The ATM/p53/p21 pathway influences cell fate decision
between apoptosis and senescence in reoxygenated
hematopoietic progenitor cells
Xiaoling Zhang1, June Li1, Daniel P. Sejas1, and Qishen Pang1,2* Form 1Division of Experimental Hematology, Cincinnati Children's Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, Ohio 45229, and 2Department of Pediatrics University of Cincinnati College of Medicine. 3125 Eden Avenue, Cincinnati, Ohio 45267
Running title: Reoxygenation induces hematopoietic cell senescence
*To whom reprint requests should be addressed. Division of Experimental Hematology, Cincinnati Children's Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, Ohio 45229. Phone: (513) 636-1152. Fax: (513) 636-3768. E-mail: [email protected].
1 The abbreviations used are: AA, aplastic anemia; 2-AP, 2-aminopurine; ATM,
Ataxia-Telangiectasia Mutated; HSC, hematopoietic stem cell; FA, Fanconi Anemia; IL, interleukin; NAC, N-acetyl-L-cysteine; SCF, stem cell factor; siRNA,
small interfering RNA.
1
JBC Papers in Press. Published on March 7, 2005 as Manuscript M502262200
Copyright 2005 by The American Society for Biochemistry and Molecular Biology, Inc.
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
ABSTRACT
Hematopoietic cells are often exposed to transient hypoxia as they
develop and migrate between blood and tissues. We tested the hypothesis that
hypoxia-then-reoxygenation represent a stress for hematopoietic progenitor cells.
Here we report that reoxygenation-generated oxidative stress induced
senescence, tested as staining for SA-β-gal, of bone marrow progenitor cells.
Reoxygenation induced significant DNA damage and inhibited colony formation
in lineage-depleted bone marrow cells enriched for progenitor cells. These
reoxygenated cells exhibited a prolonged G0/G1 accumulation without significant
apoptosis after 24 hours of treatments. Reoxygenated bone marrow progenitor
cells expressed SA-β-galactosidase and senescence-associated proteins p53
and p21WAF1. Reoxygenated Fancc-/- progenitor cells, which underwent
significant apoptosis and senescence, tested as staining for SA-β-gal, also
expressed p16INK4A. Suppression of apoptosis by the pan-caspase inhibitor Z-
VAD-FMK dramatically increased senescent Fancc-/- progenitor cells.
Senescence induction, tested as staining for SA-β-gal, in reoxygenated
progenitor cells was closely correlated with extent of DNA damage and
phosphorylation of ATM at Ser1981 and p53 at Ser15. Moreover, inhibition of
ATM signaling reduced SA-β-gal positivity but increased apoptosis of
reoxygenated progenitor cells. Thus, these results suggest that the ATM/p53/p21
pathway influences cell fate decision between apoptosis and senescence in
reoxygenated hematopoietic progenitor cells.
2
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
INTRODUCTION
Hematopoietic cells are often exposed to transient hypoxia and
reoxygenation as they develop and migrate between blood and tissues.
Continuous cycles of hypoxia-then-reoxygenation has long been known to
increase in the production of oxidants (1), which could cause DNA damage,
protein oxidation, and lipid peroxidation (2, 3). In human colorectal cell line RKO
and lymphoblasts, hypoxia-then-reoxygenation induces DNA damage and
activates p53, which can be inhibited by the anti-oxidant N-acetyl-L-cysteine
(NAC) (4). Furthermore, reoxygenation-induced DNA damage and p53 activation
is dependent on the protein kinase ATM (Ataxia-Telangiectasia Mutated; 4, 5).
Oxidative stress-induced DNA damage is well known to cause loss of cell
replication and multiple molecular changes involved in premature senescence,
such as up-regulation of senescence-associated proteins p53, p21WAF1 and
p16INK4A, and permanent growth arrest (6). Little is known about the effects of
reoxygenation-generated oxidative stress on the survival and maintenance
hematopoietic progenitor and stem (HSC) cells.
Studies on pathophysiological mechanisms of oxidative stress responses
in stem cell diseases such as aplastic anemia (AA) has been very instructive and
provides insights into the function of normal hematopoietic stem cells and their
self-renewal capacity (7). One of the well-studied AA disease models is Fanconi
anemia (FA), a genetic disorder characterized by progressive bone marrow
failure and a predisposition to cancer (8, 9). We hypothesized that hypoxia-
3
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
reoxygenation represents a physiological stress for HSC and progenitor cells,
particularly those from FA patients, and sought to determine the molecular
response of hematopoietic progenitor cells to reoxygenation-generated oxidative
stress. Our study demonstrates that oxidative stress generated by reoxygenation
can induce premature senescence, tested as staining for SA-β-gal, of Fancc-/-
hematopoietic progenitor cells through the ATM/p53/p21 pathway and suggests
that stress-induced senescence may be a novel mechanism underlying
hematopoietic cell depletion in bone marrow (BM) failure diseases including FA.
4
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
EXPERIMENTAL PROCEDURES
Mice, Isolation of BM Lin Sca-1 c-kit (LSK) Cells, and - + + Treatments-- WT
and Fancc-/- mice were generated by interbreeding the heterozygous Fancc+/-
mice (a gift from Dr. Manuel Buchwald, University of Toronto; 10). Lineage-
negative (Lin )- cells were isolated using a lineage cell depletion kit (Miltenyi
Biotec Inc.) in accordance with Manufacturer’s instruction. BM Lin cells - were
then stained with Sca-1-PE and c-kit-APC antibodies followed by cell sorting
using a FACSCalibur (Becton Dickinson, San Jose, CA). The resulting LSK cells
were cultured in IMDM medium containing stem cell factor (SCF;100 ng/ml),
interleukin (IL)-6 (20 ng/ml) and Flt-3L (50 ng/ml) (R & D Systems). Three sets of
cells were incubated in parallel: (1) the control cultures were incubated at 37 oC
in normoxia (humidified air with 21% O2, 5% CO2); (2) the reoxygenated cultures
were subjected to hypoxia (1% O2) for 4 h then shifted to 21% O2; (3) the
reoxygenated-NAC cultures were the same as those in (2) except that the
medium contained the anti-oxidant N-acetyl-L-cysteine (NAC) at a concentration
of 1mM. Pan-caspase inhibitor Z-VAD-FMK (Calbiochem) was added to cell
cultures immediately after reoxygenation at 100 µM. For 2-aminopurine (2-AP)
treatment, cells were incubated with 10 mM 2-AP (Sigma) during hypoxia-
reoxygenation treatments.
Apoptosis Assay-- Aliquots of 1 × 105 BM Lin cells - were stained with Sca-
1-PE and c-kit-APC antibodies followed by annexin V staining. These
experiments also included PE and APC isotype controls, and FITC positive and
5
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
negative controls. Apoptosis was therefore analyzed in different populations of
Lin- cells by flow cytometry.
Clonogenic Progenitor Cell Assays and BM Transplantation -- BM LSK
cells were subjected to hypoxia-reoxygenation with or without 2-AP, and cultured
in a 35 mm tissue culture dish in 4 ml of semisolid medium containing 3 ml of
MethoCult M 3134 (Stem Cell Technologies) and the following growth factors:
100 ng/mL SCF, 10 ng/mL IL-3, 100 ng/mL G-CSF, and 4 U/mL erythropoietin.
Colonies (CFCs) were counted on day 7. To evaluate the effect of reoxygenation
on the repopulation ability of the BM progenitor cells, we used a NOD/SCID
repopulation assay. NOD/SCID mice (Jackson Laboratories) were handled under
sterile conditions and maintained under microisolaters. WT or Fancc-/- BM (2 x
106) cells were transplanted by tail-vein injection into sublethal irradiated (3.5 Gy)
8-week-old mice along with 5 x 105 competitor cells. BM cells from the
transplanted mice were stained with H2kb-PE (for donor-derived cells) and H2kd-
FITC (for recipient-derived cells) antibodies (BD Pharmingen), and analyzed by
flow cytometry to detect donor-derived hematopoietic progenitors.
SiRNA and Assays for DNA Damage and Senescence – The siRNA
oligonucleotides targeting nucleotides 8111-8131 of mouse ATM mRNA
(GeneBank sequence accession number NM007499;
GGTGACTATAAAATCATTTAA) were cloned in the pSM2c retroviral vector
(Open Biosystems). Infected cells were selected for puromycin resistance. The
generation of DNA strand breaks in control and reoxygenated BM LSK cells was
6
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
assessed by the single cell gel electrophoresis (comet) assay (11), using a Fpg-
FLARE (fragment length analysis using repair enzymes) comet assay kit in
accordance with the manufacturer's instructions (Trevigen). SA-β-gal activity was
determined using a SA-β-galactosidase (SA-β-gal) staining kit (Cell Signaling
Technology) according to the manufacturer’s instruction.
Immunocytochemistry – BM LSK cells were stained with primary
antibodies (monoclonal anti-ATMser1981, Rockland Immunochem. Res.;
monoclonal anti-p53ser15, and polyclonal anti-p21WAF1, Cell Signaling; monoclonal
anti-p16, Santa Cruz Biotechnologies), and then with Rhodamine Red-X -
conjugated Goat Anti-Rabbit IgG or Rhodamine Red-X -conjugated Goat Anti-
mouse IgG (Jackson Immuno Research). Nuclei were counter-stained with DAPI
(Sigma).
Statistics--Data was analyzed statistically using a Student’s t test. The
level of statistical significance stated in the text was based on the p values.
P < 0.05 was considered statistically significant.
7
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
RESULTS AND DISCUSSION
Reoxygenation-generated Oxidative Stress Induces DNA Damage and
Inhibits Colony Formation in BM Progenitor Cells – Because reoxygenation
represents oxidative stress to the cell and oxidative stress induces DNA damage
(2, 4, 6), we first sought to determine whether hypoxia-then-reoxygenation
caused DNA damage in BM progenitor cells. Analysis of DNA strand breaks by
comet assay revealed that there was increased accumulation of DNA damage in
reoxygenated Lin-Sca-1+c-kit+ (KSL) BM cells compared to untreated
counterparts (Fig. 1A). The Fancc-deficient mice have profound defect in the
hematopoietic stem and progenitor cell compartment and FA HSCs and
progenitors have been shown to be hypersensitive to a variety of stresses
including oxidative stress (8, 12, 13). Consistent with these observations,
reoxygenated Fancc-/- KSL cells induced significant (3.8-fold) more DNA strand
breakage than reoxygenated WT KSL cells (Fig. 1A). Treatment of reoxygenated
WT or Fancc-/- KSL cells with the anti-oxidant NAC completely abrogated the
effect (Fig. 1A), suggesting that the DNA damage was generated by oxidative
stress. The number of colony-forming cells (CFC) derived from both
reoxygenated WT and Fancc-/- BM progenitors was significantly decreased
compared to their untreated counterparts and NAC completely restored
progenitor activity of these reoxygenated KSL cells (Fig. 1B).
Reoxygenated BM Progenitor Cells Undergo Growth Arrest and Have
Reduced BM Repopulating Ability – While reoxygenation induced more apoptosis
in Fancc-/- BM KSL cells than in WT KSL cells shortly after exposure to high
8
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
oxygen, apoptotic cells decreased thereafter (Fig. 1C). In addition, the extent of
the increase was not as significant as reoxygenation-generated DNA damage at
24 h post-reoxygenation (compare Fig. 1A). Actually, apoptosis decreased to
basal level 48 h post-reoxygenation (Fig. 1C). Thus, apoptosis is not the major
consequence of the DNA damage. We therefore evaluated the cell cycle profile
of these BM cells. Reoxygenated BM cells clearly exhibited a prolonged G0+G1
accumulation (Fig. 1D), suggesting that there might exist an overactivated G0/G1
checkpoint in these BM progenitor cells. The marrow repopulating ability of
reoxygenated progenitors was assessed by transplanting equal numbers of either
untreated (control) or reoxygenated progenitors into sub-lethally irradiated
NOD/SCID recipients. Engraftment was evaluated 4 weeks after transplantation
by flow cytometric determination of donor-derived cells (H2kb+) in BM cell
suspensions of the bone marrow harvested from recipient animals. The bone
marrow of animals that received transplants of reoxygenated WT or Fancc-/- cells
showed 2- or 3-fold lower engraftment than the untreated counterparts,
respectively (Fig. 1E). Consistent with others’ observation (10), Fancc deficiency
impairs the repopulating ability of Fancc-/- BM progenitors.
Cell Fate Choice between Senescence, Test as Staining for SA-β-gal, and
Apoptosis in Reoxygenated BM Progenitor Cells - Because reoxygenated BM
progenitor cells underwent G0/G1 arrest, we reasoned that stress-induced
senescence might be one fate of these cells. To examine this possibility, we
stained WT and Fancc-/- BM KSL cells for SA-β-galactosidase, a biomarker for
senescence (14). Nearly 20% of the reoxygenated WT KSL cells and more than
9
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
40% of the reoxygenated Fancc-/- KSL cells stained positive for SA-β-
galactosidase activity after 48 h of reoxygenation (Fig. 2A).
Because we observed reoxygenation-induced apoptosis, especially in
Fancc-/- BM progenitor cells, we asked whether blockage of apoptosis would
increase senescence, tested as staining for SA-β-gal, in these reoxygenated BM
cells. Indeed, when these reoxygenated BM KSL cells were incubated in the
presence of the pan-caspase inhibitor Z-VAD-FMK, more than 60% of the Fancc-
/- cells entered senescence, tested as staining for SA-β-gal, compared to ~ 40%
without the apoptotic inhibitor (Fig. 2B). Therefore, reoxygenated Fancc-/- BM
progenitor cells blocked for apoptosis may be prone to developing senescence.
Reoxygenation-induced Senescence, Test as Staining for SA-β-gal, in BM
Progenitor Cells Involves the ATM/p53/p21WAF1 Pathway - Because
reoxygenation induces DNA damage and subsequent p53 activation, which is
dependent on the ATM kinase (4, 5), we asked whether reoxygenation-induced
senescence, tested as staining for SA-β-gal, in BM progenitor cells involves the
ATM/p53/p21WAF1 pathway. We examined the reoxygenation-induced
phosphorylation of ATM (Ser1981) and p53 (Ser15), and expression of p21 in
BM KSL cells. ATM autophosphorylation at Ser1981 activates the kinase and is
largely responsible for phosphorylating p53 at Ser15 in response to DNA damage
(15, 16). We found approximately 20% each of ATMSer1981- and p53Ser15-
positive (Fig. 3A-B) in reoxygenated WT BM KSL cells. In reoxygenated Fancc-/-
BM KSL cells, the intensity and percentages of cells stained positive for
10
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
ATMSer1981 and p53Ser15 increased significantly (Fig. 3A-B). We also found
that higher levels of p21-positive (22%) stained cells were present in
reoxygenated WT BM KSL cells compared to untreated WT cells. The
percentage of p21-positive cells increased to 66% in those FA BM KSL cells (Fig.
3A-B).
To provide evidence that there is a link between activation of the
ATM/p53/p21 pathway and senescence, we wanted to know whether blockage of
ATM signaling inhibited reoxygenation-induced senescence, tested as staining
for SA-β-gal, in BM progenitor cells. It is known that inhibition of ATM can relieve
senescent cell cycle arrest (17). We used both siRNA and the kinase inhibitor 2-
AP, which has been shown to suppress ATM activation (18, 19). BM KSL cells
expressing the ATM siRNA or treated with 2-AP effectively reduced ATMSer1981
and p53Ser15 in reoxygenated WT and Fancc-/- BM KSL cells (Fig. 3C-D). We
then determined progenitor activity of these reoxygenated BM KSL cells in a
clonogenic assay (Fig. 3E). Our prediction was that if inhibition of ATM reversed
senescence, tested as staining for SA-β-gal, then the senescence-reversed cells
would be able to proliferate as reflected by the enhanced progenitor activity.
Interestingly, reoxygenated WT BM KSL cells expressing ATM siRNA or treated
with 2-AP exhibited increased clonogenic ability (nearly restored colony formation
to the level of untreated WT BM KSL cells; Fig. 3E). However, both siATM and 2-
AP treatments had little affect on progenitor activity of the reoxygenated Fancc-/-
BM KSL cells (Fig. 3E).
11
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Recent reports show that the ability of the cell to relieve senescent cell
cycle arrest or reverse senescence depends on the levels of p16INK4A expression
(19, 20). Our observations that inhibition of ATM signaling increased clonogenic
ability (Fig. 3E) of WT but not Fancc-/- progenitor cells led us to examine the
relationship between p16INK4A expression and senescence, tested as staining for
SA-β-gal. Reoxygenation hardly induced p16INK4A expression in WT BM KSL
cells, but did so strongly in Fancc-/- BM KSL cells (Fig. 3F). Expression of siATM
or 2-AP treatment reduced p16 expression in reoxygenated WT cells but did not
have detectable effect on Fancc-/- BM KSL cells (Fig. 3F), indicating that
reoxygenation-induced p16INK4A expression in Fancc-/- BM KSL cells was
independent of ATM activity. However, when we correlated ATM inhibition and
p16INK4A expression with SA-β-gal activity, we found that reoxygenated WT BM
KSL cells treated with 2-AP and siATM were almost devoid of SA-β-gal-positive
cells (decreased from 14.6% to 2.5 and 3.3%, respectively; Fig. 3D). In contrast,
inhibition of ATM activity did not significantly reduced SA-β-gal staining in
reoxygenated Fancc-/- BM KSL cells, which expressed high levels of p16INK4A
(Fig. 3F). Interestingly, inhibition of ATM activity increased apoptosis in
reoxygenated WT and Fancc-/- BM KSL cells (Fig. 3F). These results indicate
that inhibition of ATM can reverse senescence, tested as staining for SA-β-gal, of
BM progenitor cells that do not or express low level of p16, and suggest that the
ATM/p53/p21 pathway influences cell fate decision between apoptosis and
senescence in reoxygenated hematopoietic progenitor cells.
12
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
In summary, we have shown that (1) reoxygenation-generated oxidative
stress induced DNA damage and G0/G1 arrest in BM progenitor cells without
significant apoptosis, (2) reoxygenation induced senescence, test as staining for
SA-β-gal, in reoxygenated BM progenitor cells, (3) induction of senescence,
tested as staining for SA-β-gal, in reoxygenated BM progenitor cells closely
correlated with extent of DNA damage and phosphorylation of ATM at Ser1981
and p53 at Ser15, and (4) inhibition of ATM signaling reversed reoxygenation-
induced senescence, tested as staining for SA-β-gal, but increased apoptosis in
BM progenitor cells. Thus, these results suggest that reoxygenation induces
senescence in hematopoietic progenitor cells through the ATM/p53/p21 pathway.
These findings are especially relevant to the survival and maintenance of
hematopoietic progenitor cells that are often exposed to transient hypoxia in vivo
and, since hematopoietic stem/progenitor cell depletion is the major cause of BM
failure occurred in aplastic anemia including FA, to the molecular etiology of BM
diseases.
We demonstrated that the ATM kinase played a major role in transducing
the reoxygenation-induced DNA damage signal in BM progenitor cells.
Reoxygenation can generate oxidative stress, which can damage DNA. It is
known that ATM transmits the signal of DNA damage induced by oxidative
stress. For instance, oncogenic insults promote the accumulation of reactive
oxygen species, resulting in DNA damage and apoptosis by a p53-dependent
pathway (21-23). More recently, ATM has been shown to play an essential role in
transmitting DNA damage signals generated by reoxygenation, through
13
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
phosphorylation of p53Ser15 (4, 5). We used siRNA targeting ATM and the
protein kinase inhibitor 2-AP to investigate the involvement of ATM in DNA
damage response of reoxygenated BM progenitor cells. Inhibition of ATM
signaling resulted in reduction of ATM-Ser1981, p53Ser15 and p21 expression
and reversal of senescence, tested as staining for SA-β-gal, in reoxygenated BM
progenitor cells but sensitized these BM cells to apoptosis (Fig. 3). Our results
thus indicate for the first time that senescence, tested as staining for SA-β-gal,
induction in reoxygenated BM progenitor cells is regulated by the ATM/p53/p21
pathway. We propose the existence of distinct mechanisms for WT and Fancc-/-
BM cells with regard to cell cycle arrest in response to DNA damage induced by
reoxygenation-generated oxidative stress. Upon experiencing DNA damage, WT
BM cells initially arrest cell cycle progression by ATM-dependent activation of the
G1 checkpoint to gain time for DNA repair. The major pathway responsible for
triggering the G1 checkpoint involves the activation of p53 by ATM, the p53-
mediated induction of p21, and a reduction in the level of RB phosphorylation. If
the DNA damage cannot be repaired timely, the cells undergo reversal
senescence to prevent accumulation of genetic mutations until the damage has
been repair. In Fancc-/- BM progenitor cells, however, excessive DNA damage
causes overactivation of the ATM kinase, resulting in a hyperactive G1
checkpoint. The arrested Fancc-/- BM cells enter senescence while the DNA
damage remains unrepaired. Inhibition of ATM in these FA cells thus likely
results in bypass of G1 checkpoint and undergoing apoptosis.
14
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Acknowledgements--We thank Dr. Manuel Buchwald (Hospital for Sick
Children, University of Toronto) for the Fancc+/- mice. Q.P. thanks Dr. Grover
Bagby (Oregon Health Science University) for continued support.
This work was supported by an American Cancer Society (Ohio Division)
Support grant, a Fanconi Anemia Research Fund grant, and a Trustee grant from
the Cincinnati Children’s Hospital Medical Center to Q.P.
REFERENCES
1. Kogure, K., Watson, B.D., Busto, R., and Abe, K. (1982) Neurochem Res.
7,437-454.
2. Ames, B.N., Shigenaga, M.K., and Hagen, T.M. (1993) Proc Natl Acad Sci U
S A. 90,7915-7922.
3. Stadtman, E.R. (1992) Science. 257,1220-1224.
4. Hammond, E.M., Dorie, M.J., and Giaccia, A.J. (2003) J Biol Chem.
4,278:12207-12213.
5. Hammond, E.M., and Giaccia AJ. (2004) DNA Repair (Amst). 3,1117-1122.
6. Chen, Q.M. (2000) Ann N Y Acad Sci. 908,111-125.
7. Maciejewski, J.P., and Risitano, A. (2003) Arch Med Res. 34,520-527.
8. Bagby, G.C. Jr. (2003) Curr Opin Hematol. 10,68-76.
9. D'Andrea, A.D. and Grompe, M. (2003) Nat. Rev. Cancer. 3,23-34.
10. Chen, M., Tomkins, D., Auerbach, W., McKerlie,. C, Youssoufian, H., Liu, L.,
Gan, O., Carreau, M., Auerbach, A., Groves, T., Guidos, C., Freedman, M.,
15
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Cross, J., Percy, D., Dick, J., Joyner, A., and Buchwald, M. (1996) Nature
Genet. 12,448-451.
11. Tice, R.R., Agurell, E., Anderson, D., Burlinson, B., Hartmann, A., Kobayashi,
H., Miyamae, Y., Rojas, E., Ryu, J.C., and Sasaki, Y.F. (2000) Environ Mol
Mutagen. 35,206-221.
12. Tischkowitz, M., and Dokal, I. (2004) Br. J Haematol. 126,176-191.
13. Saadatzadeh, M.R., Bijangi-Vishehsaraei, K., Hong, P., Bergmann, H., and
Haneline, L.S. (2004) J Biol Chem. 279,16805-16812.
14. Dimri, G. P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C.,
Medrano, E. E., Linskens, M., Rubelj, I., and Pereira-Smith, O. A. (1995)
Proc. Natl. Acad. Sci. USA, 92,9363-9367.
15. Bakkenist, C.J., and Kastan, M.B. (2003), Nature, 421,499-506.
16. Kurz, E.U., and Lees-Miller, S.P. (2004) DNA Repair. 3,889-900.
17. d'Adda di Fagagna, F., Reaper, P.M., Clay-Farrace, L., Fiegler, H., Carr, P.,
von Zglinicki, T., Saretzki, G., Carter, N.P. and Jackson, S.P. (2003) Nature,
426,194–198.
18. Huang, S., Qu, L.K., Cuddihy, A.R., Ragheb, R., Taya, Y. and Koromilas, A.E.
(2003) Oncogene, 22,3721–3733.
19. Herbig, U., Jobling, W.A., Chen, B.P., Chen, D.J., and Sedivy, J.M. (2004)
Mol Cell. 14,501-513.
20. Beausejour, C.M., Krtolica, A., Galimi, F., Narita, M., Lowe, S.W., Yaswen, P.
and Campisi, J., (2003) EMBO J. 22,4212–4222.
21. Hermeking, H., and Eick, D. Science. (1994) 265,2091-2093.
16
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
22. Tanaka, H., Matsumura, I., Ezoe, S., Satoh, Y., Sakamaki, T., Albanese,. C,
Machii, T., Pestell, R.G., and Kanakura, Y. (2002) Mol Cell. 9,1017-1029.
23. Vafa, O., Wade, M., Kern, S., Beeche, M., Pandita, T.K., Hampton, G.M., and
Wahl, G.M. (2002) Mol Cell. 9,1031-1044.
Figure legends
Figure 1. Reoxygenation-generated Oxidative Stress Induces DNA Damage
and Growth Inhibition in BM Progenitor Cells. KSL cells were incubated in
20% O2 (control) or first subjected to hypoxia (1% O2) for 4 h then reoxygenation
(20%; Reoxy: reoxygenation). The cells were then incubated in 20% for 48 h.
The NAC cultures (Reoxy+NAC) were the same as the reoxygenated cells
except that the medium contained NAC (1mM). (A) Representative images of the
comet assays used to analyze DNA strand breaks. Numbers below images are
DNA damage quantified by determining the comet tail movement (increasing
values represent increasing amounts of DNA damage). The mean tail moment of
the WT cells without treatment (Control) is expressed as 100%. For each
treatment, 30 cells were scored for tail moment from random sampling. Data
reflect means ± SD of three independent experiments. (B) Untreated (Control) or
reoxygenated WT and Fancc-/- BM KSL cells were evaluated for colony-forming
cell (CFC) activity at day 7. Data represent the number (mean ± SD) of total
number of colonies from three independent experiments. *Statistical significance
17
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
between paired samples at P < 0.05. (C) Untreated (Control) or reoxygenated
WT and Fancc-/- BM lin- cells were stained with lineage maker antibodies (biotin-
conjugated) along with Sca-1-PE and c-kit-APC antibodies, and then with
annexin V. Percentages of apoptosis in the KSL population were analyzed by
flow cytometry. (D) Untreated (Control) or reoxygenated WT and Fancc-/- BM lin-
cells were analyzed for cell cycle distribution at 24 h after reoxygenation. Shown
are representative flow cytometric presentations of three independent
experiments. Numbers in plots indicate percent of cells in G0+G1 phases. (E)
Untreated (Control) or reoxygenated WT and Fancc-/- BM cells were
transplanted into sublethal irradiated NOD/SCID mice along with 1 x 106
irradiated carrier cells per mouse. At 4 weeks after transplantation the bone
marrow was harvested and stained with H2kb-PE and H2kd-FITC (for donor and
recipient markers, respectively) antibodies and analyzed by flow cytometric
analysis. Numbers in corners indicate percent of events in that quadrant.
Figure 2. Reoxygenation-induced senescence, test as staining for SA-β-gal,
in BM Progenitor Cells. (A) WT and Fancc-/- BM KSL cells were subjected to
reoxygenation for 48 h, and stained for SA-β-gal. The numbers below the images
are percentages of the cells stained positive for SA-β-gal quantified by counting a
total of 1000 cells in random fields on a slide. The data represent the mean ±SD.
(B) Reoxygenated BM KSL cells were incubated in the presence of the pan-
caspase inhibitor Z-VAD-FMK (100 µM), and stained for SA-β-gal. Values
18
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
represent mean ± SD of three experiments. *Statistical significance between
paired samples at P < 0.05.
Figure 3. Reoxygenation-induced Senescence in BM Progenitor Cells
Involves the ATM/p53/p21WAF1 Pathway. (A) Control and reoxygenated BM
KSL cells were stained with the antibodies against ATM-Ser1981 (magnification,
×40), p53-Ser15 (×20), and p21Waf1 (×20) and then counterstained with DAPI. (B)
Quantification of ATM-Ser1981, p53-Ser15 and p21Waf1-positive cells. >100 cells
were scored in each case. (C) BM KSL cells were untreated (Control),
reoxygenated, or reoxygenated in the presence of 2-AP (10 mM; Reoxy+2-AP).
siATM group represents cells that had been infected with siATM retroviruses and
selected for puromycin resistance for 48 h before reoxygenation treatment. Cells
were stained with the antibodies against ATM-Ser1981 (magnification, ×40) and
p53-Ser15 (×20). (D) Quantification of ATM-Ser1981 and p53-Ser15-positive
cells. >100 cells were scored in each case. (E) BM KSL cells described in (C)
were plated in semisolid, cytokine-containing medium. The colony-forming cell
(CFC) activity of WT and Fancc-/- BM KSL cells was evaluated at day 7. Data
represent the number (mean ± SD) of total number of colonies from three
independent experiments. *Statistical significance between paired samples at
P < 0.05. (F) BM KSL cells described in (C) were stained with the antibodies
against p16Ink4a (magnification, ×20). The numbers below the images are
percentages of the cells stained positive for SA-β-gal or undergone apoptosis.
Data represent mean ± SD of three experiments.
19
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Figure 2
Figure 3
21
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Xiaoling Zhang, June Li, Daniel P. Sejas and Qishen Pangsenescence in reoxygenated hematopoietic progenitor cells
The ATM/p53/p21 pathway influences cell fate decision between apoptosis and
published online March 7, 2005J. Biol. Chem.
10.1074/jbc.M502262200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Top Related