Download - Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Transcript
Page 1: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Fundamentals: Nucleic acids, DNA replication, transcription, translation and

application to molecular detection

Page 2: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Prokaryotic cell

Page 3: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Binary Fission

• Bacteria reproduce asexually via binary fission

• Each daughter cell is an identical copy (or clone) of its parent cell

Page 4: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Microbial evolution 101

Generation 1

Generation 2

Generation 3

Generation N

Ancestor Genotype

Clones

Clones

Clones and Divergent Genotypes

Page 5: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Microbial genetics 101

• What is DNA ?• What types of DNA molecules

are present in a bacterial cell?• What’s the size of the genetic

material for a typical bacterial pathogen ?

• How many genes does a bacterial pathogen have ?

• What’s the average size of a bacterial gene ?

Page 6: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

What Is DNA?

Page 7: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Double Helix Structure and Anti-parallel Orientation

Page 8: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Nucleotide = 5 carbon sugar + nitrogenous base + phosphate group

Page 9: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA is a polynucleotide

Page 10: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Constituents of a Gene• Promoter• Ribosome binding site • Open reading frame• Start & Stop codons

ATG TAG

-10-35

Ribosome binding site

Promoter

Start codon

Stop codon

5’ 3’

Page 11: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

The Central DogmaDNA

mRNA

Protein/Enzymes

Toxins & other metabolites

Molecularmethods

Classicalmethods

DNA replication

Translation

Transcription

Post-translation

Page 12: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Replication• Topoisomerases remove superhelicity• New DNA is synthesized in the 5’ to 3’ direction • Replication begins at a the origin of replication (ori)• Two replication forks proceed around the chromosome (bi-directional) until they encounter termination (ter) sites• Replication is continuous on one strand and discontinuous on the other strand• Chromosomes partitioned into two daughter cells during cell division

Page 13: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Replication

• Helicase; unwinds helix• Single-stranded binding protein; binds single-stranded DNA prevent

hybridization • Primase; lays down RNA primers needed for DNA polymerase activity• DNA polymerase I; remove RNA primers replace with DNA• DNA polymerase II; DNA repair• DNA polymerase III; major replication enzyme forms phosphodiester bonds • Ligase; seals nicks by linking free 3’ OH with 5’ adjacent phosphate group• Proofreading (DNA pol I & III) 3’ to 5’ exonuclease activity to remove incorrect

base• Incorrect base incorporated every 1x108 to 1x1011 bases

Leading strand; continuous replication

Lagging strand; discontinuous replication

Page 14: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Polymerase and PCR

• DNA polymerase III• Polymerase with or without 3’ to 5’ exonuclease

proofreading activity– Taq (5’ - 3’ exonuclease activity); only degrades double

stranded DNA while extending– Vent (3’ to 5’ exonuclease activity; specialized Taq)– Implications

• Detection/subtyping methods• Cloning

Page 15: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Replication and Application to Molecular Detection

• Polymerase chain reaction (PCR) or “DNA photocopying”– Simulate the natural DNA replication process to make

copies of DNA in vitro

– Make many copies of specific DNA fragment(s) in vitro• Template, deoxynucleotidetriphosphates, primers, DNA

polymerase, enzyme cofactors, and buffer

Page 16: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

RNA v. DNA

Page 17: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

RNA in the cell• Ribosomal RNA (rRNA) bulk of RNA in a cell

– 3 types (16s, 23s, and 5s)– 3,000 copies in a cell – Ribosomes; protein assembly during translation

• Messenger RNA (mRNA) 5-10% of RNA in a cell– Almost as many types as there are genes – Not stable in the cell; highly transcribed genes have a few hundred

copies; half-life a few minutes (1 to 7 min.)– Synthesized from DNA during transcription– Move information contained in DNA to translation machinery

• Transfer RNA (tRNA)– About 50 types– Pick up amino acid & transport to ribosome during translation

• Small RNA (sRNAs)– 50 - 200 nucleotides– Regulatory roles (e.g., affect mRNA stability and translation)

Page 18: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

The Central DogmaDNA

mRNA

Protein/Enzymes

Toxins & other metabolites

Molecularmethods

Classicalmethods

DNA replication

Translation

Transcription

Post-translation

Page 19: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Transcription and translation are coupled in bacteria

Holoenzyme (RNA polymerase and sigma factor

Anticodon

Transcription

tRNA

Translated Protein

mRNA

RibosomesTranslationDirection

5’3’

3’5’

50S large subunit (23S and 5S RNA and proteins)

30S small subunit (16S RNA and proteins)

Page 20: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

A closer look at transcription

• DNA used as template to synthesize complementary mRNA molecules• RNA polymerase (pol) binds to promoter region in double-stranded DNA• Sigma factors help RNA pol bind promoter & target genes to be transcribed

• -10 and -35 region 5’ of transcription start site

• Local unwinding of double-stranded DNA• RNA pol recognizes transcription start site • RNA pol adds nucleotides 5’ to 3’• RNA pol termination RNA pol and RNA molecule released

•Rho-dependent•Rho-independent (hairpin loop; termination sequence)

Page 21: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

The Central DogmaDNA

mRNA

Protein/Enzymes

Toxins & other metabolites

Molecularmethods

Classicalmethods

DNA replication

Translation

Transcription

Post-translation

Page 22: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

A closer look at translation

• Three ribosome sites:• A site; entry of aminoacyl tRNA (except 1st aminoacyl tRNA or start codon, which enters at P site)• P site; peptidyl tRNA is formed • E site; exit for uncharged tRNA

• Shine-Dalgarno sequence or ribosome binding site recognized (5-10 bases upstream of start codon)• Assembly of small and large ribosome subunits• Amino acids added to carboxyl end of growing chain• Protein exits ribosome through tunnel in large subunit• Termination occurs when one of three termination codons moves into A site

Page 23: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Genetic code

Page 24: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Application to molecular detection in food microbiology

• Molecular detection methods include assays that target nucleic acids (i.e., DNA and RNA)

• DNA detection methods– Detect presence or absence of gene(s) or gene fragment(s)

specific to the target organism– Detection of universal gene or gene fragment (e.g., 16s rRNA)

followed by DNA sequencing – Detection of DNA does not differentiate between viable and non-

viable organism• mRNA detection methods

– mRNA is rapidly degraded and detection indicates presence of viable organism

Page 25: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Applications

• PCR detection particularly useful when– Classical detection too time-consuming– Differentiation from closely related non-pathogenic

organisms is difficult• Listeria monocytogenes

– Only species in Listeria genera that is pathogenic to humans

– PCR assay targeted to detect hemolysin (hlyA) gene can detect presence and differentiate L. monocytogenesfrom other Listeria spp.

Page 26: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Components

• 1 - Small quantity of DNA added to tube• 2 - DNA polymerase• 3 - Oligonucleotides (primers)• 4 - Deoxynucleotidetriphosphate bases• 5 - MgCl2• 6 - Buffer• 7 - Sterile ultrapure water

Page 27: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Polymerase Chain Reaction (PCR) FundamentalsDNA Extraction

Page 28: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Introduction to PCR • DNA Genetic information for every animal, plant and

microorganism

• Unique variations in DNA allow us to track it back to the organism it originated from with precision

• Comparative genomics, forensics, fingerprinting often require significant amounts of DNA

• PCR can synthesize, characterize and analyze any specific piece of DNA

Page 29: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

What is PCR ?

Polymerase Chain Reaction:– in vitro (DNA synthesis in a tube)– Yields million of copies of target DNA sequence– Repeated cycling action– Involving DNA polymerase enzyme

Page 30: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Principles

• Conceptualized by Kary Mullis in 1983• DNA amplification in vitro using the following

components:– Two synthetic oligonucleotides (primers)

complementary to each end of targeted DNA sequence– Single nucleotide bases as substrate– DNA polymerase; a naturally occurring enzyme

responsible for in vivo DNA replication and repair

Page 31: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Applications

• Food Science:– Detection or molecular confirmation of specific

microorganisms present in foods– Molecular subtyping of isolates

• Molecular Biology:– Mutagenesis, cloning or sequencing

• Evolutionary Biology:– Re-create the evolutionary history of a group of taxa

Page 32: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Applications

• PCR detection particularly useful when– Classical detection too time-consuming– Differentiation from closely related non-pathogenic

organisms is difficult• Listeria monocytogenes

– Only species in Listeria genera that is pathogenic to humans

– PCR assay targeted to detect hemolysin (hlyA) gene can detect presence and differentiate L. monocytogenesfrom other Listeria spp.

Page 33: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction• High temperature “melts” double strand DNA

helix into single strand DNA

• Two synthetic sequences of single stranded DNA (18-24 bases) known as primers target a region of genome

• Forward primer and Reverse primer flank the region of interest (usually <1000 base pair)

Page 34: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Components

1 – DNA template2 – DNA polymerase3 – Primers (oligonucleotides)4 – Deoxynucleotidetriphosphate bases (dNTPs)5 – MgCl26 – Buffer7 – Sterile ultrapure water

Page 35: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Set-up1 - DNA Template

– Theoretically, PCR can detect as little as one DNA molecule

– Template DNA should be present in small amounts (< 106 target molecules; 1 ng of E. coli DNA = 3x105)

– Bacterial cells need to be lysed to make their DNA accessible for PCR

Page 36: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Set-up2 – Primers

– Should be in great excess to template DNA to ensure that most strands anneal to a primer and not each other

– Generally between 0.1 and 0.5 µM optimal concentration

– Higher primer concentrations may cause non-specific products

Page 37: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Set-up3 - Deoxynucleotide Triphosphates (dNTPs)

– Building blocks of DNA A’s, T’s, G’s, & C’s

– Essential to have enough dNTPs to make desired number of target sequence copies

– Final concentration of EACH dATP, dTTP, dCTP and dGTP should be 0.1 mM

Page 38: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Set-up4 - DNA Polymerase Enzyme:

– Original PCR performed with E. coli DNA polymerase, but high temperature (94-95oC) needed to denature double stranded DNA also denatured this polymerase

– Problem solved using thermostable Taq DNA polymerase

– Concentration should be around 0.5 to 5 units/100µl reaction volume

Page 39: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Set-up5 - MgCl2

– Essential for optimum Taq activity and for proper primer annealing

– Excessive concentrations cause non-specific products

– Standard PCR reaction contains between 1.5 and 5.0 mM MgCl2

Page 40: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Set-up6 - PCR buffer

– Buffer keeps the PCR reaction at the proper pH (6.8-7.8) for enzyme activity

– Contains 10-50mM Tris-HCl and KCl or NaCl (50 mM)

– Salt also helps to stabilize hybridization of primer to target DNA

Page 41: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Reaction Set-up7 – High quality water

– Dilutes template, buffers etc.

Page 42: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Demo Cycling Action

• http://www.dnalc.org/files/swfs/animationlib/pcr.exe

Page 43: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Standard Thermal Cycling Conditions

• Newly synthesized extension product of one primer serves as template for annealing of the second primer in subsequent cycles

• Each reaction cycle doubles the number of DNA copies or PCR products

94-96°C

50-55°C

72°C 72°C

4°C

1-2 min

1-2 min

1-2 min 5-7 min

94-96°C2-10 min

25-40 cycles

*Denaturation

*Annealing

*Extension

*Initialdenaturation *Final

extension

Page 44: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Amplification Cycles

• Initial denaturation at 94-96oC for 2 min• Standard PCR protocol has 20-45 cycles of the following

time/temperature combinations• 1-2 min @ 94-96oC

– Denature DNA• 1-2 min @ 50-55oC

– Primers hybridize by forming hydrogen bonds to complementary sequence

• 1-2 min @ 72oC– DNA polymerase binds and extends a complementary strand from

each hybridized primer• One final hold at 72oC for 5-7 min optional for higher

product yield

Page 45: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Exponential Amplification

• Newly synthesized extension product of one primer serves as template for annealing of the second primer in subsequent cycles

• Each reaction cycle doubles the number of DNA copies or PCR products

Page 46: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Important PCR Innovations

• Acquisition of heat stable DNA polymerase (Taq) from Thermus acquaticus which inhabits hot springs– Remains active during repeated denaturation

cycles• Thermal cycler or thermocycler

– Computer controlled heating block for repetitive temperature change cycles required for PCR reaction

Page 47: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Basics of DNA Extraction

Goal Gain access to DNA

1) Classic DNA Extractions methods2) Silica membrane (commercial kit)3) Microwave (yep, just nuke the sample)

Page 48: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Classic DNA Prep1. Disrupt the cell wall

– Mechanically Beadbeating, sonication, French press

– Enzymatically Lysozyme

2. Remove membrane lipid– Triton-X, Sodium dodecyl sulfate (SDS)Detergents

3. Degrade proteins– Proteinase K

4. Extract residual proteins phenol:chloroformextraction

5. Ethanol precipitation

Page 49: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Commercial Silica Column DNA Purification

1.Enzymatic lysis & protein degradation

2.Apply supernatant to silica membrane in a column

3.DNA is negatively charged; silica membrane is negatively chargedNa+

Page 50: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Commercial Silica Column DNA Purification , cont.

4.High salt and Ethanol washes rinse degraded protein through the column

5. ElutionWater with low salt concentrations disrupt the DNA-Na-Silica interaction releasing the DNA from the column

Page 51: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Microwave

• Colony PCR or “dirty lysates”1. Select an isolated colony from an agar plate2. Transfer a portion to a PCR tube (0.2 mL

tube)3. Microwave Time dependent!4. Add water5. Add PCR reagents & thermal cycle

Page 52: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Concepts of Primer Design

• Design is crucial to successful amplification of target DNA by PCR

• Determine the size and location of PCR product• Well-designed primers can deter amplification of

background and non-specific products• Poorly designed primers result in no or very low

PCR product yield• Several computer programs are available for

selecting primers

Page 53: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Concepts of primer design

Goal Balance specificity and efficiency of amplification

Primer selection/analysis software assess these two criteria by evaluating the following criteria:– Primer length– Terminal nucleotide– G + C content and Tm– PCR product length– Placement in target

sequence

Page 54: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Concepts of primer design

• Primer Length:

– Primers between 18-24 nucleotides in length tend to be very sequence-specific if the annealing temperature is set within a few degrees of the primer Tm

– Optimize PCR by using the minimum primer length that ensures Tm of 54oC or higher

Page 55: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Concepts of primer designTerminal Nucleotides:

– 3’ terminal positions are essential for controlling mis-priming

– 3’ end of primers must be carefully selected to prevent homologies within the primer pair known as primer-dimer where the PCR product is amplification of primers

GC content and Tm– Primers with 50% G+C content have a Tm between 56-

62oC– Tm and GC content should be similar between primer

pairs– A/T = 2°C– G/C= 4°C

Page 56: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Concepts of primer design

• Use multiple sequences to design/validate primers if possible– WHY?

• PCR Product Length and Placement within Target Sequence– Length of PCR product affects efficiency of

amplification– Size of the PCR product depends on application

Page 57: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Degenerate primers• Primers with mixed base pairs Isolate 1 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’Isolate 2 5’ ATGCCATCTGACTGACACCACCTCAATCAA 3’Isolate 3 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’Isolate 4 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’

Primer sequence 5’ ATG(G/C)CATCTGACTGACACC 3’50% of primer synthesized with each nucleotide

• InosineIsolate 1 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’Isolate 2 5’ ATGGCATCAGACTGACACCACCTCAATCAA 3’Isolate 3 5’ ATGGCATCTGACTGACACCACCTCAATCAA 3’Isolate 4 5’ ATGGCATCCGACTGACACCACCTCAATCAA 3’

Primer sequence 5’ ATGGCATC(I)GACTGACACC 3’

Page 58: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Concepts of primer design

• Hypothetical DNA and primer sequences

5’ ATGCCGCAATTCGTTATTACTTCGATCCG 3’*reverse primer 3’… TAGGC 5’

5’ ATGCC … 3’ *forward primer3’ TACGGCGTTAAGCAATAATGAAGCTAGGC 5’

5’-3’ primer sequencesF - atgccR - cggat

Page 59: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Primer design exercise• You will be provided a hand-out with the DNA

sequence for Salmonella enteritidis invA

• Design a set of primers to amplify a 600 base pair region of this gene

• Write down the sequence of both your primers in the 5’ to 3’ orientation (requested by primer synthesis companies)

• Calculate G+C content for your primers to make sure they are similar

Page 60: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Lecture 34 PCR Product Detection

FS 362

Page 61: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Components in a PCR Reaction

•••••••

Page 62: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Cycling Temperatures

?°C

?°C

?°C ?°C

?°C

1-2 min

1-2 min

1-2 min 5-7 min

?°C

2-10 min

25-40 cycles

*Denaturation

*Annealing

*Extension

*Initialdenaturation *Final extension

Page 63: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Quantity & Quality

• Presence/Absence of DNA target and PCR product Agarose Gel Electrophoresis

• Quantity of DNA target & PCR Nanodrop, Bioanalyzer

• Quality of PCR product Bioanalzyer, Nanodrop

Page 64: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Product EvaluationBefore a PCR product is used in further applications

(e.g., DNA sequencing) we need to make sure:

– There are bands; not every PCR is initially successful and optimization is usually required

– The bands are the correct size; it is possible for primers to anneal to an untargeted location on the genome

– There is only one band per reaction; if primers fit on other parts of the genome multiple non-specific bands may be present

Page 65: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Detection & Analysis of PCR Products

• Agarose gel electrophoresis

• PCR products visualized when stained EthidiumBromide (EtBr)

• EtBr intercolateswith DNA bases & fluoresces upon exposure to UV light

Page 66: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Agarose gels

• Cast by melting agarose in buffer until solution is clear– Pre-cast gels are commercially available

• Gel casting tray contains combs to create wells• Upon cooling, agarose solidifes

– Density of agarose matrix determined by concentration of agar in solution

• Negatively-charged DNA migrates through the gel matrix when electric field is applied.

Page 67: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Migration in Agarose Gels

• Molecular size of DNA– Larger molecules migrate more slowly than

smaller molecules• Larger molecules experience more friction• Larger molecules wiggle through pores in

agar matrix slower• Agarose concentration

– Lower concentrations allow better separation of large fragments

– Higher concentrations allow better separation of smaller fragments

Page 68: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Migration in Agarose Gels

• Voltage – At low voltage, rate of DNA fragment migration is

proportional to voltage applied– As voltage increases, range of fragment separation

decreases• Electrophoresis buffer

– Buffers stabilize pH and provide ions for conductivity– Composition and ionic strength of electrophoresis buffer

used to make agarose gel affects mobility of DNA

Page 69: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Migration in Agarose Gels

• Molecular size of DNA– Larger molecules migrate more slowly than

smaller molecules• Larger molecules experience more friction• Larger molecules wiggle through pores in agar

matrix slower

Page 70: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

• Voltage applied– At low voltage, rate of DNA fragments migration is

proportional to voltage applied– Range of separation of fragments decreases as voltage

increases• Electrophoresis buffer

– Buffers stabilize pH and provide ions for conductivity– Composition and ionic strength of electrophoresis

buffer used to make agarose gel affects mobility of DNA

DNA Migration in Agarose Gels

Page 71: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Staining DNA in Agarose Gels

• Ethidium bromide– Contain planar group that intercalates between

stacked bases of DNA– Ethidium bromide dye bound to DNA shows

increased fluorescence than dye in free solution

– DNA can be detected in the presence of free ethidium bromide in gel

Page 72: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Agarose Gel Electrophoresis of PCR Products

pGEM N301 N302 N303 N304 N305 N306 N307 N308 N309 +con -con pGEM

Page 73: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA & Spectrophotometry

• DNA absorbs light at 260nm• Protein absorbs light at 280nm• Salts, phenol, EtOH absorb light at 230nm

Greater the absorbance, the greater the concentration

• 260/280 ratio indicator DNA purity• 260/230 ratio indicator of residual salts

Page 74: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Nanodrop Spectrophotometry

Page 75: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Nanodrop Results

Page 76: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Quality

• Spectrophotometry can’t determine if DNA target or PCR product is dsDNA (intact DNA)

• Alternative methods are required to determine DNA integrity Agilent Bioanalyzer

• Gel on a chip

Page 77: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Agilent Bioanalyzer Overview

Page 78: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Agilent Bioanalyzer

Listeria monocytogenes total RNA

Page 79: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR-based foodborne pathogen detection methods & applications in

the food industryFS 362

Page 80: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Review

• What is polymerase chain reaction (PCR) and what is the purpose of this reaction?

• What role does temperature play in PCR?

• What role do primers play in PCR?

• Characteristics of well-designed primers.

• 5 ways to optimize a PCR reaction.

Page 81: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Today

• PCR platforms• Advantages/Disadvantages of PCR detection

systems• Characteristics of high quality assays• Good Laboratory Practices

Page 82: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

The Central DogmaDNA

mRNA

Protein/Enzymes

Toxins & other metabolites

Molecularmethods

Classicalmethods

DNA replication

Translation

Transcription

Post-translation

Page 83: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA-based detection by PCR

• Detects chromosomal or extra-chromosomal DNA (i.e. plasmids)

• Advantages: –––

• Disadvantages:––

DNA

Page 84: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA-based detection by PCRDNA

mRNA

DNA replication

Transcription

Page 85: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Examples used in industry

• hly assay for Listeria monocytogenes– Listeria spp. v. L. monocytogenes

• invA assay for Salmonella– Salmonella v. non-Salmonella

• Multiplex for STEC – Detection of multiple genes required to identify

strain likely to cause severe disease

Page 86: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Multiplex PCR

• Used to target multiple genes in a single test– Advantages

• More information from a single test• Use less reagents/consumables• Save on time

– Disadvantages• Requires time for optimization

• Single PCR reaction that contains multiple, unique primer sets– Each primer set must amplify fragments of varying sizes specific to different

DNA sequences – Annealing temperatures for each primer set must be similar in order to work

correctly within a single test

Page 87: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Multiplex & STEC

stx1 = 534 bpstx2 = 384 bpeaeA = 255 bpEHEC hlyA = 180 bp

• stx2 > stx1• eaeA required• hlyA required

Page 88: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

RNA-based detection by PCR• Reverse-transcriptase

PCRDNA

mRNA

Protein/Enzymes

Toxins and other metabolites

Reverse transcriptase

cDNA

Page 89: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

RNA-based detection by PCR

• Advantages:––

• Disadvantages:––

DNA

mRNA

Reverse transcriptase

cDNA

Page 90: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Applied Biosystems Salmonella & L. monocytogenes Rapid Detection System

Page 91: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Step 2

Page 92: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Step 3 RT-PCR

Page 93: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Step 4: Analysis

Page 94: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Real-time PCR• Works just as conventional PCR does except:

– Involves fluorescent dye(s)– Data collection throughout the PCR process

• Allows detection of target in real time during DNA amplification

Page 95: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Chemistries Used to Detect Foodborne Pathogens

• SYBR Green• Hydrolysis probe-based (e.g., TaqMan)• Molecular Beacon• Scorpion

Page 96: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

SYBR Green• Binds to double-stranded DNA

– Binds to minor groove of dsDNA– Prefers G and C base pairs

• Light is emitted upon excitation– Optimal excitation/emission wavelengths of 497/520 nm

• Advantages– Inexpensive, easy to use– Minimal effort to design– Works well with a single defined target

• Disadvantages– Binds to any double-stranded DNA

• Primer dimers• Non-specific products

– Dissociation curve or melt curve must follow the PCR protocol

Page 97: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Idaho Technoloogy Inc.

Melt curve analysis

EXAMPLE:• BAX system for detection of

L. monocytogenes or Salmonella

Page 98: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Probe-based PCR: Principle of FRET• Fluorescence Resonance Energy Transfer• Quencher dye and reporter dye

– The excited reporter dye transfers energy to a quencher dye rather than fluorescing

– Quencher dye must be in close proximity to a reporter dye in order to have a “quenching” effect

Close proximity Separation

Reporter/donor excitation

QuencherReporter

Page 99: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Hydrolysis probe-based PCR• Also referred to as TaqMan assay• Takes advantage of 5’→3’ exonuclease activity of Taq

Labeled probe hybridizes to DNA target sequence

Intact probe, the reporter does not fluoresce

Taq cleaves the fluorogenictag from the probe

Page 100: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

RT-PCR

Page 101: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Multiplex Real-Time PCR

TET

FAM

Cy5 Texas Red

Page 102: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Probe-based real-time PCR

• Advantages– Increased specificity– Able to detect multiple targets– Allows for quantification– Faster than conventional PCR

• Disadvantages– Expensive to synthesize

Page 103: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PCR Controls

• PCR Controls– Negative – Use water as the “template”– Positive – DNA that will give the expected result

• Internal or amplification control– Monitor for PCR inhibition

• Reverse-transcriptase PCR– RT-negative control – Sample with no reverse

transcriptase enzyme– Indicator for level of contaminating genomic DNA

Page 104: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

How to evaluate PCR detection methods (i.e., LIFE SKILLS)

• What is the target gene?– How/why was it chosen– What data are available to support the choice

• Virulence data? Sequence data?

• What is the target molecule?– DNA? mRNA? rRNA?– How is expression of mRNA assured?

• What is the assay and assay format?– PCR, other amplification method, detection

without amplification (e.g., ACCUPROBETM)

Page 105: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

How to evaluate molecular detection methods II

• How was the assay validated– Pure cultures, spiked foods, or “real samples”

• What isolates or samples were used• What was used as “gold standard”

- What are the most likely reasons for false positives and false negatives- What does a false negative most likely mean (e.g., does it

suggest an avirulent variant) - How does the assay perform in the presence of

competitive microflora - What controls are included in the assay

- Internal positive control?

Page 106: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Good Laboratory Practices for PCR

• Separate pre-PCR and post-PCR activities– Perform in physically separate areas– Minimize potential contamination with amplified

product– PCR can be set up in sterile hood to minimize

contamination issues. • Use aerosol resistant pipette tips

– Use new pipette tips when transferring samples– Prevent aerosolization when ejecting the tip

• Use powder-free gloves– Change gloves frequently

Page 107: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

GLPs for PCR

• Spin tubes (e.g., sample tubes) briefly to bring contents away from lid– Avoid touching rim/inside lids of tube to

ensure no cross-contamination occurs.

• Work slowly – do not rush• Adequately chill cooling blocks before use.• Minimize freeze/thaw cycles for frozen

reagents.

Page 108: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Sequencing

Page 109: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA sequencing• Biochemical process to determine of the order

of nucleotide bases – Chemical degradation

• (Maxam and Gilbert, 1977)

– Enzymatic synthesis• Sanger Method (Sanger et al., 1977)

• Generate sequences that begin at fixed point and terminate at a particular type of residue (A, T, G or C for Sanger Method)

Page 110: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA sequencingSanger method has served as the workhorse of

DNA sequencing projects for the past 30 years– Human genome sequencing project– >900 microbial genome sequences available– Multiple genome sequences available for many

foodborne pathogens• >20 genome sequences available for Listeria

monocytogenes

Page 111: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA sequencing

• Sequencing relies on DNA chain termination by dideoxynucleotide triphosphates (ddNTPs)

Page 112: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Cycle sequencing demonstration

Page 113: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA sequencing• Termination points are nucleotide specific but

occur randomly along length of target DNA• Generates many fragments of different lengths• Fragments resolved by electrophoresis

– Discriminate DNA’s that differ in length by as little as a single nucleotide

– Four populations loaded into adjacent lanes of sequencing gel, order of nucleotides along DNA can be read from gel image

Page 114: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Classic Sanger sequencing

• Sequencing performed in four separate reactions each containing one of the four ddNTPs

• Run on adjacent lanes in a denaturing polyacrylamide gel

• Short runs and can be difficult to interpret

Page 115: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Automation of Sanger Method• Cycle sequencing/Dye-terminator• 15-40 rounds of conventional thermal cycling

– Denaturation of double stranded DNA– Annealing of primer to sequence– Extension of primer by thermal stable DNA polymerase– Termination of extended strand by ddNTP incorporation

• Fluorescent dyes to ddNTPs that become incorporated to 3’ end of sequencing reaction products– Same primer in a single tube

• Capillary electrophoresis

Page 116: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Electropherograms

Page 117: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA sequencing success• Key to consistent successful cycle sequencing

is cleanliness of DNA template– Impurities (e.g., agarose, salts, proteins) cause

premature termination and pausing of DNA polymerase

– Degraded DNA cause false priming• DNA template should be purified and the

quantity and quality of DNA template should be assessed prior to submitting samples for sequencing

Page 118: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Illumina Sequencing by Synthesis

See link to URL on blackboard

Page 119: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Ion Torrent (Personal Genome Maching (PGM))

http://www.iontorrent.com/the-simplest-sequencing-chemistry/

Page 120: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Pulse Field Gel Electrophoresis

Page 121: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Introduction to PFGE

• DNA – Genetic information of an organism

• Chromosomal DNA – Sequence specificity for each species and even strain– Circular DNA molecule within bacterial cell– Carries all “normal” genes employed for growth and other

practical functions

2

Page 122: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Introduction to PFGE• Chromosome size variety of base pairs and genes for

bacteria:Bacteria Chromosome size (base pairs) Estimated number of genes

Escherichia coli 4,639,211 4,279

Campylobacterjejuni

1,641,481 1,654

Bacillus subtillus 4,214,814 4,112

SalmonellaTyphimurium

4,857,432 4,450

Listeria monocytogenes

2,866,709 2,873

3

Page 123: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Introduction to PFGE• Chromosome size variety of base pairs and genes for

L. monocytogenes:

• How does one differentiate between strains in a rapid manner?

L. monocytogenesstrain

Chromosome size (base pairs)

Estimated number of genes

10403S 2,866,709 2,873EGD-e 2,944,528 2,867

FSL J1-194 2,986,227 3,692FSL-J2-071 3,149,923 3,373FSL R2-503 3,001,696 4,767

4

Page 124: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

What is PFGE?

• Pulse Field Gel Electrophoresis– Molecular method to produce a genetic “fingerprint” or

profile of a bacterial isolate– Creates and visualizes segments of DNA from a bacterial

sample to be compared with other samples– Achieved through breaking of chromosomal DNA into

segments by *restriction enzymes*– Advanced method of gel electrophoresis

5

Page 125: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PFGE Background

• First introduced in 1984 by Schwartz &Cantor in Cell 37:67-75– Described a way to differentiate yeast chromosomes

• Segment chromosomal DNA, utilize non-uniform electric current, compare DNA band profile

– Looked for a way to visualize segments of DNA• Old size limit (50 kilobase)• PFGE capability (10 megabase)

6

Page 126: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PFGE Applications

• Food Safety– Epidemiological studies– Tracking of outbreak strains

• Food Quality– Monitoring subtle changes in fermentation cultures

• Yogurt, beer, wine industries

7

Page 127: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PFGE Applications• Cancer Research

– Observations on dsDNA structure alterations by suspect carcinogens

– Changes in DNA density for specific molecular weight regions indicate structure alterations

• Genomics– Cloning fragments to be sequenced can be separated using

PFGE– DNA fingerprinting and physical chromosome mapping– Location of promoter sites due to DNase sensitivities with

chromatin

8

Page 128: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PFGE Applications

• Epidemiological studies and strain differentiation– Agencies such as PulseNet utilize PFGE to identify similar

or different bacterial strains to:• Differentiate food-related clinical cases based upon suspect

pathogen strain• Allows for accurate tracking of outbreak allowing for source

identification• Goal of improved food safety for the public

9

Page 129: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Segmentation of DNA

• Nuclease – enzymes that breakdown strands of nucleic acids

• Two ways to cut or “restrict” DNA to segments– Exonuclease

• Works from the outside inwards, essentially dismantling DNA piece by piece

• Systematically removes one nucleotide at a time from the end of dsDNA

• Two versions of exonucleases (3’ to 5’ and 5’ to 3’) used to “clean up” polymerase products and other processes

– Endonuclease

10

Page 130: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Restriction Endonucleases (RE)• Cutting or restriction of dsDNA from within the

molecule– RE works at a specific recognition site

• Recognition site is a specific sequence of nucleotides that are identified and cut leaving fragments

11

Page 131: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Restriction Endonucleases

• RE’s read through dsDNA from 5’ to 3’ ends on both strands (palindromes) until digestion site is recognized

• Thousands of different RE’s identified, some repetitive (same recognition site as another RE, called isoschizomers)

• Activity effected by – pH– Ionic strength– Temperature

• Altered activity by changing the above conditions results in slight alterations in recognition sites (referred to as star activity)

12

Page 132: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Restriction Endonucleases

• Employed in PFGE to “randomly” break the chromosome into fragments to be visualized following electrophoresis

• The same RE is used for all samples to be compared (should be the same bacterial species)– Comparison between Listeria monocytogenes isolates from

the same outbreak would use ApaI or AscI (example RE’s)

13

Page 133: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Orientation and Subsequent Digestion

Supercoiled Chromosomal DNA

RE Digestion of DNA

14

Page 134: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Visualization through Gel Electrophoresis• Traditional electrophoresis

– One dimensional application of electrical field– DNA sample size < 50 kb can accurately be visualized– Cause of method restrictions:

• One direction voltage application and strength• 1.0% and higher agarose is too complex/thick to allow large

molecules (> 50kb) to move at different rates meaning one band represents multiple segments

DNA FragmentsGel Particle

Pore

15

Page 135: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

DNA Visualization through Gel Electrophoresis

• Pulse Field GE– Two dimensional application of pulses– Variation in direction of electrical fields

• These electric fields are altered throughout the same electrophoresis run

• Time between shifts or pulses allows for reorientation

– Avoids the limitations of molecular sieving by forcing the molecules to reorient themselves upon shifts in directions

• Application in one direction, pause, reorientation, application in another direction, repeat

• Causing zigzag transversals

16

Page 136: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Comparison of Electrophoresis Fields

_

+

Traditional PFGE

17

Page 137: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Field Inversion Gel Electrophoresis (FIGE)

• Periodical inversion of polarity of electrodes – Shift in pulse application at 180°– Molecules spend part of the time moving backwards

-/+

+/- 18

Page 138: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Transverse Alternating Field Electrophoresis (TAFE)• Employment of two different electrode groups

creating simple geometrical pulse angles• The pulse angle increases as the molecule moves

downwardsA (-)

A (+)B (+)

B (-)

19

Page 139: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Rotating Gel Electrophoresis (RGE)

• RGE is a new form of PFGE• Instead of having multiple or altering charges of

electrodes, the gel itself is moved

_

+ 20

Page 140: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Clamped Homogenous Electrical Field (CHEF)

• Most commonly used form of PFGE

• Applies multiple pulses from varying sources to create additional vectors

• Varying angles result in increased accurate separation and more clear resolution

21

Page 141: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Visualization

• Similar to PCR product visualization, following electrophoresis, PFGE gels are:– Stained with ethidium bromide– Visualized through exposure to UV light

22

Page 142: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Pulse Field Gel Electrophoresis Performance

Page 143: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Review of PFGE Theory

• PFGE– Production of a genetic “fingerprint”

• Creation of large genomic DNA fragments following restriction enzyme digestion

• Such fragments are visualized following gel electrophoresis• Comparing between lanes on the resultant gel allows for:

– Differentiation between strains – Designation of same strain samples

2

Page 144: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Steps for PFGE

1) Culture Preparation and Standardization2) Sample Treatment3) Sample Suspension/”Plug” Preparation4) Restriction Enzyme Digestion5) Pulsed Field Gel Electrophoresis6) Visualization7) Comparison

3

Page 145: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Culture Preparation• Physical removal of a pure culture from agar plate• Resuspension of culture in TE Buffer• Standardization of culture suspension

– Standard quantity of bacteria/mL– Less bacteria is more

• Increased lysis efficiency, increased resolution and sharpness of bands, similar band intensities

4

Page 146: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Sample Treatment• Cell suspension is treated to liberate DNA for further

manipulation– Lysozyme for cell wall digestion

• Hydrolyzes the 1,4-β-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in the peptidoglycan layer

– Proteinase K for degradation of proteins and inactivation of enzymes (DNases, RNases, etc.)

• Cleaves peptide bonds next to carboxyl groups of amino acids

Egg – source of LysozymeEngyodontium album – mold source of Proteinase K

5

Page 147: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Plug Preparation

• A “plug” refers to the physical suspension of the lysed bacterial sample in mixture of:– 1.5% Agarose– 1% Sodium Dodecyl Sulfate

• Detergent aiding in cell lysis steps previously described• Aids effectiveness Proteinase K

• Addition of agarose/SDS mixture to cell suspension– Can either have Proteinase K in cell suspension or plug

preparation• Placement of mixture into a mold to form a plug

6

Page 148: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

What is a “plug”?• Comparison of plug

quality:

2mm width

7

Page 149: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Restriction Enzyme Digestion

• Restriction endonucleases employed to cut/digest DNA molecules at specific points (recognition sites)

• Plug treatments– Plug samples are submerged in RE mixture:

• RE• Buffer• Water

– Buffer type and treatment temperatures are specific for the RE used

• Thorough washing following RE treatment following treatment

8

Page 150: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Restriction Enzyme Digestion

• Reaction Conditions for high specificity (accurate restriction site location)– Buffer

• Provides adequate levels of ionic strengths (Na+, K+, Mg2+)• ~pH 8.0

– Temperature• Efficacy of digestion dependent on temperature of reaction• Related to ideal temperature for organism RE was isolated from

– Ex: RE from a thermophilic bacteria has an ideal temp above 50˚C while an RE from E. coli has an ideal temp at 37˚C

– Residual glycerol (>5%) effects reaction• RE shipped in glycerol

– Concentration of RE• Ideal ~ 40U

– Concentration and purity of DNA sample• Incorrect or partial digestions

– Addition of Bovine Serum Albumin (optional)• Protein shown to aid in binding and specificity

9

Page 151: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Restriction Enzyme DigestionRE Concentration

10U 20U 40U

Asc1 Apa1

Asc1 Apa1

10

Page 152: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Restriction Enzyme Choices

• Overall goal of PFGE: – Comparison of sample fingerprints to determine strain

identities and differentiation

• Accepted practice to do 2 different PFGE runs with at least 2 different RE’s

• RE pairs for specific pathogens have been determined and commonly used– Ex: L. monocytogenes – AscI and ApaI

• Common RE’s published by PulseNet

11

Page 153: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Gel Preparation• Thought PCR gel preparation and loading was challenging?

– Ensure level surface for pouring the gel– Placement of plug into agarose gel– Placement of plug onto comb prior to gel pouring (alternative)

• Following placement of plug in gel, fill in the hole with molten agarose to seal off chamber hole– Prevents the plug from floating out

12

Page 154: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PFGE Performance• Finally, time to run the actual electrophoresis• Components:

a. Gel Chamberb. Pumpc. Chillerd. Chef Mapper Pulse Source

a. d.

c.b.

13

Page 155: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Component Purposes

• Gel Chamber:– Application of pulses from electrodes– Hold gel in centralized locale

• Pump:– Continuously moves recycled buffer through the chamber

• Chiller:– Maintains temperature of buffer and therefore of gel in

chamber• Chef Mapper Pulse Source

– Applies programmed pulses, times, application profiles

14

Page 156: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Important Parameters• Pulse Angles

– Smaller angle of pulse application results in better separation of larger DNA molecules

• Ex: 106˚ vs. 180˚• Smaller molecules crammed together at the end of the run

– Larger angle of pulse application results in better separation of smaller DNA molecules but no separation of larger molecules

– Ideal compromise angle = 120˚

• Run Time– 19 to 24 hrs

15

Page 157: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Important Parameters

• Switch Times – Interval between

alternation of electric fields

• Consider enough time for molecule to reorient itself

• Switch Time Ramping– Altering the amount of

switch times over the length of the electrophoresis run

• Ex: Initial switch time at 30sec; Final switch time at 120sec

– Linear vs. Non-linear Ramping

45 sec 60 sec 90sec

16

Page 158: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Linear vs. Non-linear

17

Page 159: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Important Parameters• Voltage

– Strength of electrical field (pulses) in V/cm units• Large value – faster run, fine for small molecules• Small value – slower run, better resolution for large molecules• Compromise at 6 V/cm

– V/cm – Voltage applied over the distance between the electrodes applying pulses

• Ex: 200V/33cm = ~6V/cm

• Buffer Concentration– TBE 0.5X common

• Increase ionic strength = slower migration • Decrease ionic strength = faster migration, poorer quality

• Buffer Temperature– ~25˚C = fastest run times, poorest resolution and band separation– ~4˚C = slowest run times, best resolution and separation– ~14˚C = compromise, most commonly used

18

Page 160: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Visualization and Comparison• Ethidium Bromide

staining and UV visualization – Same as PCR

• Comparison of lanes– Use of BioNumerics

software to select lanes and produce statistical compatibility

19

Page 161: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Standards• PCR

– Employment of a ladder standard to quantify band size

• PFGE– Employment of universal strain as a standard

• Quantification of band size • Comparison with other PFGE profiles previously run• Allows for universal nature of gels and normalization on specific

band patterns• Standard strain – Salmonella serotype Braenderup H9812

– Digested with specific RE (Xba1)– Range of 20 to 1200kb

20

Page 162: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PFGE Conclusions

• PFGE is a common technique used to create a genetic fingerprint of a sample (bacteria, yeast, etc.)– Plethora of variability in parameters and conditions– Standard procedures for conditions stated by PulseNet

• Genetic fingerprints are compared to determine if samples are the same or different

• Generated similarity used to ID and track outbreak strains as well as other applications– PulseNet and other investigative bodies

21

Page 163: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Pulse Field Gel Electrophoresis;PulseNet

Page 164: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PulseNet

• PulseNet:– Responsible agency for investigating foodborne-related

outbreaks– Employs PFGE to type and store all outbreaks in recent history

for comparison and epidemiological work– Drives early ID of outbreak sources– Standardizes all procedures for molecular fingerprinting– Coordinated by the Center for Disease Control (CDC)– Collaborates with:

• State and local health departments along with other federal agencies (FDA, USDA, FSIS, CDC)

– http://www.cdc.gov/pulsenet/whatis.htm

2

Page 165: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PulseNet- Take on PFGE

• Positives– More discriminating

than ribotyping– Outside of RE choice,

entire process is universal for all bacteria

– Proven to be very reproducible

• Negatives– Time-consuming– High level of skill and

experience required– Bands are not sequences– Same bands are not

necessarily same DNA sequence

– Relatedness are guides not necessarily phylogenic proof

3

Page 166: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

Optimization

• PulseNet driving improvement of PFGE– Standardization

• Protocols• Software• Equipment• Nomenclature of patterns

– Promote workshops for PFGE use

– Annual update symposia– Participants required to

be certified and trained

• Improvement to PulseNet itself– Increase participants– Real-time subtyping and

communication• Clinic to lab• Lab to isolate

differentiation• Isolate to profile

– Food industry?– International?

4

Page 167: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PulseNet International

• International organization spawning from PulseNet in the United States

• Agencies related to Public and National Health Agencies in foreign countries

• Collaboration between nations and research groups to investigate global outbreaks

5

Page 168: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

6

Page 169: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PFGE Gel Interpretation

7

Page 170: Fundamentals: Nucleic acids, DNA replication, … to...Fundamentals: Nucleic acids, DNA replication, transcription, translation and application to molecular detection Prokaryotic cell

PFGE Gel Interpretation

8