Wesley De [email protected]
Ghent University – iMinds & KAIST
Songdo, Incheon, KoreaSeptember 23, 2016
Ghent University Global Campus - Sungkyunkwan University Workshop on Research and Academic Development
2
• Academic credentials- Master’s degree in computer science (2002)
• at Ghent University, Belgium- Ph.D. degree in computer science engineering (2007)
• at Ghent University, Belgium
• Current employment- IDLab @ Ghent University – iMinds – imec, Belgium (since 2002)- Image and Video Systems Lab @ KAIST, Korea (since 2007)- Center for Biotech Data Science @ GUGC, Korea (since 2014)
Professional Background
3
Teaching
Informatics(Fall and Spring term of BA1 – 10 credits)
Bioinformatics(Fall term of BA3 – MBT – 5 credits)
4
• Main track- deep machine learning for analysis of
• multimedia data (Belgium)
• biotech data (Korea)
• Side track- compression of genomic data using
tools for video coding (Belgium)
Research
5
Deep Machine Learning
Google DeepMind +Ghent University
6
Breast Cancer Diagnosis and Segmentation (Mijung Kim)
Mammogram image
Normal
Benign
Malignant
1) Classify an input image as either normal (no lesion), benign, or malignant
2) Upon classification as either benignor malignant, segment the lesion
Upon classification asnormal, no segmentationis used
The red part of the heatmap below shows wherethe lesion is located
Targeted participation in the Digital Mammography DREAM challenge
7
Prediction of Drug-Target Interaction (Mijung Kim)
PCBA-2326
Target enzyme CID 2827036
Target enzyme CID 1014390
Target enzyme CID 332939
. . .
1) Feed a new or an existing drugcompound into a neural network
2) The output of the neural network showswhich target interacts with the drug compound
On hold, due to a lack of data and expert knowledge
8
Sleep Apnea Detection (Mijung Kim)
Normal Apnea Normal
1) Feature extraction fromraw data – synchronizedpolysomnography (PSG) data: EEG, EOG, EMG, …
2) Feed features into a neural network forclassification purposes
3) The result is one ofthree classes – normal,apnea, or hypopnea
Under discussion with imec (www2.imec.be)
9
Splice Site Detection (Jasper Zuallaert)
… ACCAGGTAAGCGCATCCGACATCTCTCAACGAGTCGAC …
In cooperation with VIB (www.vib.be)
1) Search for patterns using convolutional windows
2) Combine patterns found to classify a candidate splice site as a true splice site or as a pseudo splice site
… ACCAGGTAAGCGCATCCGACATCTCTCAACGAGTCGAC …
True splice site
Top Related