High Throughput Genomic Data
Vítor Santos Costa
A Brief History of Sequencing and Gene Expression
Limitations of Sanger Sequencing Low throughput
Inconsistent base quality Expensive
Not quantitative
Frederick “Fred” Sanger
Hybridization Based Gene Expression Quantification
Reliance on existing knowledge about genome sequence
High background due to cross-hybridization Requires lots of starting material
Limited dynamic range of detection
Next Generation Sequencing (Massive Parallel Sequencing)
Principles 1) Fragmentation and tagging of genomic/cDNA
fragments – provides universal primer allowing complex genomes to be amplified with common PCR primers
2) Template immobilization – DNA separated into single strands and captured onto beads (1 DNA molecule/bead)
3) Clonal Amplification – Solid Phase Amplification
4) Sequencing and Imaging – Cyclic reversible termination (CRT) reaction
Next Generation Sequencing (Massive Parallel Sequencing)
Clonal Amplification – Solid Phase Amplification Priming and extension of single strand, single molecule template; bridge amplification of the immobilized template with immediately primers to form clusters (creates 100-200 million spatially separated template clusters) providing free ends to which a universal sequencing primer can be hybridized to initiate NGS reaction – each cluster represents a population of identical templates
Next Generation Sequencing (Massive Parallel Sequencing)
Cyclic Reversible Termination – DNA Polymerase bound to primed template adds 1 (of 4) fluorescently modified nucleotide. 3’ terminator group prevents additional nucleotide incorporation.
Following incorporation, remaining unincorporated nucleotides are washed away. Imaging is performed to determine the identity of the incorporated nucleotide.
Cleavage step then removes terminating group and the fluorescent dye. Additional wash is performed before starting next incorporation step
This is repeated ~250 million times (25Gb) with HiSeq2500 (~4 days)
Unlike SANGER termination is REVERSIBLE
RNA Sequencing
Population of RNA (poly A+) converted to a library of cDNA fragments with adaptors attached to one or both ends
Solid Phase Amplification performed
Molecules sequenced from one end (Single End) or both ends (Pair End)
Reads are typically 30-400bp depending on sequence technology used
RNA Purification and AnalysisRNA Purification: Can use Qiagen Kit or Phenol/Chloroform Extraction, do not use
Invitrogen RNA isolation kit
RNA Quality Assessment (Agilent 2100 BioAnalyzer)
RNA Quantification (Qubit) – nanodrop considered too inaccurate
TRUSEQ Library Preparation
Library Construction Effective elimination of ribosomal RNA (negative selection) followed by polyA
selection (for mRNA)
High Quality Strand Information
Can be used with low quality/low abundance RNA (10-100ng)
48 barcodes allows for multiplexing
Small RNAs can be directly sequenced
Large RNAs must be fragmented
http://res.illumina.com/documents/products/datasheets/datasheet_truseq_stranded_rna.pdf
Sequencing Apparatus at UCLA
Experimental Design: Single End (SR) vs Paired End (PE)
Single Read: one read sequenced from one end of each sample cDNA insert (Rd1 SP: Read 1 Seqeuncing Primer)
Paired End: two reads (one from each end) sequenced from each sample cDNA insert (Rd1 and Rd2 sequencing primer)
SR: often used for expression studies or SNP detection; NOT good for splice isoforms PE: used for discovery of novel transcripts, splice isoforms and for de novo transcriptome assembly
Experimental Design: How many reads do I need
Study Type Reads Needed Expression Profiling 5-10 Million Alternative splicing, quantifying cSNPs 50-100 M De Novo Transcriptome Assembly 100-1000 M
Sequencing Instrument Reads per Lane (SR:PE) Reads per Flow Cell HiSEQ 2500 185:375M 1.5:3 Billion
Greater Sequencing Depth correlates with better genomic coverage and more robust differential gene expression analysis
Sequence AnalysisTheory Practice
Sequence AnalysisOne flow cell can generate up to 600Gb of data. Where am I going to store this data?
Stem Cell Core will keep raw data for up to 6 months
Sequencing analyses takes a ton of processing power: Currently the Cheng Lab is insufficiently capable of storage, processing and expertise. While analyses programs have become more user friendly (i.e.Galaxy), storage and processing capability will always be required.
Hoffman2 Cluster: 11, 000 processors, 1300 active users using up to 8 million computing hrs per month. A typical user account allows 20GB of permanent storage. Users are also provided a scratch folder (~100GB) where you can store files for up to 7 days at which point they are deleted permanently.
Access to the Hoffman2 cluster requires ucla email account (email Shirley Goldstein [email protected])
However access also requires a PI sponser. Genhong is currently not.
Hoffman2 also provides computing tutorials on a regular basis (See website)
http://ccn.ucla.edu/wiki/index.php/Hoffman2:Getting_an_Account
Converting RAW data to FASTQ
RAW data from HISEQ 2500 run yields two files 1) .bcl file: contains base identity information for each run 2) .stats file: contains base intensity and quality information Most (and probably all) programs need a merged file (named FASTQ or QSEQ)
Download and install bclconverter (already installed on Optiplex 990)
SxaQSEQsXA050L3:xG3KF4Ue
~bin/setupBclToQseq.py -i FOLDER_CONTAINING_LANE_DIRS -p POSITION_DIR -o OUT_DIR --overwrite followed by make in OUT_DIR
COMMAND
If multiplexed, files then need to be de-multiplexed (this is slightly complicated)
Converting RAW data to FASTQ
@SN971:3:2304:20.80:100.00#0/1 NAAATTTCACATTGCGTTGGGAACAGTTGGCCCAAACTCAGGTTGCAGTAACTGTCACAATACCATTCTCCATCAACTTCAAGAAATGTTCAACAAAACAC + @P\cceeegggggiihhiiiiiiihighiiiiiiiiiiiiiifghhhhgfghiifihihfhhiiiihiggggggeeeeeeddcdddccbcdddcccccccc
FASTQ File
Line 1: begins with ‘@’ followed by sequence identifier Line 2: raw sequence Line 3: + Line 4: base quality values for sequence in Line 2
Lane #
Tile #INSTRUMENT NAME
X Y
ADAPTOR INDEX
SINGLE END READ
GALAXY
User friendly web interface for processing and analyzing Sequencing Data Galaxy has also been installed on the Optiplex 990
Allows for application of workflows – enable automated processing and mapping of data
Can add tools to the galaxy toolbox Obtain a Galaxy account linked to the hoffman2 cluster for higher processing
power – email Weihong Yan ([email protected])
Video tutorials
Published workflows
My RNA Seq Workflow
Work in progress
Quality ControlFASTQ Groomer: converts FASTQ data from different sources (ie Illumina, 454 Sequence etc) to a consensus FASTQ file FASTQ QC: assesses base quality of sequence reads Per base sequence quality per sequence quality scores GC content Sequence Length Sequence Duplication Overrepresented sequences Kmer content
Genhong
Shankar
Kislay
FASTQ TRIMMER: eliminate sequences below phRed score (usually <20) Remember to check how many reads are lost from original input after processing
Quality
Reference Mapping - TOPHAT
INPUT FASTQ (processed)
Output (4 files) Insertions (.bed) Deletions (.bed) Junctions (.bed)
Accepted Hits (.bam)
.bed files can be downloaded to excel -sam (Sequence Aligment/Map) or bam (binary compressed version of sam) – can be used to visualize reads using UCSC Genome Browser or Integrative Genomics Viewer
https://genome.ucsc.edu/FAQ/FAQformat.html#format1Link to File type descriptions
TOPHAT provides both identifying and quantifying
information
Reference Mapping - TOPHAT
Often 10-20% of reads do not map to
any consensus region of genome
Estimating Transcript Abundance - Cufflinks
INPUT .bam file (Accepted Hits)
Reference (.gtf) Refseq, Ensembl, etc
Output (tabular form, excel) FPKM quantifiable
Visualizing Reads Across the Genome
Upload Files to UCSC Genome Browser Convert .bam file to .bedgraph (using Galaxy)
Requires some coding Size Limitations
Upload Files to Integrative Genome Viewer Convert .bam file to .bedgraph (using Galaxy)
Upload directly
WT
IFNAR KO
IL-27R KO
WT
IFNAR KO
IL-27R KO
How do I quantify expression from RNA-seq?RPKM: Reads per Kb million (Mortazavi et al. Nature Methods 2008)
Longer and more highly expressed transcripts are more likely be represented among RNA-seq reads
RPKM normalizes by transcript length and the total number of reads captured and mapped in the experiment
Sequencing depth can alter RPKM values
Differential Gene Expression AnalysisRPKM -Can calculate Fold change -Input sequence reads must be similar -replicates not needed -provides NO statistical test for differential gene expression -useful for Cluster based classification of genes http://www.bioinformatics.babraham.ac.uk/projects/seqmonk/Help/4%20Quantitation/4.3%20Pipelines/4.3.1%20RNA-Seq%20quantitation%20pipeline.html
DESeq -Input .bam file -Can set statistical threshold -Input sequence reads can be somewhat dissimilar -Must have replicates -Not currently on Galaxy (must use Edge R)
CuffDiff (available on GALAXY) -Input .bam file -Can set statistical threshold (p<0.05 or whatever) -replicates encouraged but not needed -Input sequence reads can be somewhat dissimilar -can provide differential splicing and promoter usage
Differential Gene Expression Analysis: Sampling VarianceConsider a bag of balls with K number of red balls where K is much less than the total number of balls. You can sample n number of balls. P represents the proportion of red balls in your sample.
Estimate of the number of balls (u) = pn K (the actual number of balls) follows a Poisson distribution and hence K varies
around the expected value (u) with a standard deviation of 1/ sqroot (u)
Microarray data follows a Poisson distribution. However RNA seq does not. In RNA Seq genes with high mean counts (either because they’re long or highly expressed) tend to show more variance (between samples) than genes with low
mean counts. Thus this data fits a Negative Binomial Distribution
Poisson Negative Binomial
Differential Gene Expression AnalysisCuffDiff: If you have two samples, cuffdiff tests, for each transcript whether there is evidence that the concentration of this transcript is not the same in the two samples
DESeq/EdgeR: If you have two different experimental conditions, with replicates for each condition, DESeq tests whether, for a given gene, the change in the expression strength between the two conditions is large as compared to the variation within each group.
You will get different answers with different tests
Resources
RNA-seq: technical variablity and sampling McIntyre et al. BMC Genomics 2011 12:293
Statistical Design and Analysis of RNA Sequencing Data Auer and Doerge. Genetics 2010 185(2): 405-416
Analyzing and minimizing PCR amplication bias in Illumina sequencing libraries
Aird et al. Genome Biology 2011 12:R18
ENCODE RNA-Seq guidelines www.encodeproject.org/ENCODE/experiment_guidelines.html
Further Reading
RNA-seq: technical variablity and sampling McIntyre et al. BMC Genomics 2011 12:293
Statistical Design and Analysis of RNA Sequencing Data Auer and Doerge. Genetics 2010 185(2): 405-416
Analyzing and minimizing PCR amplication bias in Illumina sequencing libraries
Aird et al. Genome Biology 2011 12:R18
ENCODE RNA-Seq guidelines www.encodeproject.org/ENCODE/experiment_guidelines.html
Further ReadingBioinformatics for High Throughput Sequencing Rodriguez-Ezpeleta et al. SpringerLink New York, NY Springer c2012
RNA sequencing: advances, challenges and opportunities Ozsolak and Milos. Nature Reviews Genetics 12 87-98
Computational methods for transcriptome annotation and quantification using RNA-seq Garber et al. Nature Methods 8, (2011)
Next-generation transcriptome assembly Martin and Wang. Nature Reviews Genetics 12 671-682.
Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks Trapnell et al. Nature Protocols 2012
SEQanswers.com
DevTox Preliminary Learning Results
Vítor Santos Costa C David Page
Questions
• Can we detectexposure to lead-30? • What genes are important? • What functions are envolved? • How many days to get a stable model?
Methods
• Data in CSV • Used edgeR to look for differential
expression • Converted to WEKA format
– Used Information Gain to select N attributes – Several Classifiers
Weka Analysis
• Predict Ti was subject to lead-30 given that we have T1 .... Ti-1
• Assumes T1 .... Ti-1 independent
Attribute Selection Choose highest info gain
Classifier Naïve Bayes Random Forests
WEKA: Learning
• Predictive accuracy is 95% • Mis-predictions at
– Days 2, 4, 5 – Other days always ok
• Easier task than lead/no-lead
edgeR: most signif genes
• IGF2: 3.75e-130 • FOXD3: 2.43e-117 • ITIH2: 4.72e-88 • CYP1B1: 1.87e-86 • ASIC4: 1.13e-83 • COLEC12: 2.88e-82 • GREB1: 1.74e-78 • SLC6A13: 3.96e-73 • PCSK2: 9.07e-72 • DSG2: 3.39e-70
Most Information Gain
• 0.914 4781 FLRT2 • 0.914 1556 PRRX1 • 0.914 9490 ARMCX2 • 0.914 7896 ASPN • 0.833 9585 THEM4 • 0.833 9639 TAC1 • 0.833 8353 DCN • 0.833 13181 RDH10 • 0.833 1394 GPR124 • 0.833 5819 ISLR • 0.833 11146 TLE4 • 0.833 2147 ONECUT1 • 0.833 13318 SLFN5
0 5 10 15 20 25
0200
400
600
800
Time
Activity
FLRT2
CTRL L−3 L−30
Gene Ontology
• Similar to GOStats • Most Differential Functions
– Used hypergeometric test
• Visualisation through graphviz
GO Annotations (edgeR < 10-10)
• translational initiation • nuclear-transcribed mRNA catabolic process, nonsense-
mediated decay • translational elongation • SRP-dependent cotranslational protein targeting to membrane • viral infectious cycle • translational termination • viral transcription • plasma membrane • cytosolic large ribosomal subunit • cytosolic small ribosomal subunit • structural constituent of ribosome • ribosome
GO Annotations (IG > 0.5)
• synaptic transmission • cell adhesion • G-protein coupled receptor signaling pathway • axon guidance • nervous system development • positive regulation of transcription from RNA
polymerase II promoter • negative regulation of cell proliferation • in utero embryonic development • positive regulation of transcription, DNA-dependent • multicellular organismal development
Go Graph (IG < 0.5)
1 3 5 7 9 11 13 15 17 19 21 23 25
Time of Entry for Genes in Final Set at p−value < 1e−10
Time
050
100
150
2 4 6 8 10 12 14 16 18 20 22 24 26
outin
Genes in Final Set at p−value < 1e−10
Time
0200
400
600
800
1000
1200
1400
0 2 4 6 8 10 12 14 16 18 20 22 24
Time of Entry for Genes in Final Set at Info Gain > 0.500000
Time
050
100
150
5 6 7 8 9 11 13 15 17 19 21 23 25
outin
Genes in Final Set at Info Gain > 0.500000
Time
01000
2000
3000
4000
5000
Discussion
• Good: Good prediction • Good: Gene Functions look sensible • Bad: No clear breakpoint • Interesting: GO vs edgeR
Questions
• Can we detectexposure to lead-30? • What genes are important? • What functions are envolved? • How many days to get a stable model?
Discussion
• Good: Good prediction • Good: Gene Functions look sensible • Bad: No clear breakpoint • Interesting: GO vs edgeR
Machine Learning from 3D Data
3D Case: Review
• Same ML methodology but data generation was different
• Exposed tissue model now 3D – All 7 neural cell types – Larger so spatio-temporal issues
• 35 Toxins and 26 Controls, 2 replicates each • Days 2, 7, 28 • 7 Compounds yield empty data on Day 28
Using Average of Replicates to Predict
Day: 2 7 28AUC: 0.9016 0.8767 0.8118
3 of 4 Remaining Issues
1) Any other ways to further improve performance? Combining data from multiple days? Generating more data… leads to next issue
2) Learning curves… how does AUC vary with amount of data (number of compounds)?
3) Trying to reduce cost by running all samples through sequencer at once, reducing cost but also reducing reads
4) Predicting on Blinded Set of 10 compounds – to be done next and reported next month
1) Combining Predictions from Days
• Because 7 compounds yield empty data for Day 28, difficult to combine data over days
• Easier to combine predictions over days – Average probabilities of toxic from all three
days; use the average of the Day 28 probabilities for the 7 compounds missing Day 28 data
– Or just use Days 2 and 7 • Each approach increases AUC to 0.93 (as
always, all results from cross-validation)
2) Learning Curves
• Plot #compounds on x axis and AUC on y axis – If curve is flat at right, little value from more
data – If curve is still increasing, more data should help
• Each point is average of 30 random samples of selected number of compounds
• Near far right, little variation possible in samples because using almost all data
Day 2 Learning Curve
Day 7 Learning Curve
Day 28 Learning Curve
Message from Learning Curves
• Appears to be possibility for further data to improve accuracy
• Curves are flattening, so now in the region of diminishing returns in AUC from investment in data
3) Minimizing Lanes Per Compound
• No replicates, so compare to earlier results with Day 2 AUC of 0.83 and Day 7 of 0.81
• One lane used per compound • Day 2: 0.78 • Day 7: 0.67
Summary and Next Step
• Our best method as judged by cross-validation combines output probabilities from both replicates and all days (or days 2 and 7)
• Next step: apply model from this method to the ten blinded compounds and measure accuracy
• More training data could provide some added accuracy
Top Related