentofte Hospital, Copenhagen University Hospital, Denmark, and Faculty of Health and
Medical Sciences, University of Denmark, Denmark. Department of Clinical Biochemistry,
54M1, Herlev and Gentofte Hospital, Copenhagen University Hospital, Herlev, Denmark.
Ani Manichaikul
Center for Public Health Genomics, University of Virginia, Charlottesville, VA 22903, USA
Aniruddh P. Patel
Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA 02114, USA.
Cardiovascular Research Center, Massachusetts General Hospital, Boston, MA 02114, USA.
Department of Medicine, Harvard Medical School, Boston, MA 02114, USA. Program in
Medical and Population Genetics, Broad Institute, 7 Cambridge Center, Cambridge, MA 02142,
USA.
Anna Dominiczak
Institute of Cardiovascular and Medical Sciences, College of Medical, Veterinary and Life
Sciences, University of Glasgow, Glasgow G12 8TA,Scotland, UK.
Anne Langsted
Department of Clinical Biochemistry and The Copenhagen General Population Study, Herlev
and Gentofte Hospital, Copenhagen University Hospital, Denmark, and Faculty of Health and
Medical Sciences, University of Denmark, Denmark.
Anne Tybjaerg-Hansen
Department of Clinical Biochemistry, Rigshospitalet, Copenhagen, Denmark and Faculty of
Health and Medical Sciences, University of Copenhagen, Denmark.
Anne U. Jackson
Department of Biostatistics and Center for Statistical Genetics, University of Michigan, Ann
Arbor, MI 48109, USA.
Annette Peters
Institute for Epidemiology II, Helmholtz Zentrum München, Neuherberg, Germany.
German Center for Cardiovascular Disease Research, partner-site Munich, Munich, Germany.
German Center for Diabetes Research, Neuherberg, Germany.
Anubha Mahajan
Wellcome Trust Centre for Human Genetics, Nuffield Department of Medicine, University of
Oxford, Oxford, UK.
Asif Rasheed
Center for Non-Communicable Diseases, Karachi, Pakistan.
Audrey Y. Chu
Division of Preventive Medicine, Brigham and Women’s Hospital, Boston, MA 02215, USA.
NHLBI Framingham Heart Study, Framingham, MA 01702, USA.
Børge G. Nordestgaard
Department of Clinical Biochemistry and The Copenhagen General Population Study, Herlev
and Gentofte Hospital, Copenhagen University Hospital, Denmark, and Faculty of Health and
Medical Sciences, University of Denmark, Denmark.
Bruce M. Psaty
Cardiovascular Health Research Unit, Departments of Medicine, Epidemiology, and Health
Services, University of Washington, Seattle, WA 98101, USA. Group Health Research Institute,
Group Health Cooperative, Seattle, WA 98101, USA.
Caroline Hayward
Generation Scotland, Centre for Genomic and Experimental Medicine, Institute of Genetics and
Molecular Medicine, University of Edinburgh, Edinburgh, UK. Medical Research Council
Human Genetics Unit, Institute of Genetics and Molecular Medicine, University of Edinburgh,
Edinburgh, UK.
Charles L. Kooperberg
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle WA
98195, USA.
Charlotta Pisinger
Research Centre for Prevention and Health, Capital Region of Denmark, Copenhagen, Denmark.
Christian Gieger
Research Unit of Molecular Epidemiology, Helmholtz Zentrum München, German Research
Center for Environmental Health, Neuherberg, Germany. Institute of Epidemiologie II,
Helmholtz Zentrum München, German Research Center for Environmental Health, Neuherberg,
Germany. German Center for Diabetes Research (DZD e.V.), Neuherberg, Germany.
Christian M. Shaffer
Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232, USA.
Christie M. Ballantyne
Department of Medicine, Baylor College of Medicine, Houston, TX 77030 , USA.
Claudia Langenberg
MRC Epidemiology Unit, Institute of Metabolic Science, University of Cambridge School of
Clinical Medicine, Cambridge, UK.
Colin N. A. Palmer
Medical Research Institute, University of Dundee, Ninewells Hospital and Medical School,
Dundee, UK.
Cramer Christensen
Medical department, Lillebaelt Hospital, Vejle, Denmark.
Cristen J. Willer
Department of Internal Medicine, Division of Cardiovascular Medicine, University of Michigan,
Ann Arbor, Michigan 48109, USA. Department of Computational Medicine and Bioinformatics,
University of Michigan, Ann Arbor, Michigan 48109, USA. Department of Human Genetics,
University of Michigan, Ann Arbor, Michigan 48109, USA.
Dajiang J. Liu
Department of Public Health Sciences and Institute of Personalized Medicine, College of
Medicine, Penn State College of Medicine, Hershey, PA 17033, USA.
Dan M. Roden
Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232, USA.
Daniel I. Chasman
Division of Preventive Medicine, Department of Medicine, Brigham and Women’s Hospital and
Harvard Medical School, Boston, MA 02215, USA.
Danish Saleheen
Department of Biostatistics and Epidemiology, Perelman School of Medicine, University of
Pennsylvania, Philadelphia, PA 19104, USA. Centre for Non-Communicable Diseases, Karachi,
Pakistan. Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care,
University of Cambridge, Cambridge, UK.
David C. M. Liewald
Centre for Cognitive Ageing and Cognitive Epidemiology, University of Edinburgh, Edinburgh,
UK. Department of Psychology, University of Edinburgh, Edinburgh, UK.
Dewan S. Alam
ICDDR, B; Mohakhali, Dhaka 1212, Bangladesh.
Dominique Arveiler
Department of Epidemiology and Public Health, EA 3430, University of Strasbourg, Strasbourg,
F- 67085, France.
Dorota Pasko
Genetics of Complex Traits, University of Exeter Medical School, University of Exeter, Exeter,
EX2 5DW, UK.
Eirini Marouli
William Harvey Research Institute, Barts and The London School of Medicine and Dentistry,
Queen Mary University of London, London, UK.
Eleftheria Zeggini
Wellcome Trust Sanger Institute, Hinxton, CB10 1SA, UK.
Ellen M. Schmidt
Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor,
MI 48109, USA.
Emanuele di Angelantonio
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK. The National Institute for Health Research Blood and Transplant
Unit (NIHR BTRU) in Donor Health and Genomics at the University of Cambridge, UK.
EPIC-CVD Consortium
Eric Boerwinkle
Human Genetics Center, School of Public Health, The University of Texas School Health
Science Center at Houston, Houston, TX 77225, USA.
Erwin P. Bottinger
The Charles Bronfman Institute for Personalized Medicine, Icahn School of Medicine at Mount
Sinai, New York, NY 10029, USA.
Francesco Cucca
Istituto di Ricerca Genetica e Biomedica (IRGB), Consiglio Nazionale delle Ricerche, c/o
Cittadella Universitaria di Monserrato, Cagliari, Italy. Department of Biomedical Sciences,
Azienda Ospedaliero-Universitaria di Sassari, Sassari, Italy.
Franco Giulianini
Division of Preventive Medicine, Department of Medicine, Brigham and Women’s Hospital and
Harvard Medical School, Boston, MA 02215, USA.
Frank Kee
Director, UKCRC Centre of Excellence for Public Health, Queens University, Belfast, Northern
Ireland.
Fredrik Karpe
Oxford Centre for Diabetes, Endocrinology and Metabolism, Radcliffe Department of Medicine,
University of Oxford, Oxford, UK. Oxford NIHR Biomedical Research Centre, Oxford
University Hospitals Trust, Oxford, UK.
Frida Renström
Department of Clinical Sciences, Genetic and Molecular Epidemiology Unit, Lund University,
Malmö, Sweden. Department of Biobank Research, Umeå University, Umeå, Sweden.
Gail Davies
Centre for Cognitive Ageing and Cognitive Epidemiology, University of Edinburgh, Edinburgh,
UK. Department of Psychology, University of Edinburgh, Edinburgh, UK.
George Dedoussis
Department of Nutrition and Dietetics, School of Health Science and Education, Harokopio
University, Athens, 17671, Greece.
Georgio Pistis
Istituto di Ricerca Genetica e. Biomedica, Consiglio Nazionale delle Ricerche (CNR),
Monserrato, Cagliari, Italy.
Gina M. Peloso
Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA 02114, USA.
Cardiovascular Research Center, Massachusetts General Hospital, Boston, MA 02114, USA.
Department of Medicine, Harvard Medical School, Boston, MA 02114, USA. Program in
Medical and Population Genetics, Broad Institute, 7 Cambridge Center, Cambridge, MA 02142,
USA. Department of Biostatistics, Boston University School of Public Health, Boston, MA
02118, USA.
Goncalo Abecasis
Center for Statistical Genetics, Department of Biostatistics, University of Michigan, Ann Arbor,
MI 48109, USA.
Gorm B. Jensen
The Copenhagen City Heart Study, Frederiksberg Hospital, Denmark.
Gudny Eiriksdottir
The Icelandic Heart Association, Kopavogur, Iceland.
Hanieh Yaghootkar
Genetics of Complex Traits, University of Exeter Medical School, University of Exeter, Exeter
EX2 5DW, UK.
Harald Grallert
Research Unit of Molecular Epidemiology, Helmholtz Zentrum Muenchen, German Research
Center for Environmental Health, Neuherberg, Germany. Institute of Epidemiologie II,
Helmholtz Zentrum Muenchen, German Research Center for Environmental Health, Neuherberg,
Germany. German Center for Diabetes Research (DZD e.V.), Neuherberg, Germany.
Hayato Tada
Division of Cardiovascular Medicine, Kanazawa University Graduate School of Medicine,
Kanazawa, Japan.
He Zhang
Department of Internal Medicine, Division of Cardiovascular Medicine, University of Michigan,
Ann Arbor, MI 48109, USA.
Heather M. Stringham
Department of Biostatistics and Center for Statistical Genetics, University of Michigan, Ann
Arbor, MI 48109, USA.
Helen R. Warren
Clinical Pharmacology, William Harvey Research Institute, Barts and The London, Queen Mary
University of London, Charterhouse Square, London, EC1M 6BQ, UK.
Hua Tang
Department of Genetics, Stanford University School of Medicine, Stanford, CA 94305, USA.
Ian Ford
University of Glasgow, Glasgow, UK.
Ian J. Deary
Centre for Cognitive Ageing and Cognitive Epidemiology, University of Edinburgh, Edinburgh,
UK. Department of Psychology, University of Edinburgh, Edinburgh, UK.
Ivan Brandslund
Department of Clinical Biochemistry, Lillebaelt Hospital, Vejle, Denmark. Institute of Regional
Health Research, University of Southern Denmark, Odense, Denmark.
J. Wouter Jukema
Department of Cardiology, Leiden University Medical Center, Leiden, the Netherlands.
Interuniversity Cardiology Institute of the Netherlands, Utrecht, The Netherlands.
Jaakko Tuomilehto
Chronic Disease Prevention Unit, National Institute for Health and Welfare, 00271 Helsinki,
Finland. Dasman Diabetes Institute, Dasman 15462, Kuwait. Centre for Vascular Prevention,
Danube-University Krems, 3500 Krems, Austria. Saudi Diabetes Research Group, King
Abdulaziz University, Fahd Medical Research Center, Jeddah 21589, Saudi Arabia.
James G. Wilson
Department of Physiology and Biophysics, University of Mississippi Medical Center, Jackson,
MS 39216, USA.
Jarmo Virtamo
Department of Health, National Institute for Health and Welfare, FI-00271, Helsinki, Finland.
Jaspal S. Kooner
National Heart and Lung Institute, Imperial College London, Hammersmith Hospital Campus,
London, UK. Department of Cardiology, Ealing Hospital NHS Trust, Uxbridge Road, Southall,
Middlesex UB1 3HW, UK. Imperial College Healthcare NHS Trust, London, UK.
Jean Ferrieres
Department of Epidemiology, UMR 1027- INSERM, Toulouse University-CHU Toulouse,
Toulouse, France.
Jean-Claude Tardif
Montreal Heart Institute, Montreal, Quebec, Canada. Université de Montréal, Montreal, Quebec,
Canada.
Jennifer E. Huffman
Framingham Heart Study, Population Sciences Branch, Division of Intramural Research National
Heart Lung and Blood Institute, National Institutes of Health, Framingham, MA 02118, USA.
Jerome I. Rotter
The Institute for Translational Genomics and Population Sciences, Departments of Pediatrics and
Medicine, LABioMed at Harbor-UCLA Medical Center, Torrance, CA 90502, USA.
Jette Bork-Jensen
The Novo Nordisk Foundation Center for Basic Metabolic Research, Faculty of Health and
Medical Sciences, University of Copenhagen, Copenhagen, Denmark.
Joanna M. M. Howson
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
Johanna Jakobsdottir
The Icelandic Heart Association, Kopavogur, Iceland. The University of Iceland, Reykjavik,
Iceland.
Johanna Kuusisto
Institute of Clinical Medicine, Internal Medicine, University of Eastern Finland and Kuopio
University Hospital, 70210 Kuopio, Finland.
Johanne M. Justesen
The Novo Nordisk Foundation Center for Basic Metabolic Research, Faculty of Health and
Medical Sciences, University of Copenhagen, Copenhagen, Denmark.
John C. Chambers
Department of Epidemiology and Biostatistics, School of Public Health, Imperial College
London, Norfolk Place, London W2 1PG, UK. Department of Cardiology, Ealing Hospital NHS
Trust, Uxbridge Road, Southall, Middlesex UB1 3HW, UK. Imperial College Healthcare NHS
Trust, London, UK.
John Danesh
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK. The National Institute for Health Research Blood and Transplant
Unit (NIHR BTRU) in Donor Health and Genomics at the University of Cambridge, UK.
Wellcome Trust Sanger Institute, Genome Campus, Hinxton CB10 1HH, UK.
John M. Connell
Medical Research Institute, University of Dundee, Ninewells Hospital and Medical School,
Dundee, UK.
John M. Starr
Centre for Cognitive Ageing and Cognitive Epidemiology, University of Edinburgh, Edinburgh,
UK. Alzheimer Scotland Dementia Research Centre, University of Edinburgh, Edinburgh, UK.
Jonathan Martin
Generation Scotland, Centre for Genomic and Experimental Medicine, Institute of Genetics and
Molecular Medicine, University of Edinburgh, Edinburgh, UK.
Jose M. Ordovas
Department of Cardiovascular Epidemiology and Population Genetics, National Center for
Cardiovascular Investigation, Madrid 28049, Spain.
Nutrition and Genomics Laboratory, Jean Mayer-USDA Human Nutrition Research Center on
Aging at Tufts University, Boston, MA 02111, USA.
Joshua C. Bis
Cardiovascular Health Research Unit, Department of Medicine, University of Washington,
Seattle, WA 98102, USA
Joshua C. Denny
Departments of Medicine and Biomedical Informatics, Vanderbilt University Medical Center,
Nashville, TN 37203, USA
Kari Kuulasmaa
Department of Health, National Institute for Health and Welfare, FI-00271, Helsinki, Finland.
Kathleen E. Stirrups
Department of Haematology, University of Cambridge, Cambridge, UK. William Harvey
Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary
University of London, London, UK.
Kent D. Taylor
Los Angeles Biomedical Research Institute at Harbor, UCLA, Los Angeles, CA 90048, USA.
Kerrin S. Small
Department of Twin Research and Genetic Epidemiology, King's College London, London, UK.
Konstantin Strauch
Institute of Genetic Epidemiology, Helmholtz Zentrum München - German Research Center for
Environmental Health, Neuherberg, Germany.
Institute of Medical Informatics, Biometry and Epidemiology, Chair of Genetic Epidemiology,
Ludwig-Maximilians-Universität, Munich, Germany.
Kristian Hveem
Department of Public Health and General Practice, HUNT Research Centre, Norwegian
University of Science and Technology.
L. Adrienne Cupples
Department of Biostatistics, Boston University School of Public Health, Boston, MA 02118,
USA.
Lenore J. Launer
Laboratory of Epidemiology and Population Sciences, National Institute on Aging, Bethesda,
MD 20892, USA.
Li An Lin
Institute of Molecular Medicine; the University of Texas Health Science Center at Houston,
Houston, TX 77030, USA.
Lia E. Bang
Department of Cardiology, Rigshospitalet, Copenhagen University Hospital, Copenhagen,
Denmark.
Lorraine Southam
Wellcome Trust Sanger Institute, Hinxton, CB10 1SA, UK. Wellcome Trust Centre for Human
Genetics, University of Oxford, Oxford,OX3 7BN, UK. Wellcome Trust Sanger Institute, The
Morgan Building, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1HH, UK.
Marco Ferrario
Research Centre in Epidemiology and Preventive Medicine – EPIMED, Department of Clinical
and Experimental Medicine, University of Insubria, Via O Rossi 9, 21100 Varese, Italy.
Marianne Benn
Department of Clinical Biochemistry and The Copenhagen General Population Study, Herlev
and Gentofte Hospital, Copenhagen University Hospital, Denmark, and Faculty of Health and
Medical Sciences, University of Denmark, Denmark.
Marie-Pierre Dubé
Montreal Heart Institute, Montreal, Quebec, Canada; 2) Université de Montréal, Montreal,
Quebec, Canada.
Université de Montréal Beaulieu-Saucier Pharmacogenomics Center, Montreal, Quebec, Canada.
Marit E. Jørgensen
Steno Diabetes Center, Gentofte, Denmark; National Institute of Public Health, Southern
Denmark University, Denmark.
Marjo-Riitta Jarvelin
Department of Epidemiology and Biostatistics, School of Public Health, Imperial College
London.
Mark Caulfield
Clinical Pharmacology, William Harvey Research Institute, Queen Mary University of London,
London, EC1M 6BQ, UK. NIHR Barts Cardiovascular Biomedical Research Unit, Queen Mary
University of London, London, EC1M 6BQ, UK.
Mark I. McCarthy
Oxford Centre for Diabetes, Endocrinology and Metabolism, Radcliffe Department of Medicine,
University of Oxford, Oxford, UK. Wellcome Trust Centre for Human Genetics, Nuffield
Department of Medicine, University of Oxford, Oxford, UK. Oxford NIHR Biomedical Research
Centre, Oxford University Hospitals Trust, Oxford, UK.
Mark J. Caulfield
The Barts Heart Centre, William Harvey Research Institute, Queen Mary University of London,
Charterhouse Square, London EC1M 6BQ. Clinical Pharmacology, William Harvey Research
Institute, Barts and The London, Queen Mary University of London, Charterhouse Square,
London, EC1M 6BQ, UK.
Markku Laakso
Institute of Clinical Medicine, Internal Medicine, University of Eastern Finland and Kuopio
University Hospital, 70210 Kuopio, Finland.
Markus Perola
Department of Health, National Institute for Health and Welfare, FI-00271, Helsinki, Finland.
Institute of Molecular Medicine FIMM, University of Helsinki, Finland.
Martina Müller-Nurasyid
Institute of Genetic Epidemiology, Helmholtz Zentrum München - German Research Center for
Environmental Health, Neuherberg, Germany. Department of Medicine I, Ludwig-Maximilians-
Universität, Munich, Germany. DZHK (German Centre for Cardiovascular Research), partner
site Munich Heart Alliance, Munich, Germany.
Mary F. Feitosa
Division of Statistical Genomics, Department of Genetics, Washington University School of
Medicine, St. Louis, MO 63108, USA.
Matt J. Neville
Oxford Centre for Diabetes, Endocrinology and Metabolism, Radcliffe Department of Medicine,
University of Oxford, Oxford, UK.
Megan L. Grove
Human Genetics Center, School of Public Health, The University of Texas School Health
Science Center at Houston, Houston, TX 77030. USA.
Melanie Waldenberger
Institute of Epidemiology II, Helmholtz Zentrum München, German Research Center for
Environmental Health, Neuherberg, 85764, Germany. Research Unit of Molecular
Epidemiology, Helmholtz Zentrum München, German Research Center for Environmental
Health, Neuherberg, 85764, Germany.
Melissa E. Garcia
Laboratory of Epidemiology and Population Sciences, National Institute on Aging, Bethesda,
MD 20892, USA.
Michael Boehnke
Department of Biostatistics and Center for Statistical Genetics, University of Michigan, Ann
Arbor, MI 48109, USA.
Ming Xu
Department of Cardiology, Institute of Vascular Medicine, Peking University Third Hospital,
Key Laboratory of Molecular Cardiovascular Sciences, Ministry of Education, Beijing 100191,
China.
Morris Brown
Clinical Pharmacology Unit, University of Cambridge, Addenbrookes Hospital, Hills Road,
Cambridge CB2 2QQ, UK.
Myriam Fornage
Institute of Molecular Medicine; the University of Texas Health Science Center at Houston,
Houston, TX 77030, USA.
Natalie R. van Zuydam
Medical Research Institute, University of Dundee, UK. WTCHG, Oxford University, Oxford,
Oxfordshire, UK.
Naveed Sattar
University of Glasgow, Glasgow, UK.
Neil Poulter
International Centre for Circulatory Health, Imperial College London, W2 1PG, UK.
Neil R. Robertson
Wellcome Trust Centre for Human Genetics, Nuffield Department of Medicine, University of
Oxford, Oxford, UK. Oxford Centre for Diabetes, Endocrinology and Metabolism, Radcliffe
Department of Medicine, University of Oxford, Oxford, UK.
Nicholas G. D. Masca
Department of Cardiovascular Sciences, University of Leicester, UK; NIHR Leicester
Cardiovascular Biomedical Research Unit, Glenfield Hospital, Leicester, UK.
Nick J. Wareham
MRC Epidemiology Unit, Institute of Metabolic Science, University of Cambridge School of
Clinical Medicine, Cambridge, UK.
Niels Grarup
The Novo Nordisk Foundation Center for Basic Metabolic Research, Faculty of Health and
Medical Sciences, University of Copenhagen, Copenhagen, Denmark.
Nilesh J. Samani
Department of Cardiovascular Sciences, University of Leicester, UK; NIHR Leicester
Cardiovascular Biomedical Research Unit, Glenfield Hospital, UK. BHF Cardiovascular
Research Centre, Glenfield Hospital, Leicester, LE3 9QP, UK.
Oddgeir L. Holmen
Department of Public Health and General Practice, HUNT Research Centre, Norwegian
University of Science and Technology, 7600 Levanger, Norway. St Olav Hospital, Trondheim
University Hospital, 7030 Trondheim, Norway.
Oluf Pedersen
The Novo Nordisk Foundation Center for Basic Metabolic Research, Faculty of Health and
Medical Sciences, University of Copenhagen, Copenhagen, Denmark.
Panos Deloukas
William Harvey Research Institute, Barts and The London School of Medicine and Dentistry,
Queen Mary University of London, London, UK. Princess Al-Jawhara Al-Brahim Centre of
Excellence in Research of Hereditary Disorders (PACER-HD), King Abdulaziz University,
Jeddah 21589, Saudi Arabia.
Patricia B. Munroe
Clinical Pharmacology, William Harvey Research Institute, Queen Mary University of London,
London, EC1M 6BQ, UK. NIHR Barts Cardiovascular Biomedical Research Unit, Queen Mary
University of London, London, EC1M 6BQ, UK.
Paul L. Auer
Zilber School of Public Health, University of Wisconsin-Milwaukee, Milwaukee WI 53201,
USA.
Paul M. Ridker
Division of Preventive Medicine, Brigham and Women’s Hospital, Boston, MA 02215, USA.
Paul W. Franks
Department of Clinical Sciences, Genetic and Molecular Epidemiology Unit, Lund University,
Malmö, Sweden. Department of Nutrition, Harvard T. H. Chan School of Public Health, Boston,
MA 02115, USA. Department of Public Health & Clinical Medicine, Umeå University, Umeå,
Sweden.
Pekka Mäntyselkä
Department of General Medicine, University of Eastern Finland, Kuopio, Finland.
Peter E. Weeke
Department of Medicine, Vanderbilt, University Medical Center, Nashville, TN 37232, USA.
The Heart Centre, Department of Cardiology, Copenhagen University Hospital, Rigshospitalet,
Copenhagen, Denmark.
Peter Sever
International Centre for Circulatory Health, Imperial College London, W2 1PG, UK.
Philippe Amouyel
Department of Epidemiology and Public Health, Institut Pasteur de Lille, Lille, France.
Philippe Frossard
Center for Non-Communicable Diseases, Karachi, Pakistan.
Pia R. Kamstrup
Department of Clinical Biochemistry and The Copenhagen General Population Study, Herlev
and Gentofte Hospital, Copenhagen University Hospital, Denmark, and Faculty of Health and
Medical Sciences, University of Denmark, Denmark.
Praveen Surendran
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
Rainer Raumaraa
Kuopio Research Institute of Exercise Medicine, Kuopio, Finland and Department of Clinical
Physiology and Nuclear Medicine, Kuopio University Hospital, Kuopio, Finland.
Rajiv Chowdhury
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
Robert A. Scott
MRC Epidemiology Unit, Institute of Metabolic Science, University of Cambridge School of
Clinical Medicine, Cambridge, UK.
Robin Young
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
Ruth Frikke-Schmidt
Department of Clinical Biochemistry, Rigshospitalet, Copenhagen, Denmark and Faculty of
Health and Medical Sciences, University of Copenhagen, Denmark.
Ruth J. F. Loos
The Charles Bronfman Institute for Personalized Medicine, Icahn School of Medicine at Mount
Sinai, New York, NY 10029, USA.
The Mindich Child Health and Development Institute, Ichan School of Medicine at Mount Sinai,
New York, NY 10029, USA.
Sandosh Padmanabhan
Institute of Cardiovascular and Medical Sciences, School of Medicine, University of Glasgow,
Glasgow, UK.
Santhi K. Ganesh
Department of Internal Medicine, Division of Cardiovascular Medicine, University of Michigan,
Ann Arbor, MI 48109, USA.
Department of Human Genetics, University of Michigan, Ann Arbor, Michigan 48109, USA.
Sehrish Jabeen
Center for Non-Communicable Diseases, Karachi, Pakistan.
Sekar Kathiresan
Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA 02114, USA.
Cardiovascular Research Center, Massachusetts General Hospital, Boston, MA 02114, USA.
Department of Medicine, Harvard Medical School, Boston, MA 02114, USA. Program in
Medical and Population Genetics, Broad Institute, 7 Cambridge Center, Cambridge, MA 02142,
USA.
Stavroula Kanoni
William Harvey Research Institute, Barts and The London School of Medicine and Dentistry,
Queen Mary University of London, London, UK.
Stella Trompet
Department of Cardiology, Leiden University Medical Center, Leiden, the Netherlands.
Department of Gerontology and Geriatrics, Leiden University Medical Center, Leiden, the
Netherlands.
Stephen S. Rich
Center for Public Health Genomics, University of Virginia, Charlottesville, VA 22903, USA.
Sune F. Nielsen
Department of Clinical Biochemistry and The Copenhagen General Population Study, Herlev
and Gentofte Hospital, Copenhagen University Hospital, Denmark, and Faculty of Health and
Medical Sciences, University of Denmark, Denmark.
Suthesh Sivapalaratnam
Department of Vascular Medicine, Academic Medical Center, University of Amsterdam,
Amsterdam, NL.
Tamara B. Harris
Laboratory of Epidemiology and Population Sciences, National Institute on Aging, Bethesda,
MD 20892, USA.
Tapani Ebeling
Department of Medicine, Oulu University Hospital, Oulu, Finland.
The EPIC-InterAct consortium
Tibor V. Varga
Department of Clinical Sciences, Genetic and Molecular Epidemiology Unit, Lund University,
Malmö, Sweden.
Timo Lakka
Department of Physiology, Institute of Biomedicine, University of Eastern Finland, Kuopio
Campus, Kuopio, Finland and Kuopio Research Institute of Exercise Medicine, Kuopio, Finland.
Timothy D. Spector
Department of Twin Research and Genetic Epidemiology, King's College London, London, UK.
Timothy M. Frayling
Genetics of Complex Traits, University of Exeter Medical School, University of Exeter, Exeter
EX2 5DW, UK.
Tõnu Esko
Broad Institute of the Massachusetts Institute of Technology and Harvard University,
Cambridge, MA 02142, USA. Estonian Genome Center, University of Tartu, Tartu, Estonia.
Division of Endocrinology, Genetics and Basic and Translational Obesity Research, Children’s
Hospital Boston, Boston, MA 02115, USA.
Torben Hansen
The Novo Nordisk Foundation Center for Basic Metabolic Research, Faculty of Health and
Medical Sciences, University of Copenhagen, Copenhagen, Denmark. Faculty of Health
Sciences, University of Southern Denmark, Odense, Denmark.
Torsten Lauritzen
Department of Public Health, Section of General Practice, University of Aarhus, Aarhus,
Denmark.
Veikko Salomaa
Department of Health, National Institute for Health and Welfare, FI-00271, Helsinki, Finland.
Vilmundur Gudnason
The Icelandic Heart Association, Kopavogur, Iceland; The University of Iceland, Reykjavik,
Iceland [email protected] Holtasmari 1, 201 Kopavogur, Iceland.
Wei Gao
Department of Cardiology, Peking University Third Hospital, Key Laboratory of Cardiovascular
Molecular Biology and Regulatory Peptides, Ministry of Health, Beijing 100191, China.
Wei Zhou
Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor,
Michigan 48109, USA.
Weihua Zhang
Department of Epidemiology and Biostatistics, School of Public Health, Imperial College
London, Norfolk Place, London W2 1PG, UK.
Wouter Jukema
Department of Cardiology, Leiden University Medical Center, Leiden, The Netherlands; The
Interuniversity Cardiology Institute of the Netherlands, Utrecht, The Netherlands.
Xiangfeng Lu
Department of Internal Medicine, Division of Cardiovascular Medicine, University of Michigan,
Ann Arbor, MI 48109, USA. State Key Laboratory of Cardiovascular Disease, Fuwai Hospital,
National Center for Cardiovascular Diseases, Chinese Academy of Medical Sciences and Peking
Union Medical College, Beijing, China.
Xueling Sim
Department of Biostatistics and Center for Statistical Genetics, University of Michigan, Ann
Arbor, MI 48109, USA.
Saw Swee Hock School of Public Health, National University of Singapore, Singapore, 117549,
Singapore.
Y. Eugene Chen
Department of Internal Medicine, Division of Cardiovascular Medicine, University of Michigan,
Ann Arbor, Michigan 48109, USA.
Yan Zhang
Department of Cardiology, Peking University First Hospital, Beijing 100034, China.
Yanhua Zhou
Department of Biostatistics, Boston University School of Public Health, Boston, MA 02118,
USA.
Yii-Der Ida Chen
Institute for Translational Genomics and Population Sciences, Los Angeles BioMedical Research
Institute at Harbor-UCLA Medical Center, Torrance, CA 90502, USA.
Yingchang Lu
The Charles Bronfman Institute for Personalized Medicine, Icachn School of Medicine at Mount
Sinai, New York, NY 10029.
Yong Huo
Department of Cardiology, Peking University First Hospital, Beijing 100034, China.
______________________________________________________________________________
CARDIoGRAM Exome Consortium
Nathan O. Stitziel
Cardiovascular Division, Departments of Medicine and Genetics, and the McDonnell Genome
Institute, Washington University School of Medicine, St. Louis, MO 63110, USA.
Aldi T. Kraja
Division of Statistical Genomics, Department of Genetics and Center for Genome Sciences and
Systems Biology, Washington University School of Medicine, St. Louis, MO 63108, USA.
Kathleen E. Stirrups
William Harvey Research Institute, Barts and the London School of Medicine and Dentistry,
Queen Mary University of London, London, UK. Department of Haematology, University of
Cambridge, Cambridge, UK.
Nicholas G. D. Masca
Departments of Cardiovascular Sciences, University of Leicester, Leicester, UK. NIHR Leicester
Cardiovascular Biomedical Research Unit, Glenfield Hospital, Leicester, UK.
Jeanette Erdmann
Institute for Integrative and Experimental Genomics, University of Lübeck, Lübeck, Germany.
DZHK (German Center for Cardiovascular Research), partner site Hamburg/Lübeck/Kiel,
Lübeck, Germany.
Paola G. Ferrario
DZHK (German Center for Cardiovascular Research), partner site Hamburg/Lübeck/Kiel,
Lübeck, Germany. Institut für Med-izinische Biometrie und Statistik, Universität zu Lübeck,
Lübeck, Germany. Dr. rer. nat., Inke R. König, Dr. rer. biol. hum. DZHK (German Center for
Cardiovascular Research), partner site Hamburg/Lübeck/Kiel, Lübeck, Germany. Institut für
Med-izinische Biometrie und Statistik, Universität zu Lübeck (P.G.F., I.R.K., J. Kruppa),
Lübeck, Germany.
Peter E. Weeke
Department of Medicine, Vanderbilt, University Medical Center, Nashville, TN 37232, USA.
The Heart Centre, Department of Cardiology, Copenhagen University Hospital, Rigshospitalet,
Copenhagen, Denmark.
Thomas R. Webb
Departments of Cardiovascular Sciences, University of Leicester, Leicester, UK. NIHR Leicester
Cardiovascular Biomedical Research Unit, Glenfield Hospital, Leicester, UK.
Paul L. Auer
School of Public Heath, University of Wisconsin–Milwaukee, Milwaukee, WI 53201, USA.
Ursula M. Schick
Fred Hutchinson Cancer Research Center, University of Washington, Seattle, WA 98109, USA.
Charles Bronfman Institute for Personalized Medicine, Icahn School of Medicine at Mount Sinai,
New York, NY 10029, USA.
Yingchang Lu
Genetics of Obesity and Related Metabolic Traits Program and the Charles Bronfman Institute
for Personalized Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029,
USA.
He Zhang
Division of Cardiovascular Medicine, University of Michigan, Ann Arbor, Michigan 48109,
USA.
Marie-Pierre Dubé
Département de medicine, and the Montreal Heart Institute, Montreal, Canada.
Anuj Goel
Division of Cardiovascular Medicine, Radcliffe Department of Medicine, and the Wellcome
Trust Centre for Human Genetics, University of Oxford, Oxford, UK.
Martin Farrall
Division of Cardiovascular Medicine, Radcliffe Department of Medicine, and the Wellcome
Trust Centre for Human Genetics, University of Oxford, Oxford, UK.
Gina M. Peloso
Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA 02114, USA.
Cardiovascular Research Center, Massachusetts General Hospital, Boston, MA 02114, USA.
Department of Medicine, Harvard Medical School, Boston, MA 02114, USA. Program in
Medical and Population Genetics, Broad Institute, 7 Cambridge Center, Cambridge, MA 02142,
USA. Department of Biostatistics, Boston University School of Public Health, Boston, MA
02118, USA.
Hong-Hee Won
Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA 02114, USA.
Cardiovascular Research Center, Massachusetts General Hospital, Boston, MA 02114, USA.
Department of Medicine, Harvard Medical School, Boston, MA 02114, USA. Program in
Medical and Population Genetics, Broad Institute, 7 Cambridge Center, Cambridge, MA 02142,
USA. Samsung Advanced Institute for Health Sciences and Tech-nology (SAIHST),
Sungkyunkwan University, Samsung Medical Center, Seoul, South Korea.
Ron Do
Charles Bronfman Institute for Personalized Medicine, Center for Statistical Genetics and
Institute for Genomics and Multiscale Biology, Department of Genetics and Genomic Sciences,
Zena and Michael A. Weiner Cardiovascular Institute, Icahn School of Medicine at Mount Sinai,
New York, NY 10029, USA.
Erik van Iperen
Department of Biostatistics, Academic Medical Center, Amsterdam, the Netherlands.
Stavroula Kanoni
William Harvey Research Institute, Barts and the London School of Medicine and Dentistry,
Queen Mary University of London, London, UK.
Jochen Kruppa
Institut für Med-izinische Biometrie und Statistik, Universität zu Lübeck, Lübeck, Germany.
Department of Medical Statistics, University Medical Center Göttingen, Göttingen, Germany.
Anubha Mahajan
Wellcome Trust Centre for Human Genetics, Nuffield Department of Medicine, University of
Oxford, Oxford, UK.
Robert A. Scott,
University of Cambridge, MRC Epidemiology Unit, Institute of Metabolic Science,
Addenbrooke’s Hospital, Cambridge, UK.
Christina Willenborg
Institute for Integrative and Experimental Genomics, University of Lübeck, Lübeck, Germany.
DZHK (German Center for Cardiovascular Research), partner site Hamburg/Lübeck/Kiel,
Lübeck, Germany.
Peter S. Braund
Departments of Cardiovascular Sciences, University of Leicester, Leicester, UK. NIHR Leicester
Cardiovascular Biomedical Research Unit, Glenfield Hospital, Leicester, UK.
Julian C. van Capelleveen
Department of Vascular Medicine, Academic Medical Center, Amsterdam, the Netherlands.
Alex S.F. Doney
Medical Research Institute, University of Dundee, Ninewells Hospital and Medical School,
Dundee, Scotland, UK.
Louise A. Donnelly
Medical Research Institute, University of Dundee, Ninewells Hospital and Medical School,
Dundee, Scotland, UK.
Rosanna Asselta
Department of Biomedical Sciences, Humanitas University, and Humanitas Clinical and
Research Center, Milan, Italy.
Piera A. Merlini
Division of Cardiology, Niguarda Hospital, Milan, Italy.
Stefano Duga
Department of Biomedical Sciences, Humanitas University, and Humanitas Clinical and
Research Center, Milan, Italy.
Nicola Marziliano
Division of Cardiology, Azienda Ospedaliero–Uni-versitaria di Parma, Parma, Italy.
Associazione per lo Studio della Trombosi in Cardiologia, Pavia, Italy.
Josh C. Denny
Departments of Medicine and Biomedical Informatics, Vanderbilt University Medical Center,
Nashville, TN 37232, USA.
Christian M. Shaffer
Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232, USA.
Nour Eddine El-Mokhtari
Klinik für Innere Medizin, Kreiskrankenhaus Rendsburg, Rendsburg, Germany.
Andre Franke
Institute of Clinical Molecular Biology, Christian-Albrechts-University Kiel, Kiel, Germany.
Omri Gottesman
Charles Bronfman Institute for Personalized Medicine, Icahn School of Medicine at Mount Sinai,
New York, NY 10029, USA.
Stefanie Heilmann
Institute of Human Genetics, and Department of Genomics, Life and Brain Center, University of
Bonn, Bonn, Germany.
Christian Hengstenberg
Deutsches Herzzentrum München, Technische Universität München, Germany. DZHK partner
site Munich Heart Alliance, Germany.
Per Hoffmann
Institute of Human Genetics and Department of Genomics, Life and Brain Center, University of
Bonn, Bonn, Germany.
Oddgeir L. Holmen
HUNT Research Center, Department of Public Health and Gen-eral Practice, Norwegian
University of Science and Technology, Levanger, Norway. St. Olav Hospital, Trondheim
University Hospital, Trondheim, Norway.
Kristian Hveem
HUNT Research Center, Department of Public Health and General Practice, Norwegian
University of Science and Technology, and Department of Medicine, Levanger Hospital, Nord-
Trøndelag Health Trust Norway, Levanger, Norway.
Jan-Håkan Jansson
Department of Public Health and Clinical Medicine, Research Unit Skellefteå, Umeå University,
Umeå, Sweden.
Karl-Heinz Jöckel
Institute for Medical Informatics, Biometry and Epidemiology, University Hospital Essen, Essen,
Germany.
Thorsten Kessler
Deutsches Herzzentrum München, Technische Universität München, Germany.
Jennifer Kriebel
Research Unit of Molecular Epidemiology, Institutes of Epidemiology II, and German Center for
Diabetes Research, Neuherberg, Germany.
Karl L. Laugwitz
DZHK partner site Munich Heart Alliance, I. Medizinische Klinik und Poliklinik, Klinikum
rechts der Isar der Technischen Universität München, Ludwig-Maximilians-Universität, Munich,
Germany.
Eirini Marouli
William Harvey Research Institute, Barts and the London School of Medicine and Dentistry,
Queen Mary University of London, London, UK.
Nicola Martinelli
Department of Medicine, Section of Internal Medicine, University of Verona, Verona, Italy.
Mark I. McCarthy
Wellcome Trust Centre for Human Genetics, and Oxford Centre for Diabetes, Endocrinology
and Metabolism, University of Oxford, and Oxford National Institute for Health Research
Biomedical Research Centre, Churchill Hospital, Oxford, UK.
Natalie R. Van Zuydam
Oxford Centre for Diabetes, Endocrinology and Metabolism, University of Oxford, Oxford, UK.
Christa Meisinger
Institutes of Epidemiology II, Helmholtz Zentrum München–German Research Center for
Environmental Health, Neuherberg, Germany.
Tõnu Esko
Department of Genetics, Harvard Medical School, Boston, MA 02114, USA. Division of
Endocrinology, Boston Children’s Hospital, Boston, MA 02115, USA. Broad Institute of the
Massachusetts Institute of Technology and Harvard, Cambridge, MA 02142, USA. Estonian
Genome Center, University of Tartu, Tartu, Estonia.
Evelin Mihailov
Estonian Genome Center, University of Tartu, Tartu, Estonia.
Stefan A. Escher
Department of Clinical Sciences, Department of Clinical Sciences in Malmo, Lund University
Diabetes Center, Lund University, Lund, Sweden.
Maris Alver
Estonian Genome Center, University of Tartu, Tartu, Estonia. Institute of Molecular and Cell
Biology, Tartu, Estonia.
Susanne Moebus
Institute for Medical Informatics, Biometry and Epidemiology, University Hospital Essen, Essen,
Germany.
Andrew D. Morris
School of Molecular, Genetic and Population Health Sciences, University of Edinburgh Medical
School, Edinburgh, Scotland, UK.
Martina Müller-Nurasyid
Institute of Genetic Epidemiology, Helmholtz Zentrum München - German Research Center for
Environmental Health, Neuherberg, Germany. Department of Medicine I, Ludwig-Maximilians-
Universität, Munich, Germany. DZHK (German Centre for Cardiovascular Research), partner
site Munich Heart Alliance, Munich, Germany.
Majid Nikpay
Ruddy Canadian Cardiovascular Genetics Centre, University of Ottawa Heart Institute, Ottawa,
Canada.
Oliviero Olivieri
Department of Medicine, Section of Internal Medicine, University of Verona, Verona, Italy.
Louis-Philippe Lemieux Perreault
Montreal Heart Institute, Montreal, Canada.
Alaa AlQarawi
King Abdulaziz University, Jeddah, Saudi Arabia.
Neil R. Robertson
Wellcome Trust Centre for Human Genetics, and Oxford Centre for Diabetes, Endocrinology
and Metabolism, University of Oxford, Oxford, UK.
Karen O. Akinsanya
Merck Sharp & Dohme, Rahway, NJ 07065, USA.
Dermot F. Reilly
Merck Sharp & Dohme, Rahway, NJ 07065, USA.
Thomas F. Vogt
Merck Sharp & Dohme, Rahway, NJ 07065, USA.
Wu Yin
Merck Sharp & Dohme, Rahway, NJ 07065, USA.
Folkert W. Asselbergs
Institute of Cardiovascular Science, Faculty of Population Health Sciences, University College
London, London, UK.
ICIN-Netherlands Heart Institute, Utrecht, the Netherlands.
Charles Kooperberg
Fred Hutchinson Cancer Research Center, University of Washington, Seattle, WA 98109, USA.
Rebecca D. Jackson
Division of Endocrinology, Diabetes, and Metabolism, Department of Medicine, Ohio State
University, Columbus, OH 43210, USA.
Eli Stahl
Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029,
USA.
Konstantin Strauch
Institute for Medical Informatics, Biometry and Epidemiology, Chair of Genetic Epidemiology,
Ludwig-Maximilians-Universität, Munich, Germany. Institute for Genetic Epidemiology (M.M.-
N., K.S.), Helmholtz Zentrum München–German Research Center for Environmental Health,
Neuherberg, Germany.
Tibor V. Varga
Department of Clinical Sciences, Lund University Diabetes Center, Lund University, Lund,
Sweden.
Melanie Waldenberger
Research Unit of Molecular Epidemiology and Institute of Epidemiology II, Helmholtz Zentrum
München–German Research Center for Environmental Health, and German Center for Diabetes
Research, Neuherberg, Germany.
Lingyao Zeng
Deutsches Herzzentrum München, Technische Universität München, Germany.
Chunyu Liu
Framingham Heart Study, Framingham, MA 01702, USA.
Population Sciences Branch, National Heart, Lung, and Blood Institute, Bethesda, MD 20892,
USA.
Georg B. Ehret
Cardiology Division, Department of Medicine, Geneva University Hospital, Geneva,
Switzerland.
Center for Complex Disease Genomics, McKusick–Nathans Institute of Genetic Medicine, Johns
Hopkins University School of Medicine, Baltimore, MD 21205, USA.
Christopher Newton-Cheh
Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA 02114, USA.
Cardiovascular Research Center, Massachusetts General Hospital, Boston, MA 02114, USA.
Department of Medicine, Harvard Medical School, Boston, MA 02114, USA. Program in
Medical and Population Genetics, Broad Institute, 7 Cambridge Center, Cambridge, MA 02142,
USA.
Daniel I. Chasman
Division of Preventive Medicine, Department of Medicine, Brigham and Women’s Hospital and
Harvard Medical School, Boston, MA 02215, USA.
Rajiv Chowdhury
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
Marco Ferrario
Research Centre in Epidemiology and Preventive Medicine – EPIMED, Department of Clinical
and Experimental Medicine, University of Insubria, Via O Rossi 9, 21100 Varese, Italy.
Ian Ford
Robertson Centre for Biostatistics, University of Glasgow, Glasgow, UK.
J. Wouter Jukema
Department of Cardiology, Leiden University Medical Center, Leiden, The Netherlands; The
Interuniversity Cardiology Institute of the Netherlands, Utrecht, The Netherlands.
Frank Kee
Director, UKCRC Centre of Excellence for Public Health, Queens University, Belfast, Northern
Ireland.
Kari Kuulasmaa
Department of Health, National Institute for Health and Welfare, FI-00271, Helsinki, Finland.
Børge G. Nordestgaard
Department of Clinical Biochemistry and The Copenhagen General Population Study, Herlev
and Gentofte Hospital, Copenhagen University Hospital, Denmark, and Faculty of Health and
Medical Sciences, University of Denmark, Denmark.
Markus Perola
Department of Health, National Institute for Health and Welfare, FI-00271, Helsinki, Finland.
Institute of Molecular Medicine FIMM, University of Helsinki, Finland.
Danish Saleheen
Department of Biostatistics and Epidemiology, Perelman School of Medicine, University of
Pennsylvania, Philadelphia, PA 19104, USA. Centre for Non-Communicable Diseases, Karachi,
Pakistan. Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care,
University of Cambridge, Cambridge, UK.
Naveed Sattar
University of Glasgow, Glasgow, UK.
Neil Poulter
International Centre for Circulatory Health, Imperial College London, W2 1PG, UK.
Praveen Surendran
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
David Tregouet
Sorbonne Université, UPMC Univ Paris 06, ICAN Insti-tute for Cardiometabolism and
Nutrition, Paris, France.
Robin Young
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
Joanna M.M. Howson
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK.
Adam S. Butterworth
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK. The National Institute for Health Research Blood and Transplant
Unit (NIHR BTRU) in Donor Health and Genomics at the University of Cambridge, UK.
John Danesh
Cardiovascular Epidemiology Unit, Department of Public Health and Primary Care, University
of Cambridge, Cambridge, UK. The National Institute for Health Research Blood and Transplant
Unit (NIHR BTRU) in Donor Health and Genomics at the University of Cambridge, UK.
Wellcome Trust Sanger Institute, Genome Campus, Hinxton CB10 1HH, UK.
Diego Ardissino
Division of Cardiology, Azienda Ospedaliero–Uni-versitaria di Parma, Parma, Italy.
Associazione per lo Studio della Trombosi in Cardiologia, Pavia, Italy.
Erwin P. Bottinger
The Charles Bronfman Institute for Personalized Medicine, Icahn School of Medicine at Mount
Sinai, New York, NY 10029, USA.
Raimund Erbel
Institute for Medical Informatics, Biometry and Epidemiology, University Hospital Essen, Essen,
Germany.
Paul W. Franks
Department of Clinical Sciences, Genetic and Molecular Epidemiology Unit, Lund University,
Malmö, Sweden. Department of Nutrition, Harvard T. H. Chan School of Public Health, Boston,
MA 02115, USA. Department of Public Health & Clinical Medicine, Umeå University, Umeå,
Sweden.
Domenico Girelli
Department of Medicine, Section of Internal Medicine, University of Verona, Verona, Italy.
Alistair S. Hall
Leeds Institute of Genetics, Health and Therapeutics, University of Leeds, Leeds, UK.
G. Kees Hovingh
Department of Vascular Medicine, Academic Medical Center, Amsterdam, the Netherlands.
Adnan Kastrati
Deutsches Herzzentrum München, Technische Universität München, Germany.
Wolfgang Lieb
Institute of Epidemiology and Biobank popgen (W.L.), Christian-Albrechts-University Kiel,
Kiel, Germany.
Thomas Meitinger
Institute of Human Genetics (T.M.), Technische Universität München, Germany. DZHK partner
site Munich Heart Alliance (C.H., K.L.L., M.M.-N., T.M., A.P., H.S.), I. Medizinische Klinik
und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Germany.
Institute of Human Genetics, Helmholtz Zentrum München–German Research Center for
Environmental Health, Neuherberg, Germany.
William E. Kraus
Duke Molecular Physiology Institute and Division of Cardiology, Department of Medicine,
Duke University, Durham, NC 27710, USA.
Svati H. Shah
Duke Molecular Physiology Institute and Division of Cardiology, Department of Medicine,
Duke University, Durham, NC 27710, USA.
Ruth McPherson
Ruddy Canadian Cardiovascular Genetics Centre, University of Ottawa Heart Institute, Ottawa,
Canada.
Marju Orho-Melander
Department of Clinical Sciences in Malmo, Lund University Diabetes Center, Lund University,
Clinical Research Center, Skåne University Hospital, Malmo, Sweden.
Olle Melander
Department of Clinical Sciences in Malmo, Lund University Diabetes Center, Lund University,
Clinical Research Center, Skåne University Hospital, Malmo, Sweden.
Andres Metspalu
Estonian Genome Center, University of Tartu, and Institute of Molecular and Cell Biology,
Tartu, Estonia.
Colin N.A. Palmer
Medical Research Institute, University of Dundee, Ninewells Hospital and Medical School,
Dundee, UK.
Annette Peters
Institute for Epidemiology II, Helmholtz Zentrum München, Neuherberg, Germany.
German Center for Cardiovascular Disease Research, partner-site Munich, Munich, Germany.
German Center for Diabetes Research, Neuherberg, Germany.
Daniel J. Rader
Departments of Medicine and Genetics and the Cardiovascular Institute, Perelman School of
Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA.
Muredach P. Reilly
Cardiovascular Institute, Perelman School of Medicine, University of Pennsylvania,
Philadelphia, PA 19104, USA.
Ruth J.F. Loos, Ph.D.,
The Charles Bronfman Institute for Personalized Medicine, Icahn School of Medicine at Mount
Sinai, New York, NY 10029, USA.
The Mindich Child Health and Development Institute, Ichan School of Medicine at Mount Sinai,
New York, NY 10029, USA.
Alex P. Reiner
Department of Epidemiology, University of Washington, Seattle WA 98195, USA. Division of
Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle WA 98195, USA.
Dan M. Roden
Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232, USA.
Jean-Claude Tardif
Montreal Heart Institute, Montreal, Quebec, Canada. Université de Montréal, Montreal, Quebec,
Canada.
John R. Thompson
Departments of Cardiovascular Sciences and Health Sciences, University of Leicester, and NIHR
Leicester Cardiovascular Biomedical Research Unit, Glenfield Hospital Leicester, UK.
Nicholas J. Wareham
University of Cambridge, MRC Epidemiology Unit, Institute of Metabolic Science,
Addenbrooke’s Hospital, Cambridge, UK.
Hugh Watkins
Division of Cardiovascular Medicine, Radcliffe Department of Medicine, and the Wellcome
Trust Centre for Human Genetics, University of Oxford, Oxford, UK.
Cristen J. Willer
Department of Internal Medicine, Division of Cardiovascular Medicine, University of Michigan,
Ann Arbor, Michigan 48109, USA.
Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor,
Michigan 48109, USA. Department of Human Genetics, University of Michigan, Ann Arbor,
Michigan 48109, USA.
Panos Deloukas
William Harvey Research Institute, Barts and The London School of Medicine and Dentistry,
Queen Mary University of London, London, UK. Princess Al-Jawhara Al-Brahim Centre of
Excellence in Research of Hereditary Disorders (PACER-HD), King Abdulaziz University,
Jeddah 21589, Saudi Arabia.
Nilesh J. Samani
Department of Cardiovascular Sciences, University of Leicester, UK. NIHR Leicester
Cardiovascular Biomedical Research Unit, Glenfield Hospital, UK. BHF Cardiovascular
Research Centre, Glenfield Hospital, Leicester, LE3 9QP, UK.
Heribert Schunkert
Deutsches Herzzentrum München, Technische Universität München, Germany. DZHK partner
site Munich Heart Alliance, Ludwig-Maximilians-Universität, Munich, Germany.
Sekar Kathiresan
Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA 02114, USA.
Cardiovascular Research Center, Massachusetts General Hospital, Boston, MA 02114, USA.
Department of Medicine, Harvard Medical School, Boston, MA 02114, USA. Program in
Medical and Population Genetics, Broad Institute, 7 Cambridge Center, Cambridge, MA 02142,
USA.
Materials and Methods
Subject Identification and Ascertainment
Individuals with high HDL-C levels above the 95th percentile for age and sex were
systematically recruited. For this study 341 individuals of European ancestry with HDL-C > 95th
percentile were selected for targeted sequencing, as were 407 individuals of European ancestry
with low HDL-C levels below the 25th percentile for age and sex. Briefly, using customized
hybrid capture (Agilent) baits, we targeted and enriched for sequencing the exons of the ~990
genes located within 300 kb of each of the 95 loci with significant associations (P < 5 × 10–8)
with plasma lipid levels identified by the Global Lipids Genetics Consortium as of 2010 (22).
We performed next-generation sequencing using Illumina Genome Analyzers at the Broad
Institute as described previously (40). Base pairs were called and sequencing reads were aligned
to the human genome reference GRCh37 (hg19), and sequencing metrics were processed using
the Picard pipeline with an output of Binary Alignment Map (BAM) files.
The Genome Analysis Toolkit Unified Genotyper was used to genotype all variant sites,
calculate initial quality control metrics, and filter based on these values, and variants were
annotated using SnpEFF (41). Variants were indexed per sample in Variant Call Format (VCF)
files. Genotypes for each individual were computed at each site and tabulated.
Additionally, SCARB1 mutation carriers were identified by genotyping subjects with high
vs. low HDL-C using the Exome Chip (HumanExome BeadChip v1.0, Illumina, Inc., San Diego,
CA). The Exome Chip contains >240,000 coding SNPs derived from all mutations found >2
times across >1 data set among 23 separate data sets comprising a total of >12,000 individual
exome and whole genome sequences. The P376L variant is included. In total, 353 high HDL-C
males (HDL-C ≥ 70 mg/dL), 747 high HDL-C females (HDL-C ≥80 mg/dL), 1106 low HDL-C
males (HDL-C ≤40 mg/dL), and 573 low HDL-C females (HDL-C ≤50 mg/dL) were genotyped
using the Exome Chip. Subject samples were drawn from previous research studies conducted in
our laboratory. After removing subjects from analysis for which demographic covariates were
not available, there remained 805 subjects with high HDL-C and 989 subjects with low HDL-C
analyzed for association of SCARB1 P376L allele frequency with HDL-C.
To confirm the presence of the P376L mutation in carriers, a nearby region of 995 bp of
SCARB1 was amplified by PCR using the following primers: forward:
TGGTTTGGTTGGTCAGTGGCG, reverse: AGGGCTGCCTCCAGCTCACAT; and the
following PCR conditions: 95ºC, 2 min; (95ºC, 30 s; 62.6ºC, 30 s; 72ºC; 100.0 s) repeat 29
times; 72ºC, 5 min; 4ºC forever. PCR products were purified using a QIAquick PCR Purification
Kit (Qiagen, Germantown, MD, USA) and sequenced by Sanger sequencing (42) by Genewiz
Inc (South Plainfield, NJ, USA). Sequences were compared with SCARB1 NCBI reference
sequence NG_028199.1 using Sequencher (Gene Codes, Ann Arbor, MI, USA).
In silico analysis
To predict the effect of the P376L mutation on SR-BI protein structure and function we
used the publicly available algorithms Condel and Raptor X (43-46). Condel generated a
“consensus deleteriousness” score, obtained by combining 3 prediction algorithms (PolyPhen-2,
MutationAssessor, and SIFT). Raptor X was used to predict effects on local secondary structure
of the SR-BI due to the P376L variant. Protein alignment data were generated by MacVector
(MacVector, Inc., Cary, NC) using a Gonnet similarity matrix with open gap penalty = 10 and
extended gap penalty = 0.1.
DNA cloning and adeno-associated virus generation
The coding sequence of SR-BI (CCDS 9259.1) was obtained from Thermo Scientific
(cDNA clone MGC:120767 IMAGE:7939577) in a pCR4-TOPO cloning vector (Invitrogen).
The P376L and the P297S mutations were inserted in the sequence by site directed mutagenesis
using the Quickchange II site directed mutagenesis kit (Agilent technologies) and following
primers:
P376L-F 5'-cctggacatccacctggtcacgggaatcc-3'
P376L-R 5'-ggattcccgtgaccaggtggatgtccagg-3'
P297S-F 5'-ggtgtttgaaggcatctccacctatcgcttcgt-3'
P297S-R 5'-acgaagcgataggtggagatgccttcaaacacc-3'
The wild type and the mutated coding sequences were then amplified by PCR and subcloned into
a pcDNA3.1/V5-His TOPO expression plasmid (Invitrogen) according to manufacturer`s
instructions. For in vivo studies, SCARB1 WT and P376L cDNA sequences were amplified by
PCR using the following primers containing KpnI and NotI sites, and then subcloned by
KpnI/NotI double digestion followed by ligation into adeno-associated virus serotype 8 vector
(AAV8) containing the liver-specific thyroxine-binding globulin (TBG) promoter provided by
the University of Pennsylvania Vector Core (47-52). Virus production, purification and
quantification were carried out by the core facility.
Radioactive labeling of HDL
Total human HDL (1.063<d<1.21 g/ml) and HDL3 (1.125<d<1.21 g/ml) were obtained
by sequential ultracentrifugation as described before (53). HDL was labeled with 125I by a
modification of the iodine monochloride method for the binding experiment at 4°C and they
were labeled with 125I-tyramine-cellobiose (125I-TCB) for all the other experiments (54). To
further label 125I-TCB-HDL with 3H-cholesteryl-ether (3H-CE), 500 μCi of 3H-CE resuspended
in 50 μl of ethanol were added to a solution containing heat-inactivated human lipoprotein
deficient serum (200 mg protein) and iodinated HDL (6 mg protein). The solution was incubated
overnight at 37°C with gentle shaking, followed by reisolation of the dual-labeled HDL by
sequential ultracentrifugation.
Cell culture and in vitro assays
COS7 cells were cultured in Dulbecco modified Eagle medium (DMEM) supplemented
with 10% fetal bovine serum at 37°C in a humidified 5% CO2 incubator and were passaged using
trypsin. For selective cholesterol uptake COS7 cells were plated at a density of 3 × 104 cells/cm2
in 6 well plates. One day following plating (Day 1), cells were transfected using Lipofectamine
2000 (4 μg DNA/well, 3:1 Lipofectamine:DNA ratio) with a pcDNA3.1/V5-His-TOPO plasmid
encoding either SCARB1 WT, SCARB1 P376L, or SCARB1 P297S cDNAs. One group received a
mock transfection with plasmid containing no cDNA. Each experimental group was tested in
quintuplicate. On Day 2, culture medium was changed to DMEM 0.5% BSA containing 20
μg/ml of 3H-cholesteryl hexadecyl ether/125I-TCB-labeled HDL3 and incubated for 3 hours at
37°C. In one well per plate a 40-fold excess of nonradiolabeled (“cold”) HDL was added to a
final concentration of 800 μg/ml. After incubation cells were washed with PBS and lipids were
extracted in two consecutive steps using a 3:2 hexane-isopropanol mixture. After drying, proteins
were solubilized using 2 ml of 0.1N NaOH. The hexane/isopropanol fraction was dried under
nitrogen, resuspended in 600 μl of toluene, and counted separately in scintillation and gamma
counters. The NaOH fraction was counted in the gamma counter and measured for protein
concentration using a Lowry protein assay (55). Counts from wells with 40-fold excess of cold
HDL (non receptor-specific counts) were subtracted from counts from other wells to calculate
the receptor-specific activity internalized. Data analysis was performed as previously described
(56), with the following modification: 125I activity (counts per minute) in the NaOH fraction
were considered as cell-surface associated lipoproteins (it has been shown previously that when
performing this experiment under similar conditions, the fraction of cell associated counts that is
trichloroacetic acid-soluble is approximately 5%) (57). A negligible amount of 125I counts were
found in the hexane-isopropanol fraction. SR-BI protein expression was determined by western
blotting. 10 μg of protein from cellular lysates determined by Lowry assay from each sample was
loaded in NuPAGE gels (Life Technologies) using denaturing and reducing conditions for one-
dimensional SDS-PAGE using MOPS running buffer. Proteins were separated by electrophoresis
for approx. 1 hour, transferred to nitrocellulose membranes, blocked for 2 hours at room
temperature using 5% fat-free milk in PBS (0.05% tween 20). Membranes were then incubated
with anti-SR-BI antibody (NB400-131, Novus, 1:500 dilution in 5% milk-PBS-tween) at room
temperature for 1 hour, washed three times with PBS-tween, and then with anti-goat IgG-HRP
conjugate (700-035-147, Jackson Immunoresearch, 1:2500 dilution in 5% milk-PBS-tween) at
room temperature for 1 hour. Proteins were visualized after washing again after secondary
antibody incubation using Luminata Crescendo chemiluminscent agent (Millipore). Films were
incubated with membranes after chemiluminescent reagent in the dark typically for 30 s, 1 min, 2
min, and 5 min exposures for each membrane. Human β-actin was used as a loading control and
was visualized after incubation with mouse anti-actin primary antibody (sc-81178, Santa Cruz,
1:20 dilution in 5% milk-PBS-tween) and then goat anti-mouse IgG HRP (sc-2302, Santa Cruz,
1:1000 in 5% milk-PBS-tween).
The binding of 125I-HDL3 at 4°C to COS7 cells was measured using a modification of the
method from Nieland et al (58). Briefly, COS7 cells were seeded at a concentration of 3 × 104
cells/cm2 in 12 well plates. The next day, cells were transfected using Lipofectamine 2000 (1.6
μg DNA/well, 3:1 Lipofectamine:DNA ratio) with a pcDNA3.1/V5-His-TOPO plasmid
encoding either SCARB1 WT, SCARB1 P376L, or SCARB1 P297S cDNAs. An additional plate
of cells was transfected with a plasmid encoding GFP (pAAV-CB-EGFP), which was used as a
control. On the following day, cell plates were precooled for 30 min on ice, washed with cold
DMEM and then exposed for 2 hours to the assay medium (DMEM, 1% P/S, 0.5%BSA +
lipoproteins) at 4°C. After the incubation, cells were washed twice with ice-cold PBS containing
2 mg/ml of bovine serum albumin (BSA) and a third time with PBS without BSA. Cells were
then lysed in 0.1N NaOH. Lysates were used for 125I counting and for measuring protein content
using a Lowry assay. In parallel to this, cells were seeded in 10 cm plates, transfected as
described above and lysed after 24 hours in RIPA buffer to check SR-BI protein expression by
immunoblotting for SR-BI as described above using 10 μg of protein from cellular lysates.
Cell surface biotinylation assay
COS7 cells were seeded and transfected as described above in 175 cm2 flasks. Twenty-
four hours after transfection, cell-surface-associated proteins were isolated using the Pierce Cell
Surface Protein Isolation Kit (Pierce Biotechnology Inc., Rockford, IL) according to the
manufacturer`s instructions. After lysis, protein concentration was determined by bicinchoninic
acid (BCA) assay and the same amount of proteins was loaded on NeutrAvidin Agarose beads to
isolate biotinylated proteins. After multiple washing steps, proteins were eluted from the beads
and loaded on a 10% Bis-Tris polyacrylamide gels for western blotting. Blots for β-actin and
Na+/K+-ATPase were used as intracellular and surface-associated controls, respectively.
We generated induced pluripotent stem cells (iPSC) from peripheral blood mononuclear cells
(PBMCs) and differentiated them into hepatocyte-like cells as described elsewhere (24-26, 59,
60) After complete differentiation of iPSCs to hepatocyte-like cells (approx. 20–22 days from
initiation of differentiation), we performed selective cholesterol uptake as described above.
For Endoglycosidase H sensitivity assays, 100 μg of liver homogenates from mice
transduced with human SCARB1 or Null AAV8 vectors were treated with Endoglicosidase H
(New England Biolabs, Ipswich, MA), Sialidase A, or a combination of Sialidase A and PNGase
F (Prozyme, Hayward, CA) according to manufacturer’s instructions. 30 μg of digestion products
were then loaded on a 10% Bis-Tris polyacrylamide gel for western blotting as described above.
Non-treated homogenates were used as controls. Endoglycosidase H sensitivity assays were also
performed using lysates from transfected COS7 cells (10 μg each lysate) and from iPSC-derived
hepatocyte-like cells (50 μg each lysate). In these experiments, cell lysate in RIPA buffer plus
Complete Protease Inhibitor Cocktail (Roche) was used.
AAV-mediated overexpression of SCARB1 WT and P376L in Scarb1 KO mice
AAV serotype 8 vectors expressing SCARB1 WT or P376L were expressed in Scarb1 KO
mice, which were subsequently studied for effects on lipoprotein metabolism. Male Scarb1 KO
mice (6 per group) were weighed, bled through retro-orbital bleeding and injected with 1012
genome copies (GC) of AAV-SCARB1-WT, AAV-SCARB1-P376L, or Null vector via
intraperitoneal injection. Mice were fasted for 5 hours, weighed, and bled again at 12 days after
injection. Plasma lipid levels were determined as described above. At 2 weeks after injection,
HDL kinetics using radiolabeled human HDL was measured (61). Briefly, mice were injected via
tail-vein injection with a mixture of 125I-tyramine-cellobiose-HDL (3 × 106 cpm/mouse) and 3H-
cholesteryl-ether (CE)-HDL (3 × 106 cpm/mouse) and bled at 2 min post-injection and 1, 3, 6, 9,
and 24 hours. Plasma 3H and 125I activity at each time point were determined by using
scintillation counting and gamma counting, respectively. At 24 hours post-injection of
radiolabeled HDLs, mice were weighed, anesthetized, terminally bled, and sacrificed. Livers
were lysed in phosphate buffered saline (PBS), and 3H and 125I were counted in the lysates to
determine liver-associated counts. Liver-associated counts were then expressed as micrograms of
HDL component/mg of liver to allow a direct comparison between liver associated 3H and 125I
counts. Selective cholesterol uptake was calculated as the difference between liver-associated 3H
counts and liver associated 125I counts expressed as micrograms of HDL component/mg of liver.
SR-BI protein expression levels in liver homogenates were determined by western blot as
described above using 30 μg of protein from tissue lysates followed by densitometric analysis
performed with ImageJ (U.S. National Institutes of Health, Bethesda, MD) (62).
Subject selection and study visit
Carriers of the P376L variant identified through next-generation sequencing were
recruited through a comprehensive recall protocol approved by the institutional review board of
the Perelman School of Medicine at the University of Pennsylvania, Philadelphia. Additionally,
control subjects were chosen from a database of previous participants in studies conducted in our
laboratory. All subjects recruited gave informed consent. Two groups of controls were selected:
those having HDL-C levels between the 25th and the 75th percentile for age and sex (normal
HDL-C control group) and those with HDL-C levels greater than the 75th percentile for age and
sex but confirmed to lack the P376L variant (high HDL-C control group). The two control
groups were selected to match on aggregate the age, gender and race of the carrier group. Study
visits were performed in the Clinical and Translational Research Center (CTRC) facility at the
Perelman School of Medicine at the University of Pennsylvania. Venous blood after overnight
fasting was drawn from each subject to measure a comprehensive metabolic panel, complete
blood count, standard urinalysis, reticulocyte count, T- and B-cell counts, antinuclear antibody
screen, anti double-stranded DNA antibody screen, and anti-neutrophil cytoplasmic antibody
screen, which were measured by the William Pepper Laboratory of the Hospital of the University
of Pennsylvania. A comprehensive lipid panel {total cholesterol [TC], VLDL cholesterol
[VLDL-C], LDL cholesterol [LDL-C], HDL-C, triglycerides [TG], lipoprotein(a) [Lp(a)], and
apolipoproteins A-I, A-II, C-II, C-III, and E [ApoA-1, ApoA-II, ApoC-II, ApoC-III, ApoE]}was
also performed by the Lipid Research Laboratory of the Hospital of the University of
Pennsylvania per standard protocols as described previously (63). HDL-C and LDL-C levels
were measured both directly and after precipitation with phosphotungstic acid (PTA).
Lipoproteins were separated by fast protein liquid chromatography on a Superose 6 column as
described previously (64).
Blood was also collected in BD Vacutainer CPT Cell Preparation tubes (BD, Franklin
Lakes, NJ, USA) for PBMC isolation and storage and in sodium citrate tubes for platelet
isolation and testing. Platelet aggregation studies (PAS) were performed at the Translational
Core Laboratory (TCL) using a photometric aggregometer (Biodata Corp, Horsham, PA).
To induce platelet aggregation the following stimuli were used at the concentrations
reported in brackets: arachidonic acid (200, 250, 300, 400, 500 mg/ml), collagen (0.04, 0.08,
0.12, 0.16, 0.2 mg/ml), ADP (0.625, 1.25, 2.5, 5, 10 mM), TRAP (1, 2, 3, 4, 5 μM). Arachidonic
acid, collagen, and ADP were obtained from Biodata Corp. (Horsham, PA); TRAP was obtained
from Sigma Chemical Corp (St. Louis, MO). To correct for possibly unreported intake of drugs
with antiaggregant action, subjects whose platelets failed to reach 95% aggregation with 500
mg/ml of arachidonic acid were excluded from the analysis. Additional blood was also drawn
and frozen for later batch measurement of adrenocorticotropic hormone (ACTH), cortisol,
estradiol, progesterone, luteinizing hormone (LH), follicle-stimulating hormone (FSH), and
testosterone also by the TCL using standard radioimmunoassay methods (“Coat-A-Count”) from
SIEMENS Healthcare Diagnostics. Subjects taking exogenous steroids were excluded from the
analysis. Study subjects were also given the option of performing a 24-hour urine collection
according to standard methods the day before their visit or on a later date. Collected urine was
frozen in single-use aliquots for batch measurement of cortisol by the Translational Core
Laboratory as per standard protocols. The acquisition of carotid intima-media thickness (IMT)
ultrasound images was performed according to a standardized protocol, adopted from the
Atherosclerosis Risk in Communities (ARIC) study (65) and as per American Society of
Echocardiography and Society for Vascular Medicine Guidelines for IMT analysis (66). The
scanner used was a Siemens Sequoia (Mountain View, CA, USA) with a 9 Linear probe and a
custom designed carotid IMT preset. One heterozygous subject who was unable to travel to the
study site had blood drawn locally. These samples were shipped to the study site for the lipid
panel and autoimmune tests; the subject also sent the results of a recent comprehensive metabolic
panel and complete blood count. Data from clinical phenotyping studies were collected and
managed using REDCap (Research Electronic Data Capture) electronic data capture tools hosted
at the Perelman School of Medicine at the University of Pennsylvania (67).
Platelet separation and cholesterol measurement
Approximately 4.5 ml of blood was drawn from each subject into tubes containing 25 g
sodium citrate, 8 g citric acid and 500 ml H2O2. Tubes were centrifuged using a tabletop
centrifuge at 200xg for 15 min. at room temperature. Platelet-rich plasma (PRP) was collected as
supernatant from this spin and was centrifuged at 900g for 5 min. The pellet from this spin was
resuspended in 8 ml 1xPBS and centrifuged again at 900g for 5 min. Platelet pellets were
collected and resuspended in 200 μl 1 × PBS and stored at –20°C. For measurement of
cholesterol, platelet extracts were dried using a centrifugal evaporator (Genevac). D7-cholesterol
(Cat. No. 700041; Avanti Polar Lipids, Inc.) was added to each sample as an internal standard.
Lipids were extracted by addition of 1 ml chloroform:methanol (2:1) at 4°C for 2 hours. The
nonpolar phase from the platelet extracts was collected and dried through centrifugal evaporation
along with cholesterol standards (1.0–100.0 nmol) containing equivalent amounts of D7-
cholesterol internal standard. All samples were derivativized using pentaflurobenzoyl chloride
and extracted with petroleum ether before measurement by gas chromatography-mass
spectrometry using negative chemical ionization. Peak areas for cholesterol and D7-cholesterol
from platelet extracts were compared to that from the standard curve generated from cholesterol
standards to yield cholesterol content in each sample. For platelet protein measurement, aqueous
extracts from chloroform:methanol extraction of platelet samples were spun to remove excess
methanol and dried using centrifugal evaporation and then resuspended in 200 μl RIPA buffer
containing 0.1 N NaOH and heated at 55°C for approximately 24 hours with periodic vortexing.
Protein concentrations from these extracts were measured by a Lowry assay (55) (Pierce).
Cholesterol measurements for each sample were then normalized to the corresponding protein
concentrations.
Fractionation of plasma lipoproteins from study subjects
VLDL, LDL, and HDL subfractions were isolated from EDTA plasma by single step,
isopycnic non-denaturing density gradient ultracentrifugation based on a modification of the
method developed by Chapman et al. as previously described(68, 69). Using this procedure, five
subfractions of LDL (LDL1, d 1.019–1.023 g/ml; LDL2, d 1.023–1.029 g/ml; LDL3, d 1.029–
1.039 g/ml; LDL4, d 1.039–1.050 g/ml; and LDL5, d 1.050–1.063 g/ml) were isolated, followed
by two subfractions of large, light HDL2 (HDL2b, d 1.063–1.087 g/ml and HDL2a, d 1.088–1.110
g/ml), and three subfractions of small, dense HDL3 (HDL3a, d 1.110–1.129 g/ml; HDL3b, d
1.129–1.154 g/ml; and HDL3c, d 1.154–1.170 g/ml). Total HDL was prepared as a mixture of
HDL2b, 2a, 3a, 3b and 3c subfractions at their equivalent plasma concentrations.
Protein quantification and chemical composition of HDL
Overall chemical composition of HDL subfractions was assessed using commercially
available enzymatic kits (total protein: Thermo Scientific, Villebon-sur-Yvette, France; total
cholesterol, free cholesterol, phospholipids: DiaSys, Holzheim, Germany; triglycerides:
Biomérieux, Marcy l’Etoile, France). Cholesteryl ester (CE) concentration was calculated by
multiplying the difference between total and free cholesterol concentrations by 1.67. Total
lipoprotein mass was calculated as the sum of total protein, CE, FC, PL and TG and expressed as
plasma concentrations (mg/dl). HDL apoplipoproteins (ApoA-I, ApoA-II, ApoC-III) were
quantified using automated enzymatic methods (Konelab, Thermo Scientific, Waltham, MA,
USA).
Cellular cholesterol efflux capacity of HDL
The cholesterol efflux capacity of total HDL was assessed in a human THP-1 monocytic
cell line (ATCC, Manassas, VA, USA) as previously reported(70). THP-1 monocytes were
cultured at 37°C and 5% CO2 in RPMI 1640 media with 10% FBS, 2 mM glutamine, 100 µg/ml
penicillin, and 100 µg/ml streptomycin (complete media) using standard cell culture procedures
and differentiated into macrophage-like cells using 50 ng/ml phorbol 12-myristate 13-acetate
(PMA). Cells were loaded for 24 h with [3H] cholesterol-labeled acetylated LDL (acLDL, 1
µCi/ml) in serum-free RPMI 1640 culture medium supplemented with 50 mM glucose, 2 mM
glutamine, 0.2% BSA, 100 µg/ml penicillin and 100 µg/ml streptomycin (serum-free media).
After equilibration in serum-free media, cells were incubated for 4 h with HDL from subjects.
Efflux capacity was normalized to HDL-phospholipid content because PL has been shown to
represent the key component in determining cholesterol efflux capacity of HDL (15 µg/ml HDL-
PL in serum-free media, total volume 250 µL) (27). Cholesterol efflux capacity was measured as
the percent of radioactivity counts in the media over counts in the cell lysate, after adjustment for
non-specific diffusion to non-HDL containing media.
Statistical analysis
Data analysis was conducted using Excel (Microsoft Corp.) and GraphPad Prism 6.0
(GraphPad Software Inc.). In vitro and in vivo data were compared by Student`s unpaired T-test.
A p-value of less than 0.05 was considered statistically significant. The same test was employed
to compare HDL subclasses and composition between controls and heterozygotes. For data
regarding clinical samples, Chi-square testing (for categorical variables) and one-way ANOVA
(for continuous variables) were used to determine the effect of SCARB1 P376L carrier status on a
number of variables. A P value less than 0.05 was considered statistically significant. Tukey's
multiple comparison test (α=0.05) was used following ANOVA where appropriate to determine
which groups were responsible for statistically significant differences among groups. Data are
reported as mean ± SD. The association of P376L and CHD was tested among CHD cases and
controls of European ancestry assembled from the CARDIoGRAM Exome Consortium and the
CHD Exome+ Consortium. The summary OR of CHD for P376L carriers was calculated using a
Mantel-Haenszel fixed-effects meta-analysis without continuity correction, a method that is well
suited to low (and even zero) counts and resultant ORs. The association of the P376L variant
with HDL-C, LDL-C and TG in the Global Lipids Genetics Consortium Exome Chip
Genotyping study was assessed through meta-analysis of single variant score statistics in up to
301,025 individuals (71).
Supplemental Text
Conservation of SR-BI Proline 376 Across Species and Paralogues
The proline at position 376 of SR-BI is highly conserved down through Drosophila and
Anopheles, as well as in the closely related human genes CD36 and LIMP2 and is in a sequence
of highly invariant residues (Fig. S1). The “consensus deleteriousness” score according to
Condel was 0.906 (on a scale from 0 to 1, with 1 indicating maximum deleteriousness). Raptor
X, a secondary structure prediction program, predicts that substitution of proline 376 with
leucine increases the probability of this region to be in a beta-sheet confirmation from 36% to
61%. This finding is in agreement with the suggestion from the recently reported structure of
another scavenger receptor LIMP-2 (72) that the region containing P376 in SR-BI is a disordered
linker sequence joining beta strands 15 and 16 on the extracellular loop proximal to the C-
terminal transmembrane domain.
Impact of SCARB1 P376L on SR-BI processing and cholesterol ester uptake in transfected
COS7 cells
We tested the functional impact of the P376L variant on HDL-CE selective uptake in
transfected COS7 cells. Studies with transfected COS7 cells revealed that the P376L variant was
defective in promoting selective CE uptake (Fig. S3A) despite similar protein expression in total
cell lysates (Fig. S3B). Notably, the P376L variant had less activity in this assay than one
previously reported P297S variant (32) (Fig. S3A). In studies of 125I-labeled HDL3 binding at 4
ºC, the P376L variant abrogated cell-surface binding (Fig. S3C), despite equal SR-BI protein
levels in total cell lysates among groups (Fig. S3D).
We hypothesized that the reduced CE uptake and cell-surface HDL-binding by the SR-BI
P376L variant could be due to abnormal processing of the mutant protein, preventing its cell-
surface localization. To study this, we isolated cell-surface proteins from COS7 cells transfected
with SCARB1 WT, P376L and P297S using biotinylation and streptavidin pull-down. Western
blotting of whole cell lysates compared with purified biotinylated samples (as tested by probing
for β-actin and Na/K-ATPase) indicated that cell-surface expression of SR-BI P376L was
markedly reduced compared to both WT and P297S (Fig. S3E). This suggested that the P376L
mutation causes SR-BI to be retained inside the cell after translation. We next sought to
determine the molecular defect underlying loss of cell-surface localization and CE uptake
function by SR-BI P376L observed in the cell and mouse models. Given that SR-BI undergoes
N-glycosylation in the endoplasmic reticulum concomitant with proper folding and localization,
we hypothesized that altered post-translational modification may underlie its reduced cell-surface
localization (27-29). We measured the molecular weights of SR-BI forms after endoglycosidase-
H (Endo-H) treatment of transfected COS7 expressing WT or mutant SR-BI (Fig. S3F). In COS7
cell lysates in the absence of Endo-H, whole cell lysates from cells transfected with SR-BI WT,
P376L, or the P297S variant displayed a single band of approximately 65 kDa, representing fully
glycosylated mature SR-BI. For all three constructs, Endo-H treatment resulted in a major band
of approximately 45 kDa, representing the fully-deglycosylated (fully Endo-H sensitive) SR-BI
protein. However, WT and P297S displayed additional larger bands consistent with a pool of
partially Endo-H sensitive SR-BI possessing complex N-linked glycans, whereas P376L
displayed only the single, unmodified, fully-sensitive band. Because of high levels of cDNA
overexpression in the COS7 transfection, we believe the majority of the SR-BI across all groups
in this experiment is not fully processed, thus resulting the relatively higher proportion of the
total SR-BI exhibiting complete Endo-H sensitivity (Fig. S3F) relative to that observed in
analogous experiments in iPSC-derived hepatocyte-like cell and murine hepatocyte lysates after
Endo-H treatment (Fig. 2F-G of main text).
Phenotyping studies of P376L homozygote and heterozygotes
The P376L homozygote and eight P376L heterozygotes were recruited for additional
deep phenotyping. Two age, sex, and race matched control groups were used, one with normal
HDL-C levels (25th–75th percentile for age, race and sex) and a second with high HDL-C levels
(>95th percentile for age, race and sex) in which SCARB1 mutations were excluded. All of the
P376L study participants were of European ancestry, almost exclusively of Ashkenazi Jewish
descent. Two P376L heterozygotes, 4 normal HDL-C controls and 4 high HDL-C controls
reported an alcohol intake of more than 1 drink per day, but there was no self-reported alcohol
abuse. Smokers and subjects with diabetes were excluded. The P376L homozygote reported
having a seizure disorder that was not treated pharmacologically at the time of participation.
Previous in vitro, mouse and human genetics studies have suggested that SR-BI in
platelets is necessary for proper platelet activity and thrombosis (6, 32, 73-75). To test the effects
of the P376L variant on platelet activity, we isolated platelets from carriers and controls and
performed light transmission aggregometry (LTA) after stimulation with known platelet
activators arachidonic acid, collagen, ADP and TRAP over a range of doses. We found only a
slight decrease in ADP-induced maximal aggregation in platelets isolated from the P376L
homozygote relative to heterozygotes and control subjects at a dose of 5 mmol (Fig. S5A). No
differences in platelet activity in response to other stimulants were observed between the groups.
We also extracted lipids from platelets and measured platelet cholesterol content among groups.
We observed that platelet cholesterol increased in a genotype dose-dependent manner from
controls (mean 122 nmol/mg protein) to heterozygotes (mean 139 nmol/mg protein) to the
homozygote subject (244 nmol/mg protein) (Fig. S5B). However, the difference between normal
HDL-C controls and heterozygotes was not significant, and these differences were reduced when
the values normalized to plasma total cholesterol levels, suggesting that elevated platelet
cholesterol in carriers reflects increased plasma HDL-C levels rather than a platelet SR-BI
specific function (Fig. S5C). There was also no difference in total circulating platelet levels
among groups (data not shown).
SR-BI also takes up HDL-cholesteryl esters in adrenal glands and reproductive tissues for
steroid hormone production in mice and humans (6, 18, 76), so we evaluated the impact of
SCARB1 loss-of-function on steroid hormones in our recruited participants. We found no
difference in morning serum cortisol, ACTH and 24-hr urinary cortisol-to-creatinine (Fig. S6)
across participants, moderately higher testosterone in male P376L heterozygotes relative to
normal HDL-C controls, but no differences across groups in FSH and LH.
Fig. S1
Fig. S1. SR-BI Protein Sequence Alignment Across Species. Amino acid sequence
alignment of SR-BI across 12 species and human SR-BI paralogues CD36 and LIMP-2. Shown
is the ~60 residue sequence alignment adjacent human SR-BI residue Pro376 (indicated by red
box). Dark grey shading indicates full conservation of a given residue across indicated species.
Light grey shading indicates a different but conservative amino acid for the given species
compared to the others listed.
Fig. S2
Fig. S2. Gene expression in control and SCARB1 P376L iPSC-derived hepatocyte-like cells
(HLCs). A. ALB Gene expression by quantitative RT-PCR of mRNA from control and P376L
mutant iPSC-derived HLCs. Cells were differentiated 21–25 days before experiments and RNA
isolation for gene expression analysis. B. AFP gene expression in iPSC-derived HLCs. C.
SCARB1 gene expression in iPSC-derived HLCs.
ALB
M15-4 M15-10 M14-5 M14-11 Human Liver012345
90100110120130140 Control HLCs
Pro376Leu HLCs
Rel
ativ
e E
xpre
ssio
n(N
orm
aliz
ed t
o
-act
in)
AFP
M15-4 M15-10 M14-5 M14-11 Human Liver0
20406080
100200000.0
400000.0
600000.0
800000.0 Control HLCs
Pro376Leu HLCs
Rel
ativ
e E
xpre
ssio
n(N
orm
aliz
ed t
o
-act
in)
SCARB1
M15-4 M15-10 M14-5 M14-11 Human Liver0
20
40
60
80
100
120
140 Control HLCs
Pro376Leu HLCs
Rel
ativ
e E
xpre
ssio
n(N
orm
aliz
ed t
o
-act
in)
A.
C.
B.
Fig. S3
Fig S3. SCARB1 P376L abrogates SR-BI function in transfected COS7 cells. A. Selective
cholesterol uptake in COS7 cells expressing SR-BI WT vs. P376L. Cells were transfected with
plasmids expressing WT, P376L or P297S forms of SR-BI and incubated at 37°C for 3 hours
with 125I/3H-labeled HDL3 to determine HDL cholesterol ester (CE) specific uptake. Data
represent the mean of a quintuplicate determination after subtraction of the determinations done
with the addition of a 40-fold excess of cold HDL. B. Western blot showing SR-BI expression
levels in whole cell lysates from COS7 cells transfected for selective cholesterol uptake
experiment in (A). C. Binding of HDL to SR-BI at 4°C in transfected COS7 cells. Transfected
cells were exposed to 125I-labeled HDL3 for 2 hours at 4°C to measure HDL binding. Radioactive
counts from cells were then quantified to determine the amount of cell-associated 125I-HDL3.
Data points represent the mean +/- S.D. of a triplicate determination after subtraction of the
A. B. B.
D.
NTC WT P376L P297S
GFP WT P376L P297S
β-actin
SR-BI
β-actin
SR-BI
P297S P376L WT
125I HDL concentration (µg protein/ml medium)�
Bo
un
d H
DL
(n
g H
DL
pro
tein
/mg
ce
ll p
rote
in) �
C.
P297S
P376L
WT
β-actin
SR-BI
Na+/K+ ATPase
GFP WT P376L P297S GFP WT P376L P297S
Whole Cell Lysate Cell Surface E.
WT P376L A.
GFP P297S WT P376L GFP P297S
- - + + EndoH:
SR-BI
- +
45
52
65 Mature
Partially EndoH sensitive
Fully EndoH sensitive
kDa - +
F.
determinations done with the addition of a 40-fold excess of unlabeled HDL3. ** P<0.01, one-
way ANOVA. D. Western blot showing SR-BI expression levels in whole cell lysates from
COS7 cells transfected in panel (C). E. Immunoblot of SR-BI after cell-surface biotinylation in
transfected COS7 cells. Cells were transfected with GFP, SR-BI WT, P376L or P297S plasmids
and biotinylated before collection of whole cell lysate (left) or incubation with NuetrAvidin
beads and elution of cell-surface localized proteins (right). Whole cell lysates (lanes 1–4) and
cell-surface proteins (lanes 5–8) were separated by SDS-PAGE and immunoblotted for human
SR-BI. Actin and Na/K-ATPase were used respectively as intracellular and surface-associated
controls. F. Endo-H sensitivity of SR-BI from transfected COS7 cells. Cells were transfected
with plasmids encoding GFP or different forms of SR-BI (WT, P376L, P297S) and cell lysates
were treated with Endo-H to release complex N-linked glycans and molecular forms of SR-BI
were monitored by immunoblotting. For A & C, data represent mean Error bars indicate mean
values ± S.D. ** P<0.01, Student’s unpaired T-test.
Fig. S4
Fig. S4. Hepatic SCARB1 expression and impact on selective cholesterol uptake from HDL
in mice. A. Human SCARB1 transcript expression levels measured by quantitative RT-PCR from
livers of mice expressing Null or SR-BI AAV vectors. Gene expression was measured from total
hepatic RNA after reverse transcription and normalized to expression levels of actin. B. SR-BI
immunoblot (right) from livers of Scarb1 KO mice expressing Null, SR-BI WT, and SR-BI
P376L 2 week s after AAV administration. C. Liver 3H CE uptake from dual-labeled HDL
administration in mice expressing Null or SR-BI AAVs. D. Hepatic selective cholesterol uptake
measured by relative difference of hepatic 3H CE and 125I TC uptake in livers of mice expressing
Null or SR-BI AAVs after dual-labeled HDL administration. All data represent mean values ±
S.D. for each of the 3 groups. *P<0.05, ** P<0.01, ***P<0.001, Unpaired T-test.
SR-BI
AAV-Null AAV-SRBI-WT AAV-SRBI-P376L
kDa
64
ID#
β-actin
77 81 84 87 90 93 78 82 85 88 91 94 79 83 86 89 92 95
42
Null WT P376L0
200
400
600
800
1000
Rel
ativ
e L
iver
SCARB1
mR
NA
(n
orm
aliz
ed t
o
-act
in)
A. B.
Null WT P376L0
2
4
6
8
Hep
atic
3H
CE
Up
take
(n
g H
DL
/mg
cel
l pro
tein
)
N.S.
******
F.
Null Wild type P376L0
1
2
3
4
5
Hep
atic
Sel
ecti
ve C
ho
lest
ero
l Up
take
(n
g H
DL
/mg
cel
l pro
tein
)
N.S.
******
G.C. D.
Fig. S5
Fig. S5. Platelet aggregation and cholesterol content. A. Platelet aggregation measured by
light transmission aggregometry after stimulation with increasing doses of ADP. Data represent
the percentage maximal aggregation. B. Platelet cholesterol content measured by LC/MS. C.
Platelet cholesterol content after normalization for plasma total cholesterol levels. Bars represent
mean values ± S.D.. * P<0.05, one-way ANOVA followed by Tukey's multiple comparisons test.
A. B. C.
Fig. S6
Fig. S6. Impact of SCARB1 P376L on adrenal and gonadic steroidogenesis. A. Morning
serum cortisol in carriers vs. controls. B. Morning plasma ACTH. C. Cortisol / creatinine ratio in
24-hour urine. D. Serum testosterone in males. E. Serum LH in males. F. Serum FSH in males.
Bars represent mean values ± S.D.. * P<0.05, one-way ANOVA followed by Tukey's multiple
comparisons test.
A. B. C.
D. E. F.
Fig. S7
Fig. S7. Carotid intima media thickness (cIMT) in SCARB1 P376L carriers vs. controls. A.
cIMT for all subjects (male and female combined). B & C. cIMT results for males and females,
respectively. Dotted lines represent the 25th and the 75th percentile values from the ARIC study.
Bars represent mean values ± S.D.. All data shows the average left / right cIMT.
A. B. C.
Table S1. Association of SCARB1 P376L with plasma lipid traits in global lipids genetics
consortium exome array genotyping. The relationship between the frequency of P376L carriers
and plasma lipid traits was measured in the Global Lipids Genetics Consortium cohort by
genotyping of the variant on the Exome Array and using the Score test.
Trait Number of
subject included
Minor allele
frequency Beta (SE) in SD
P value (score
test)
HDL-C 301025 0.00033 +0.57 (0.071) 1.41 × 10–15
LDL-C 280551 0.00033 +0.065 (0.074) 0.381
TG 290277 0.00034 –0.052 (0.072) 0.474
REFERENCES
1. D. J. Rader, A. R. Tall, The not-so-simple HDL story: Is it time to revise the HDL cholesterol
hypothesis? Nat. Med. 18, 1344–1346 (2012). Medline doi:10.1038/nm.2937
2. C. L. Haase, A. Tybjærg-Hansen, A. A. Qayyum, J. Schou, B. G. Nordestgaard, R. Frikke-
Schmidt, LCAT, HDL cholesterol and ischemic cardiovascular disease: A Mendelian
randomization study of HDL cholesterol in 54,500 individuals. J. Clin. Endocrinol.
Metab. 97, E248–E256 (2012). Medline doi:10.1210/jc.2011-1846
3. R. Frikke-Schmidt, B. G. Nordestgaard, M. C. Stene, A. A. Sethi, A. T. Remaley, P. Schnohr,
P. Grande, A. Tybjaerg-Hansen, Association of loss-of-function mutations in the ABCA1
gene with high-density lipoprotein cholesterol levels and risk of ischemic heart disease.
JAMA 299, 2524–2532 (2008). Medline doi:10.1001/jama.299.21.2524
4. B. F. Voight, G. M. Peloso, M. Orho-Melander, R. Frikke-Schmidt, M. Barbalic, M. K.
Jensen, G. Hindy, H. Hólm, E. L. Ding, T. Johnson, H. Schunkert, N. J. Samani, R.
Clarke, J. C. Hopewell, J. F. Thompson, M. Li, G. Thorleifsson, C. Newton-Cheh, K.
Musunuru, J. P. Pirruccello, D. Saleheen, L. Chen, A. Stewart, A. Schillert, U.
Thorsteinsdottir, G. Thorgeirsson, S. Anand, J. C. Engert, T. Morgan, J. Spertus, M.
Stoll, K. Berger, N. Martinelli, D. Girelli, P. P. McKeown, C. C. Patterson, S. E. Epstein,
J. Devaney, M. S. Burnett, V. Mooser, S. Ripatti, I. Surakka, M. S. Nieminen, J. Sinisalo,
M. L. Lokki, M. Perola, A. Havulinna, U. de Faire, B. Gigante, E. Ingelsson, T. Zeller, P.
Wild, P. I. de Bakker, O. H. Klungel, A. H. Maitland-van der Zee, B. J. Peters, A. de
Boer, D. E. Grobbee, P. W. Kamphuisen, V. H. Deneer, C. C. Elbers, N. C. Onland-
Moret, M. H. Hofker, C. Wijmenga, W. M. Verschuren, J. M. Boer, Y. T. van der
Schouw, A. Rasheed, P. Frossard, S. Demissie, C. Willer, R. Do, J. M. Ordovas, G. R.
Abecasis, M. Boehnke, K. L. Mohlke, M. J. Daly, C. Guiducci, N. P. Burtt, A. Surti, E.
Gonzalez, S. Purcell, S. Gabriel, J. Marrugat, J. Peden, J. Erdmann, P. Diemert, C.
Willenborg, I. R. König, M. Fischer, C. Hengstenberg, A. Ziegler, I. Buysschaert, D.
Lambrechts, F. Van de Werf, K. A. Fox, N. E. El Mokhtari, D. Rubin, J. Schrezenmeir, S.
Schreiber, A. Schäfer, J. Danesh, S. Blankenberg, R. Roberts, R. McPherson, H. Watkins,
A. S. Hall, K. Overvad, E. Rimm, E. Boerwinkle, A. Tybjaerg-Hansen, L. A. Cupples, M.
P. Reilly, O. Melander, P. M. Mannucci, D. Ardissino, D. Siscovick, R. Elosua, K.
Stefansson, C. J. O’Donnell, V. Salomaa, D. J. Rader, L. Peltonen, S. M. Schwartz, D.
Altshuler, S. Kathiresan, Plasma HDL cholesterol and risk of myocardial infarction: A
mendelian randomisation study. Lancet 380, 572–580 (2012). Medline
doi:10.1016/S0140-6736(12)60312-2
5. S. Acton, A. Rigotti, K. T. Landschulz, S. Xu, H. H. Hobbs, M. Krieger, Identification of
scavenger receptor SR-BI as a high density lipoprotein receptor. Science 271, 518–520
(1996). Medline doi:10.1126/science.271.5248.518
6. M. Hoekstra, T. J. Van Berkel, M. Van Eck, Scavenger receptor BI: A multi-purpose player in
cholesterol and steroid metabolism. World J. Gastroenterol. 16, 5916–5924 (2010).
Medline
7. N. Wang, T. Arai, Y. Ji, F. Rinninger, A. R. Tall, Liver-specific overexpression of scavenger
receptor BI decreases levels of very low density lipoprotein ApoB, low density
lipoprotein ApoB, and high density lipoprotein in transgenic mice. J. Biol. Chem. 273,
32920–32926 (1998). Medline doi:10.1074/jbc.273.49.32920
8. Y. Ueda, L. Royer, E. Gong, J. Zhang, P. N. Cooper, O. Francone, E. M. Rubin, Lower plasma
levels and accelerated clearance of high density lipoprotein (HDL) and non-HDL
cholesterol in scavenger receptor class B type I transgenic mice. J. Biol. Chem. 274,
7165–7171 (1999). Medline doi:10.1074/jbc.274.11.7165
9. K. F. Kozarsky, M. H. Donahee, A. Rigotti, S. N. Iqbal, E. R. Edelman, M. Krieger,
Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol
levels. Nature 387, 414–417 (1997). Medline doi:10.1038/387414a0
10. Y. Ji, N. Wang, R. Ramakrishnan, E. Sehayek, D. Huszar, J. L. Breslow, A. R. Tall, Hepatic
scavenger receptor BI promotes rapid clearance of high density lipoprotein free
cholesterol and its transport into bile. J. Biol. Chem. 274, 33398–33402 (1999). Medline
doi:10.1074/jbc.274.47.33398
11. M. L. Varban, F. Rinninger, N. Wang, V. Fairchild-Huntress, J. H. Dunmore, Q. Fang, M. L.
Gosselin, K. L. Dixon, J. D. Deeds, S. L. Acton, A. R. Tall, D. Huszar, Targeted mutation
reveals a central role for SR-BI in hepatic selective uptake of high density lipoprotein
cholesterol. Proc. Natl. Acad. Sci. U.S.A. 95, 4619–4624 (1998). Medline
doi:10.1073/pnas.95.8.4619
12. A. Rigotti, B. L. Trigatti, M. Penman, H. Rayburn, J. Herz, M. Krieger, A targeted mutation
in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger
receptor class B type I reveals its key role in HDL metabolism. Proc. Natl. Acad. Sci.
U.S.A. 94, 12610–12615 (1997). Medline doi:10.1073/pnas.94.23.12610
13. M. Brundert, A. Ewert, J. Heeren, B. Behrendt, R. Ramakrishnan, H. Greten, M. Merkel, F.
Rinninger, Scavenger receptor class B type I mediates the selective uptake of high-
density lipoprotein-associated cholesteryl ester by the liver in mice. Arterioscler.
Thromb. Vasc. Biol. 25, 143–148 (2005). Medline
14. Y. Ueda, E. Gong, L. Royer, P. N. Cooper, O. L. Francone, E. M. Rubin, Relationship
between expression levels and atherogenesis in scavenger receptor class B, type I
transgenics. J. Biol. Chem. 275, 20368–20373 (2000). Medline
doi:10.1074/jbc.M000730200
15. K. F. Kozarsky, M. H. Donahee, J. M. Glick, M. Krieger, D. J. Rader, Gene transfer and
hepatic overexpression of the HDL receptor SR-BI reduces atherosclerosis in the
cholesterol-fed LDL receptor-deficient mouse. Arterioscler. Thromb. Vasc. Biol. 20,
721–727 (2000). Medline doi:10.1161/01.ATV.20.3.721
16. T. Arai, N. Wang, M. Bezouevski, C. Welch, A. R. Tall, Decreased atherosclerosis in
heterozygous low density lipoprotein receptor-deficient mice expressing the scavenger
receptor BI transgene. J. Biol. Chem. 274, 2366–2371 (1999). Medline
doi:10.1074/jbc.274.4.2366
17. M. Van Eck, J. Twisk, M. Hoekstra, B. T. Van Rij, C. A. Van der Lans, I. S. Bos, J. K.
Kruijt, F. Kuipers, T. J. Van Berkel, Differential effects of scavenger receptor BI
deficiency on lipid metabolism in cells of the arterial wall and in the liver. J. Biol. Chem.
278, 23699–23705 (2003). Medline doi:10.1074/jbc.M211233200
18. B. Trigatti, H. Rayburn, M. Viñals, A. Braun, H. Miettinen, M. Penman, M. Hertz, M.
Schrenzel, L. Amigo, A. Rigotti, M. Krieger, Influence of the high density lipoprotein
receptor SR-BI on reproductive and cardiovascular pathophysiology. Proc. Natl. Acad.
Sci. U.S.A. 96, 9322–9327 (1999). Medline doi:10.1073/pnas.96.16.9322
19. D. Huszar, M. L. Varban, F. Rinninger, R. Feeley, T. Arai, V. Fairchild-Huntress, M. J.
Donovan, A. R. Tall, Increased LDL cholesterol and atherosclerosis in LDL receptor-
deficient mice with attenuated expression of scavenger receptor B1. Arterioscler.
Thromb. Vasc. Biol. 20, 1068–1073 (2000). Medline doi:10.1161/01.ATV.20.4.1068
20. A. Braun, B. L. Trigatti, M. J. Post, K. Sato, M. Simons, J. M. Edelberg, R. D. Rosenberg,
M. Schrenzel, M. Krieger, Loss of SR-BI expression leads to the early onset of occlusive
atherosclerotic coronary artery disease, spontaneous myocardial infarctions, severe
cardiac dysfunction, and premature death in apolipoprotein E-deficient mice. Circ. Res.
90, 270–276 (2002). Medline doi:10.1161/hh0302.104462
21. Y. Zhang, J. R. Da Silva, M. Reilly, J. T. Billheimer, G. H. Rothblat, D. J. Rader, Hepatic
expression of scavenger receptor class B type I (SR-BI) is a positive regulator of
macrophage reverse cholesterol transport in vivo. J. Clin. Invest. 115, 2870–2874 (2005).
Medline doi:10.1172/JCI25327
22. T. M. Teslovich, K. Musunuru, A. V. Smith, A. C. Edmondson, I. M. Stylianou, M. Koseki,
J. P. Pirruccello, S. Ripatti, D. I. Chasman, C. J. Willer, C. T. Johansen, S. W. Fouchier,
A. Isaacs, G. M. Peloso, M. Barbalic, S. L. Ricketts, J. C. Bis, Y. S. Aulchenko, G.
Thorleifsson, M. F. Feitosa, J. Chambers, M. Orho-Melander, O. Melander, T. Johnson,
X. Li, X. Guo, M. Li, Y. Shin Cho, M. Jin Go, Y. Jin Kim, J.-Y. Lee, T. Park, K. Kim, X.
Sim, R. Twee-Hee Ong, D. C. Croteau-Chonka, L. A. Lange, J. D. Smith, K. Song, J.
Hua Zhao, X. Yuan, J. Luan, C. Lamina, A. Ziegler, W. Zhang, R. Y. Zee, A. F. Wright,
J. C. Witteman, J. F. Wilson, G. Willemsen, H.-E. Wichmann, J. B. Whitfield, D. M.
Waterworth, N. J. Wareham, G. Waeber, P. Vollenweider, B. F. Voight, V. Vitart, A. G.
Uitterlinden, M. Uda, J. Tuomilehto, J. R. Thompson, T. Tanaka, I. Surakka, H. M.
Stringham, T. D. Spector, N. Soranzo, J. H. Smit, J. Sinisalo, K. Silander, E. J. G.
Sijbrands, A. Scuteri, J. Scott, D. Schlessinger, S. Sanna, V. Salomaa, J. Saharinen, C.
Sabatti, A. Ruokonen, I. Rudan, L. M. Rose, R. Roberts, M. Rieder, B. M. Psaty, P. P.
Pramstaller, I. Pichler, M. Perola, B. W. J. H. Penninx, N. L. Pedersen, C. Pattaro, A. N.
Parker, G. Pare, B. A. Oostra, C. J. O’Donnell, M. S. Nieminen, D. A. Nickerson, G. W.
Montgomery, T. Meitinger, R. McPherson, M. I. McCarthy, W. McArdle, D. Masson, N.
G. Martin, F. Marroni, M. Mangino, P. K. E. Magnusson, G. Lucas, R. Luben, R. J. F.
Loos, M.-L. Lokki, G. Lettre, C. Langenberg, L. J. Launer, E. G. Lakatta, R. Laaksonen,
K. O. Kyvik, F. Kronenberg, I. R. König, K.-T. Khaw, J. Kaprio, L. M. Kaplan, Å.
Johansson, M.-R. Jarvelin, A. C. Janssens, E. Ingelsson, W. Igl, G. Kees Hovingh, J.-J.
Hottenga, A. Hofman, A. A. Hicks, C. Hengstenberg, I. M. Heid, C. Hayward, A. S.
Havulinna, N. D. Hastie, T. B. Harris, T. Haritunians, A. S. Hall, U. Gyllensten, C.
Guiducci, L. C. Groop, E. Gonzalez, C. Gieger, N. B. Freimer, L. Ferrucci, J. Erdmann,
P. Elliott, K. G. Ejebe, A. Döring, A. F. Dominiczak, S. Demissie, P. Deloukas, E. J. C.
de Geus, U. de Faire, G. Crawford, F. S. Collins, Y.-D. Chen, M. J. Caulfield, H.
Campbell, N. P. Burtt, L. L. Bonnycastle, D. I. Boomsma, S. M. Boekholdt, R. N.
Bergman, I. Barroso, S. Bandinelli, C. M. Ballantyne, T. L. Assimes, T. Quertermous, D.
Altshuler, M. Seielstad, T. Y. Wong, E. S. Tai, A. B. Feranil, C. W. Kuzawa, L. S. Adair,
H. A. Taylor Jr., I. B. Borecki, S. B. Gabriel, J. G. Wilson, H. Holm, U. Thorsteinsdottir,
V. Gudnason, R. M. Krauss, K. L. Mohlke, J. M. Ordovas, P. B. Munroe, J. S. Kooner,
A. R. Tall, R. A. Hegele, J. J. P. Kastelein, E. E. Schadt, J. I. Rotter, E. Boerwinkle, D. P.
Strachan, V. Mooser, K. Stefansson, M. P. Reilly, N. J. Samani, H. Schunkert, L. A.
Cupples, M. S. Sandhu, P. M. Ridker, D. J. Rader, C. M. van Duijn, L. Peltonen, G. R.
Abecasis, M. Boehnke, S. Kathiresan, Biological, clinical and population relevance of 95
loci for blood lipids. Nature 466, 707–713 (2010). Medline doi:10.1038/nature09270
23. A. Ghodsizadeh, A. Taei, M. Totonchi, A. Seifinejad, H. Gourabi, B. Pournasr, N. Aghdami,
R. Malekzadeh, N. Almadani, G. H. Salekdeh, H. Baharvand, Generation of liver disease-
specific induced pluripotent stem cells along with efficient differentiation to functional
hepatocyte-like cells. Stem Cell Rev. 6, 622–632 (2010). Medline doi:10.1007/s12015-
010-9189-3
24. M. A. Cayo, J. Cai, A. DeLaForest, F. K. Noto, M. Nagaoka, B. S. Clark, R. F. Collery, K.
Si-Tayeb, S. A. Duncan, JD induced pluripotent stem cell-derived hepatocytes faithfully
recapitulate the pathophysiology of familial hypercholesterolemia. Hepatology 56, 2163–
2171 (2012). Medline doi:10.1002/hep.25871
25. S. K. Mallanna, S. A. Duncan, Differentiation of hepatocytes from pluripotent stem cells.
Curr. Protocol Stem Cell Biol. 26 (Unit 1G), 4 (2013).
26. K. Si-Tayeb, F. K. Noto, M. Nagaoka, J. Li, M. A. Battle, C. Duris, P. E. North, S. Dalton, S.
A. Duncan, Highly efficient generation of human hepatocyte-like cells from induced
pluripotent stem cells. Hepatology 51, 297–305 (2010). Medline doi:10.1002/hep.23354
27. J. Babitt, B. Trigatti, A. Rigotti, E. J. Smart, R. G. Anderson, S. Xu, M. Krieger, Murine SR-
BI, a high density lipoprotein receptor that mediates selective lipid uptake, is N-
glycosylated and fatty acylated and colocalizes with plasma membrane caveolae. J. Biol.
Chem. 272, 13242–13249 (1997). Medline doi:10.1074/jbc.272.20.13242
28. M. Viñals, S. Xu, E. Vasile, M. Krieger, Identification of the N-linked glycosylation sites on
the high density lipoprotein (HDL) receptor SR-BI and assessment of their effects on
HDL binding and selective lipid uptake. J. Biol. Chem. 278, 5325–5332 (2003). Medline
doi:10.1074/jbc.M211073200
29. D. Calvo, D. Gómez-Coronado, M. A. Lasunción, M. A. Vega, CLA-1 is an 85-kD plasma
membrane glycoprotein that acts as a high-affinity receptor for both native (HDL, LDL,
and VLDL) and modified (OxLDL and AcLDL) lipoproteins. Arterioscler. Thromb.
Vasc. Biol. 17, 2341–2349 (1997). Medline doi:10.1161/01.ATV.17.11.2341
30. C. C. Schwartz, J. M. VandenBroek, P. S. Cooper, Lipoprotein cholesteryl ester production,
transfer, and output in vivo in humans. J. Lipid Res. 45, 1594–1607 (2004). Medline
doi:10.1194/jlr.M300511-JLR200
31. M. Vergeer, S. J. Korporaal, R. Franssen, I. Meurs, R. Out, G. K. Hovingh, M. Hoekstra, J.
A. Sierts, G. M. Dallinga-Thie, M. M. Motazacker, A. G. Holleboom, T. J. Van Berkel, J.
J. Kastelein, M. Van Eck, J. A. Kuivenhoven, Genetic variant of the scavenger receptor
BI in humans. N. Engl. J. Med. 364, 136–145 (2011). Medline
doi:10.1056/NEJMoa0907687
32. R. B. Hildebrand, B. Lammers, I. Meurs, S. J. Korporaal, W. De Haan, Y. Zhao, J. K. Kruijt,
D. Praticò, A. W. Schimmel, A. G. Holleboom, M. Hoekstra, J. A. Kuivenhoven, T. J.
Van Berkel, P. C. Rensen, M. Van Eck, Restoration of high-density lipoprotein levels by
cholesteryl ester transfer protein expression in scavenger receptor class B type I (SR-BI)
knockout mice does not normalize pathologies associated with SR-BI deficiency.
Arterioscler. Thromb. Vasc. Biol. 30, 1439–1445 (2010). Medline
doi:10.1161/ATVBAHA.110.205153
33. L. Lagrost, H. Gandjini, A. Athias, V. Guyard-Dangremont, C. Lallemant, P. Gambert,
Influence of plasma cholesteryl ester transfer activity on the LDL and HDL distribution
profiles in normolipidemic subjects. Arterioscler. Thromb. 13, 815–825 (1993). Medline
doi:10.1161/01.ATV.13.6.815
34. H. E. Miettinen, H. Rayburn, M. Krieger, Abnormal lipoprotein metabolism and reversible
female infertility in HDL receptor (SR-BI)-deficient mice. J. Clin. Invest. 108, 1717–
1722 (2001). Medline doi:10.1172/JCI13288
35. M. Hoekstra, I. Meurs, M. Koenders, R. Out, R. B. Hildebrand, J. K. Kruijt, M. Van Eck, T.
J. Van Berkel, Absence of HDL cholesteryl ester uptake in mice via SR-BI impairs an
adequate adrenal glucocorticoid-mediated stress response to fasting. J. Lipid Res. 49,
738–745 (2008). Medline doi:10.1194/jlr.M700475-JLR200
36. M. Hoekstra, D. Ye, R. B. Hildebrand, Y. Zhao, B. Lammers, M. Stitzinger, J. Kuiper, T. J.
Van Berkel, M. Van Eck, Scavenger receptor class B type I-mediated uptake of serum
cholesterol is essential for optimal adrenal glucocorticoid production. J. Lipid Res. 50,
1039–1046 (2009). Medline doi:10.1194/jlr.M800410-JLR200
37. O. Kocher, A. Yesilaltay, C. Cirovic, R. Pal, A. Rigotti, M. Krieger, Targeted disruption of
the PDZK1 gene in mice causes tissue-specific depletion of the high density lipoprotein
receptor scavenger receptor class B type I and altered lipoprotein metabolism. J. Biol.
Chem. 278, 52820–52825 (2003). Medline doi:10.1074/jbc.M310482200
38. C. Mineo, P. W. Shaul, Functions of scavenger receptor class B, type I in atherosclerosis.
Curr. Opin. Lipidol. 23, 487–493 (2012). Medline doi:10.1097/MOL.0b013e328357ba61
39. A. Rigotti, H. E. Miettinen, M. Krieger, The role of the high-density lipoprotein receptor SR-
BI in the lipid metabolism of endocrine and other tissues. Endocr. Rev. 24, 357–387
(2003). Medline doi:10.1210/er.2001-0037
40. A. Gnirke, A. Melnikov, J. Maguire, P. Rogov, E. M. LeProust, W. Brockman, T. Fennell, G.
Giannoukos, S. Fisher, C. Russ, S. Gabriel, D. B. Jaffe, E. S. Lander, C. Nusbaum,
Solution hybrid selection with ultra-long oligonucleotides for massively parallel targeted
sequencing. Nat. Biotechnol. 27, 182–189 (2009). Medline doi:10.1038/nbt.1523
41. P. Cingolani, A. Platts, L. Wang, M. Coon, T. Nguyen, L. Wang, S. J. Land, X. Lu, D. M.
Ruden, A program for annotating and predicting the effects of single nucleotide
polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118;
iso-2; iso-3. Fly (Austin) 6, 80–92 (2012). Medline doi:10.4161/fly.19695
42. F. Sanger, S. Nicklen, A. R. Coulson, DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. U.S.A. 74, 5463–5467 (1977). Medline
doi:10.1073/pnas.74.12.5463
43. A. González-Pérez, N. López-Bigas, Improving the assessment of the outcome of
nonsynonymous SNVs with a consensus deleteriousness score, Condel. Am. J. Hum.
Genet. 88, 440–449 (2011). Medline doi:10.1016/j.ajhg.2011.03.004
44. I. A. Adzhubei, S. Schmidt, L. Peshkin, V. E. Ramensky, A. Gerasimova, P. Bork, A. S.
Kondrashov, S. R. Sunyaev, A method and server for predicting damaging missense
mutations. Nat. Methods 7, 248–249 (2010). Medline doi:10.1038/nmeth0410-248
45. M. Källberg, H. Wang, S. Wang, J. Peng, Z. Wang, H. Lu, J. Xu, Template-based protein
structure modeling using the RaptorX web server. Nat. Protoc. 7, 1511–1522 (2012).
Medline doi:10.1038/nprot.2012.085
46. Z. Wang, F. Zhao, J. Peng, J. Xu, Protein 8-class secondary structure prediction using
conditional neural fields. Proteomics 11, 3786–3792 (2011). Medline
doi:10.1002/pmic.201100196
47. S. Somanathan, F. Jacobs, Q. Wang, A. L. Hanlon, J. M. Wilson, D. J. Rader, AAV vectors
expressing LDLR gain-of-function variants demonstrate increased efficacy in mouse
models of familial hypercholesterolemia. Circ. Res. 115, 591–599 (2014). Medline
doi:10.1161/CIRCRESAHA.115.304008
48. S. J. Chen, J. Sanmiguel, M. Lock, D. McMenamin, C. Draper, M. P. Limberis, S. H.
Kassim, S. Somanathan, P. Bell, J. C. Johnston, D. J. Rader, J. M. Wilson,
Biodistribution of AAV8 vectors expressing human low-density lipoprotein receptor in a
mouse model of homozygous familial hypercholesterolemia. Hum. Gene Ther. Clin. Dev.
24, 154–160 (2013). Medline doi:10.1089/humc.2013.082
49. S. H. Kassim, H. Li, P. Bell, S. Somanathan, W. Lagor, F. Jacobs, J. Billheimer, J. M.
Wilson, D. J. Rader, Adeno-associated virus serotype 8 gene therapy leads to significant
lowering of plasma cholesterol levels in humanized mouse models of homozygous and
heterozygous familial hypercholesterolemia. Hum. Gene Ther. 24, 19–26 (2013). Medline
doi:10.1089/hum.2012.108
50. S. H. Kassim, H. Li, L. H. Vandenberghe, C. Hinderer, P. Bell, D. Marchadier, A. Wilson, D.
Cromley, V. Redon, H. Yu, J. M. Wilson, D. J. Rader, Gene therapy in a humanized
mouse model of familial hypercholesterolemia leads to marked regression of
atherosclerosis. PLOS ONE 5, e13424 (2010). Medline
doi:10.1371/journal.pone.0013424
51. K. Kitajima, D. H. Marchadier, G. C. Miller, G. P. Gao, J. M. Wilson, D. J. Rader, Complete
prevention of atherosclerosis in apoE-deficient mice by hepatic human apoE gene
transfer with adeno-associated virus serotypes 7 and 8. Arterioscler. Thromb. Vasc. Biol.
26, 1852–1857 (2006). Medline doi:10.1161/01.ATV.0000231520.26490.54
52. S. J. Chen, D. J. Rader, J. Tazelaar, M. Kawashiri, G. Gao, J. M. Wilson, Prolonged
correction of hyperlipidemia in mice with familial hypercholesterolemia using an adeno-
associated viral vector expressing very-low-density lipoprotein receptor. Mol. Ther. 2,
256–261 (2000). Medline doi:10.1006/mthe.2000.0122
53. F. T. Hatch, R. S. Lees, Practical methods for plasma lipoprotein analysis. Adv. Lipid Res. 6,
1–68 (1968). Medline doi:10.1016/B978-1-4831-9942-9.50008-5
54. U. J. Tietge, C. Maugeais, W. Cain, D. Grass, J. M. Glick, F. C. de Beer, D. J. Rader,
Overexpression of secretory phospholipase A(2) causes rapid catabolism and altered
tissue uptake of high density lipoprotein cholesteryl ester and apolipoprotein A-I. J. Biol.
Chem. 275, 10077–10084 (2000). Medline doi:10.1074/jbc.275.14.10077
55. O. H. Lowry, N. J. Rosebrough, A. L. Farr, R. J. Randall, Protein measurement with the
Folin phenol reagent. J. Biol. Chem. 193, 265–275 (1951). Medline
56. S. Azhar, L. Tsai, E. Reaven, Uptake and utilization of lipoprotein cholesteryl esters by rat
granulosa cells. Biochim. Biophys. Acta 1047, 148–160 (1990). Medline
doi:10.1016/0005-2760(90)90041-U
57. M. A. Connelly, S. M. Klein, S. Azhar, N. A. Abumrad, D. L. Williams, Comparison of class
B scavenger receptors, CD36 and scavenger receptor BI (SR-BI), shows that both
receptors mediate high density lipoprotein-cholesteryl ester selective uptake but SR-BI
exhibits a unique enhancement of cholesteryl ester uptake. J. Biol. Chem. 274, 41–47
(1999). Medline doi:10.1074/jbc.274.1.41
58. T. J. Nieland, S. Xu, M. Penman, M. Krieger, Negatively cooperative binding of high-density
lipoprotein to the HDL receptor SR-BI. Biochemistry 50, 1818–1830 (2011). Medline
doi:10.1021/bi101657j
59. J. Cai et al., in StemBook (Cambridge, MA, 2008).
60. W. Yang et al., in StemBook (Cambridge, MA, 2008).
61. U. J. Tietge, C. Maugeais, W. Cain, D. J. Rader, Acute inflammation increases selective
uptake of HDL cholesteryl esters into adrenals of mice overexpressing human sPLA2.
Am. J. Physiol. Endocrinol. Metab. 285, E403–E411 (2003). Medline
doi:10.1152/ajpendo.00576.2002
62. C. A. Schneider, W. S. Rasband, K. W. Eliceiri, NIH Image to ImageJ: 25 years of image
analysis. Nat. Methods 9, 671–675 (2012). Medline doi:10.1038/nmeth.2089
63. M. Cuchel, L. T. Bloedon, P. O. Szapary, D. M. Kolansky, M. L. Wolfe, A. Sarkis, J. S.
Millar, K. Ikewaki, E. S. Siegelman, R. E. Gregg, D. J. Rader, Inhibition of microsomal
triglyceride transfer protein in familial hypercholesterolemia. N. Engl. J. Med. 356, 148–
156 (2007). Medline doi:10.1056/NEJMoa061189
64. L. U. Gerdes, C. Gerdes, I. C. Klausen, O. Faergeman, Generation of analytic plasma
lipoprotein profiles using two prepacked Superose 6B columns. Clin. Chim. Acta 205, 1–
9 (1992). Medline doi:10.1016/0009-8981(92)90348-T
65. V. Nambi, L. Chambless, A. R. Folsom, M. He, Y. Hu, T. Mosley, K. Volcik, E. Boerwinkle,
C. M. Ballantyne, Carotid intima-media thickness and presence or absence of plaque
improves prediction of coronary heart disease risk: The ARIC (Atherosclerosis Risk In
Communities) study. J. Am. Coll. Cardiol. 55, 1600–1607 (2010). Medline
doi:10.1016/j.jacc.2009.11.075
66. J. H. Stein, C. E. Korcarz, R. T. Hurst, E. Lonn, C. B. Kendall, E. R. Mohler, S. S. Najjar, C.
M. Rembold, W. S. Post; American Society of Echocardiography Carotid Intima-Media
Thickness Task Force, Use of carotid ultrasound to identify subclinical vascular disease
and evaluate cardiovascular disease risk: A consensus statement from the American
Society of Echocardiography Carotid Intima-Media Thickness Task Force, Endorsed by
the Society for Vascular Medicine,. J. Am. Soc. Echocardiogr. 21, 93–111, quiz 189–190
(2008). Medline doi:10.1016/j.echo.2007.11.011
67. P. A. Harris, R. Taylor, R. Thielke, J. Payne, N. Gonzalez, J. G. Conde, Research electronic
data capture (REDCap)—a metadata-driven methodology and workflow process for
providing translational research informatics support. J. Biomed. Inform. 42, 377–381
(2009). Medline doi:10.1016/j.jbi.2008.08.010
68. M. J. Chapman, S. Goldstein, D. Lagrange, P. M. Laplaud, A density gradient
ultracentrifugal procedure for the isolation of the major lipoprotein classes from human
serum. J. Lipid Res. 22, 339–358 (1981). Medline
69. M. Guerin, T. S. Lassel, W. Le Goff, M. Farnier, M. J. Chapman, Action of atorvastatin in
combined hyperlipidemia : Preferential reduction of cholesteryl ester transfer from HDL
to VLDL1 particles. Arterioscler. Thromb. Vasc. Biol. 20, 189–197 (2000). Medline
doi:10.1161/01.ATV.20.1.189
70. L. Camont, M. Lhomme, F. Rached, W. Le Goff, A. Nègre-Salvayre, R. Salvayre, C.
Calzada, M. Lagarde, M. J. Chapman, A. Kontush, Small, dense high-density lipoprotein-
3 particles are enriched in negatively charged phospholipids: Relevance to cellular
cholesterol efflux, antioxidative, antithrombotic, anti-inflammatory, and antiapoptotic
functionalities. Arterioscler. Thromb. Vasc. Biol. 33, 2715–2723 (2013). Medline
doi:10.1161/ATVBAHA.113.301468
71. D. J. Liu, G. M. Peloso, X. Zhan, O. L. Holmen, M. Zawistowski, S. Feng, M. Nikpay, P. L.
Auer, A. Goel, H. Zhang, U. Peters, M. Farrall, M. Orho-Melander, C. Kooperberg, R.
McPherson, H. Watkins, C. J. Willer, K. Hveem, O. Melander, S. Kathiresan, G. R.
Abecasis, Meta-analysis of gene-level tests for rare variant association. Nat. Genet. 46,
200–204 (2014). Medline doi:10.1038/ng.2852
72. D. Neculai, M. Schwake, M. Ravichandran, F. Zunke, R. F. Collins, J. Peters, M. Neculai, J.
Plumb, P. Loppnau, J. C. Pizarro, A. Seitova, W. S. Trimble, P. Saftig, S. Grinstein, S.
Dhe-Paganon, Structure of LIMP-2 provides functional insights with implications for SR-
BI and CD36. Nature 504, 172–176 (2013). Medline doi:10.1038/nature12684
73. J. R. Nofer, M. van Eck, HDL scavenger receptor class B type I and platelet function. Curr.
Opin. Lipidol. 22, 277–282 (2011). Medline doi:10.1097/MOL.0b013e32834701de
74. V. S. Dole, J. Matuskova, E. Vasile, A. Yesilaltay, W. Bergmeier, M. Bernimoulin, D. D.
Wagner, M. Krieger, Thrombocytopenia and platelet abnormalities in high-density
lipoprotein receptor-deficient mice. Arterioscler. Thromb. Vasc. Biol. 28, 1111–1116
(2008). Medline doi:10.1161/ATVBAHA.108.162347
75. Y. Ma, M. Z. Ashraf, E. A. Podrez, Scavenger receptor BI modulates platelet reactivity and
thrombosis in dyslipidemia. Blood 116, 1932–1941 (2010). Medline doi:10.1182/blood-
2010-02-268508
76. M. A. Connelly, D. L. Williams, SR-BI and cholesterol uptake into steroidogenic cells.
Trends Endocrinol. Metab. 14, 467–472 (2003). Medline doi:10.1016/j.tem.2003.10.002
Top Related