Download - Identify the type of mutation: 1.Gene or Chromosome 2. Point, Frame Shift, Deletion, Duplication, Inversion, or Translocation TACCCATGGATGCTACCCCTGGATGC.

Transcript

Identify the type of mutation: Identify the type of mutation: 1.Gene or Chromosome1.Gene or Chromosome2. Point, Frame Shift, Deletion, Duplication, 2. Point, Frame Shift, Deletion, Duplication, Inversion, or TranslocationInversion, or Translocation

TACCCATGGATGCTACCCATGGATGC

TACCCCTGGATGCTACCCCTGGATGC

QRST UVWXQRST UVWX

QRSSST UVWXQRSSST UVWX

QRST UVWXQRST UVWX

QR UVWXQR UVWX

TACCCATGGATGCTACCCATGGATGC

TACCATGGATGCTACCATGGATGC

TACCCATGGATGCTACCCATGGATGC

TAGCCCATCCATGCTAGCCCATCCATGC

QRST UVWXQRST UVWX

QRVU TSWXQRVU TSWX

QRST UVWXQRST UVWX

ABC DEFWXABC DEFWX

TACCCATGGATGCTACCCATGGATGC

TACCGATGCATCGTACCGATGCATCG

Warm-Up #17 2/22/13

Mutation Quiz Study GuideMutation Quiz Study Guide1)1) What is a mutation?What is a mutation?2)2) What are the 2 causes of What are the 2 causes of

mutations?mutations?3)3) What are the 3 affects of mutation?What are the 3 affects of mutation?4)4) What is a mutagen? List 5 What is a mutagen? List 5

examples.examples.5)5) What two places can a mutation What two places can a mutation

occur (in the body)?occur (in the body)?6)6) What are the 2 types of mutations? What are the 2 types of mutations?

How are they different?How are they different?7)7) What is nondisjunction? What are What is nondisjunction? What are

the 3 types.the 3 types.8)8) Be able to identify these types of Be able to identify these types of

mutations. (ON NEXT SLIDE)mutations. (ON NEXT SLIDE)9)9) Be able to find the mutation in the Be able to find the mutation in the

chart. (ON NEXT SLIDE)chart. (ON NEXT SLIDE)

8

9

THESE WERE ON YESTERDAY’S HOMEWORK

Warm-Up #16 2/21/13Warm-Up #16 2/21/131) What did the scientist Franklin discover?1) What did the scientist Franklin discover?2) Watson and crick are responsible for 2) Watson and crick are responsible for

what?what?3) What type of RNA is pictured?3) What type of RNA is pictured?

4) What is polymerase and what does it do?4) What is polymerase and what does it do?5) Using the following words list the steps to 5) Using the following words list the steps to

transcription and translation. transcription and translation. Nucleus, mRNA, tRNA, Ribosome, DNA, Nucleus, mRNA, tRNA, Ribosome, DNA,

Amino AcidsAmino Acids

MUTATIONSMUTATIONS

Unit 7: Molecular Genetics

Chapters 12 & 13

Today is About…Today is About… Essential Question:Essential Question:

How can a mutation How can a mutation in DNA affect an in DNA affect an organisms ability to organisms ability to survive?survive?

ESSENTIAL ESSENTIAL

QUESTION QUESTION

is on back ofis on back of

the notes!the notes!

Objectives:Objectives:

1.1. Contrast gene mutations Contrast gene mutations and chromosomal and chromosomal mutationsmutations

2.2. Describe a typical geneDescribe a typical gene

3.3. Describe how the Describe how the laclac genes are turned on and genes are turned on and offoff

4.4. Explain how must Explain how must eukaryotic genes are eukaryotic genes are controlledcontrolled

5.5. Relate gene regulation Relate gene regulation to developmentto development

Mutations can be Mutations can be visiblevisible

Polydactyly

Conjoined twins

Or microscopic!Or microscopic!

Sickle cell anemia

Mutations can be fatalMutations can be fatal

Spina bifida

Or cause medical disorders.Or cause medical disorders.

Hemophilia

MutationMutation

A change in the genetic material.A change in the genetic material.

MutationsMutations

May be harmful, beneficial, or May be harmful, beneficial, or cause no effect.cause no effect. Harmful Mutation: Sickle CellHarmful Mutation: Sickle Cell Beneficial Mutation: Antibiotic Resistant Bacteria Beneficial Mutation: Antibiotic Resistant Bacteria

(beneficial to the bacteria)(beneficial to the bacteria) No Effect Mutation: Same Protein MadeNo Effect Mutation: Same Protein Made

May occur in May occur in somaticsomatic cellscells—not inheritable.—not inheritable. May occur in May occur in gametesgametes—inheritable.—inheritable.

Mutations are caused by mutagens.Mutations are caused by mutagens.

RadiationRadiation HormonesHormones VirusesViruses TemperatureTemperature ChemicalsChemicals

Two types of mutations:Two types of mutations:

Gene mutationsGene mutations Chromosomal mutationsChromosomal mutations

Gene mutationsGene mutations involve involve individual genes (proteins). Two individual genes (proteins). Two

types are:types are: PointPoint mutations- mutations--change of one -change of one

nucleotidenucleotide. (substitution). (substitution) Frame shiftFrame shift mutations- mutations--loss or -loss or

gain of one nucleotide.gain of one nucleotide. Examples include sickle cell Examples include sickle cell

anemia, cystic fibrosis, and anemia, cystic fibrosis, and Duchenne muscular dystrophy.Duchenne muscular dystrophy.

Substitution InsertionDeletion

Point FrameshiftMutation Mutations

Chromosomal mutationsChromosomal mutations involve segments or whole involve segments or whole

chromosomes.chromosomes.

NondisjuntionNondisjuntion DeletionDeletion DuplicationDuplication InversionsInversions TranslocationsTranslocations

Nondisjunction (ON BACK)Nondisjunction (ON BACK)

One cellOne cell has an extra chromosome while has an extra chromosome while the other lacks one.the other lacks one.

During meiosis chromosomes During meiosis chromosomes stick stick togethertogether instead of pulling apart instead of pulling apart

Produces an odd number of chromosomesProduces an odd number of chromosomes Ex. get Ex. get 4545 oror 4747-- Instead of 46 normal – Instead of 46 normal –

Types of Nondisjuction Types of Nondisjuction (ON BACK) (ON BACK)

TrisomyTrisomy – – 1 extra chromosomes1 extra chromosomes Down’s Syndrome, Down’s Syndrome, three of chromsome 21three of chromsome 21 Klinefleter’s Syndrome – Klinefleter’s Syndrome – Extra X = XXYExtra X = XXY Jacob’s syndrome- Jacob’s syndrome- Extra Y= XYYExtra Y= XYY

MonosomyMonosomy – – missing chromosomemissing chromosome Ex. Turner’s Syndrome – Ex. Turner’s Syndrome – Female with 1 X = OXFemale with 1 X = OX

PolyploidPolyploid – – 4 or more chromosomes4 or more chromosomes Instead of 1n, gametes are 3n or 4nInstead of 1n, gametes are 3n or 4n Common in plantsCommon in plants Lethal in humansLethal in humans

Del ionsDel ions

Part of or an entire chromosome Part of or an entire chromosome is missing.is missing.

The entire B gene has been deleted from the chromosome.

Deletion

EX: Cri du Chat is a deletion EX: Cri du Chat is a deletion mutation. An affect person mutation. An affect person

sounds like a cat when they cry.sounds like a cat when they cry.

Part of Part of chromosome 5 is chromosome 5 is missing in this rare missing in this rare genetic disorder.genetic disorder.

DuplipliplicatioDuplipliplicationn

Part of a Part of a chromosomchromosome is e is duplicated.duplicated.

Duplication

The entire B gene has been duplicated so there are two copies of it on one chromosome.

Fragile X Fragile X SyndromeSyndrome

One of the most common causes of mental retardation is Fragile X syndrome where there are 55-200 copies of a gene on the X chromosome.

InvInv Part of a Part of a

chromosome chromosome is cut out and is cut out and reattached in reattached in the wrong the wrong direction.direction.

er

sions

Inversion

The B and C genes have flipped around with the D and E genes.

Chromosome inversionChromosome inversion

Normal chromosome

Chromosome with inversion--often has normal individual.

Trans tionsTrans tions Part of a Part of a chromosome is chromosome is cut out and cut out and reattached on reattached on a differenta differentlocaloca chromosome.chromosome.

Translocation

The DEF and JKL genes have broken off and moved to another chromosome.

Philadelphia translocationPhiladelphia translocation

This is found This is found in tumor in tumor cells of cells of patients with patients with chronic chronic myelogenoumyelogenous leukemia.s leukemia.

CML (Leukemia) vs. healthy bloodCML (Leukemia) vs. healthy blood

Gene regulationGene regulation

A cell only uses some A cell only uses some genes; other genes are kept genes; other genes are kept “silent” (turned off).“silent” (turned off).

Sites near the promoter Sites near the promoter determine if a gene is turned determine if a gene is turned on or off.on or off.

Gene regulationGene regulation

Prokaryotes have operons-Prokaryotes have operons-genes that work together genes that work together and can be turned on and and can be turned on and off.off.

Gene regulationGene regulation

Eukaryotes control genes Eukaryotes control genes individuallyindividually

A liver cell has all of the A liver cell has all of the genetic code- uses only parts genetic code- uses only parts of the code needed for liver of the code needed for liver functions.functions.

PLEASE play mutation video located on the desk top now