PROTEIN SYNTHESISAND GENE MUTATION
Objectives
2. Discuss the relationships among chromosomes, genes, and DNA.
2.5 Describe the functions of mRNA, tRNA, amino acids, and ribosomes in protein synthesis.
2.6 Describe the causes and effects of both chromosome and gene mutations.
Protein Synthesis
• DNA provides the instructions for how to build proteins
• Each gene dictates how to build a single protein in prokaryotes
• The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein
• Protein synthesis occurs in two primary steps
Protein Synthesis
mRNA (messenger RNA) copy of a gene is synthesized
Cytoplasm of prokaryotesNucleus of eukaryotes
1
mRNA is used by ribosome to build protein
(Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein)
Cytoplasm of prokaryotes and eukaryotes
Some proteins feed directly into rough ER in eukaryotes
2
(eukaryotes)
Protein Synthesis1) INITIATION
• Transcription Initiation RNA polymerase binds to a
region on DNA known as the promoter, which signals the start of a gene
Promoters are specific to genes RNA polymerase does not need
a primer Transcription factors assemble
at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex
Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor
Protein Synthesis1) INITIATION
• Transcription Elongation RNA polymerase
unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another
Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template)• recall RNA uses uracil
instead of thymine
AGTCAT
UCAGUA
Protein Synthesis• Transcription
Elongation RNA polymerase unwinds
the DNA and breaks the H-bonds between the bases of the two strands, separating
them from one another.
Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template)• recall RNA uses uracil
instead of thymine
RNA polymerase catalyzes bond to form between ribose of 3’ nucleotide of mRNA and phosphate of incoming RNA nucleotide
3’
5’
3’
5’
+ ATP
+ ADP
Protein Synthesis• Transcription
ElongationThe gene occurs on only one of the DNA strands; each strand possesses a separate set of genes
Protein Synthesis1) INITIATION
• Transcription Termination A region on DNA known
as the terminator signals the stop of a gene
RNA polymerase disengages the mRNA and the DNA
Exons are “coding” regions
Introns are removed
different combinations of exons form different mRNA resulting in multiple proteins from the same gene
Humans have 30,000 genes but are capable of producing 100,000 proteins
Protein Synthesis• Alternative Splicing (eukaryotes only)
mRNA copy of a gene is synthesized
Cytoplasm of prokaryotesNucleus of eukaryotes
1
Protein Synthesis
mRNA is used by ribosome to build protein
(Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein)
Cytoplasm of prokaryotes and eukaryotes
Some proteins feed directly into rough ER in eukaryotes
2
mRNA
Transcription
Translation
mRNA
tRNA synthesis
Transcription
Translation
mRNA
tRNA synthesis
Protein Synthesis• Translation
Every three mRNA nucleotides (codon) specify an amino acid
Protein Synthesis• Translation
tRNA have an anticodon region that specifically binds to its codon
Transcription
Translation
mRNA
tRNA synthesis
Protein Synthesis• Translation
Each tRNA carries a specific amino acid
Transcription
Translation
mRNA
tRNA synthesis
Protein Synthesis
Aminoacyl tRNA synthetases attach amino acids to their specific tRNA
Protein Synthesis• Translation
Initiation Start codon signals where the gene
begins (at 5’ end of mRNA)
AUGGACAUUGAACCG…
5’ 3’
start codon
Transcription
Translation
mRNA
tRNA synthesi
s
Protein Synthesis• Translation
Initiation Start codon signals where the
gene begins (at 5’ end of mRNA)
Ribosome binding site (Shine Dalgarno sequence) upstream from the start codon binds to small ribosomal subunit– then this complex recruits
the large ribosomal subunit
Small ribosomal subunit
Small ribosomal subunit
Ribosome
Large ribosomal subunit
Protein Synthesis• Translation
ScanningThe ribosome moves in 5’ to 3’ direction “reading” the
mRNA and assembling amino acids into the correct protein
large ribosome subunit
small ribosome subunit
Protein Synthesis• Translation
ScanningThe ribosome moves in 5’ to 3’ direction “reading” the
mRNA and assembling amino acids into the correct protein
Protein Synthesis• Translation
TerminationRibosome disengages from the
mRNA when it encounters a stop codon
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGCSerine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGCSerine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
S – Y –H– T – H – P – S – S – S - S
Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser
Protein Synthesis• Multiple RNA polymerases
can engage a gene at one time
• Multiple ribosomes can engage a single mRNA at one timeDNA mRNAs
Transcription
Translation
Protein Synthesis• Eukaryotes:
transcription occurs in the nucleus and translation occurs in the cytoplasm
• Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm
• There are four main types of RNA:1. mRNA
- RNA copy of a gene used as a template for protein synthesis
2. rRNA - part of structure of ribosomes
3. tRNA- amino acid carrier that matches to mRNA codon
4. snRNA - found in nucleus where they have several important jobs
RNA
Top Related