Download - Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Transcript
Page 1: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Microsatellite Identification in the Thick-Microsatellite Identification in the Thick-billed Parrot (billed Parrot (Rhynchopsitta Rhynchopsitta

pachyrhynchapachyrhyncha)) By: By:

Daniel Acosta Daniel Acosta Howard Hughes Medical Institute-NMSU Research Howard Hughes Medical Institute-NMSU Research

ScholarScholar

Dr. Wright’s LabDr. Wright’s LabDepartment of BiologyDepartment of Biology

Page 2: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Thick-billed Parrot

• International Union for Conservation of Nature (IUCN 2007)

• World Parrot Trust

• Historic range: Southwestern United States and Northern Mexico (Snyder et. al., 1999)

• Habitat degradation and fragmentation from logging

Page 3: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Range

Page 4: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Genetic Variation• High degree of genetic variation to reduce

the impact of founder effect, which may lead to genetic differentiation

• To adapt to a changing environment and to avoid reduced reproductive fitness.

• Importance to any translocation.

Page 5: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Microsatellites

• Microsatellites are simple sequence repeats (1-6) base pairs long: e.g. GTGTGTGTGTGT or ACGACGACGACGACGACGACG found in the genome of both prokaryotic and eukaryotic organisms

• Found in coding and non-coding regions

• They have a high mutation rate and high variability in natural populations.

• High degree of polymorphism

• All of these characteristics makes microsatellites a class of genetic marker that is highly useful to assess genetic variation.

Page 6: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Methods: Isolation of Microsatellites

DNA Extraction

Boil clone in TE buffer

Genetic LibraryPCR

T3/T7

T3/T7/GT10(Zane et. al. 2002)

(Kongrit et. al., 2008)

Page 7: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Methods: Primer Design Sequencing Primer Design

Test for amplification in thick-billed parrot DNA

Optimize Primers

Polymorphism

CCGAGTAGGACAGAGCCTTGGGTGGCATGGTTTAGTGGGAGGTGTCCCTGCCCACGGCATGGGGTTTGGAACTAGATGATCTTAAGGTCCTTTACAGCCCTAACTGTTCTATGATTCTATTGGGTCTCAAGGGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCATTTTCCTCTTCAGGGTGGAATAAGAGCCTTGAATTACAACATTAAACCTTTTAAATGG

Page 8: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Polymorphism

• Having genetic diversity

• Proportion of loci polymorphic: Number of polymorphic loci / total number of loci sampled

• We can also calculate allelic diversity: If we have sampled 6 loci and the diversity is as follows (1, 3, 3, 2, 2, 3) Allelic diversity=(1+3+3+2+2+1) / 6 = 2

• These calculations tell us a great deal about the genetic variation of the target population

Page 9: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Progress and Future Goals

• Up to date: 3 primers we designed and 4 designed for other species.

• These primers have been optimized for [Mg] and annealing temperature.

• We now propose to use these primers to assess the genetic variation not only of the wild population, but of the captive population.

• Compare wild population to captive population

Page 10: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Acknowledgements

• Howard Hughes Medical Institute-NMSU Research Program • Dr. Timothy Wright • Ph. D Student Erin Schirtzinger• Ph. D Student Swati Mukherjee• Ph. D Student Alejandro Salinas• Nadine Lamberski @ San Diego Zoo• Kari L. Schmidt. @ American Museum of Natural History

Page 11: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

References

IUCN 2007. Rhynchopsitta pachyrhyncha. <http://www.iucnredlist.org/search/details.php/19715/all> (March 26, 2 008 2007).

Kongrit, C. et. at. (2008). Isolation and characterization of dinucleotide

microsatellite loci in the Asian elephant (Elephas maximus). Molecular

Ecology 8, 175-177

Snyder, N. F. R., E. C. Enkerlin-Hoeflich, and M. A. Cruz-Neto. 1999. Thick-billed Parrot (Rhynchopsitta pachyrhyncha) The Birds of North America 24

Zane, L., Bargelloni, L., & Patarnello, T. (2002). Strategies for microsatellite

isolation: a review. Molecular Ecology 11, 1-16g

Page 12: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Picture Sources• http://www.avianweb.com/images/birds/parrots/thickbilledparrots/thickbilled.jpg

• (map) http://content.cdlib.org/xtf/data/13030/xw/ft0f59n6xw/figures/ft0f59n6xw_00001.gif

• http://www.aviary.org/~aviary/images/thick-billed%20parrots.jpg

• http://www.dkimages.com/discover/previews/928/55058803.JPG

• http://www.sabo.org/images/tbpanest.jpg

• http://www.expeditionswest.com/adventures/2004/sierra_madre/JourneyOneSatevo/images/DSCF3627.jpg

Page 13: Microsatellite Identification in the Thick-billed Parrot ( Rhynchopsitta pachyrhyncha )

Questions??Questions??