Download - Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Transcript
Page 1: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.
Page 2: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Functions

Page 3: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

GenomeEntire set of DNA in each cell of an orgNormally one circular chromosome in

prokaryotes

Page 4: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Binary FissionSingle chromosome replicatesOne pulls awayMembrane & wall separate cell

Page 5: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Human Genome

Haploid(n)

Diploid(2n)

6,000,000,000 base pairs longSomatic cells’ DNA is split into 46

chromosomes23 are maternal23 are paternal

Gametes have ½ the DNA which is split into 23 chroms

Page 6: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Human Genome ( )♂Human Genome ( )♀

1 2 3 4 5 6 7 8

9 10 11 12 13 14 15 16

X21 2219 2017 18 Y

Page 7: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Human ChromosomeA length of DNA

Each has a homologous chromosome

♀ ♂Homologous Pair

CENTROMERES

Page 8: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

A length of DNAEach has a homologous

chromosome1000’s of genes1,000,000’s of base pairsCombined with proteins

Homologous Pair ♀ ♂

ATCGCGGCATTATATACGGCGCCGTA

Human Chromosome

Page 9: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Each chromosome replicates to form identical chromatids

Attached by centromeres

Chromosome Replication

Page 10: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Cell Cycle

Identical distribution of replicated DNA into nuclei of 2

daughter cells

Splitting of the rest of the cell

Page 11: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Late InterphaseCentrosomes replicate

Page 12: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

ProphaseChromosomes supercoilNucleoli disappearSpindle forms

Page 13: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Spindle Elongation

Page 14: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Prometaphase Nuc envelope breaks downmtubules from opposite poles

attach to kinetochores

Page 15: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

MetaphaseSpindle fibers force chroms

to metaphase plate

Page 16: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

AnaphaseChromatids migrate toward

opposite polesNonkinetochore mtubules

elongate cell

Page 17: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Anaphase Chromatid may “walk” along

mtubule toward pole

Page 18: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

TelophaseCell continues elongationNuclear envelopes reformDNA uncoils

Page 19: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Cytokinesis (animal) Microfilaments

constrict cell to form cleavage furrow

Membrane pinches off

Page 20: Functions Genome Entire set of DNA in each cell of an org Entire set of DNA in each cell of an org Normally one circular chromosome in prokaryotes Normally.

Cytokinesis (Plant)

Cellulose vesicles gather in the middle of the cell forming the cell plate