7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
1/13
Expression and agonist responsiveness of CXCR3 variants in human
T lymphocytes
Introduction
Members of the chemokine (chemotactic cytokine) super-
family and their receptors play a major role in the traf-
ficking of immune cells under homeostatic and
inflammatory conditions. They have also been implicated
in distinct biological processes such as angiogenesis, pro-
liferation and apoptosis.15 The interferon-c (IFN-c) -
inducible chemokines CXCL9 (monokine induced by
human IFN-c/Mig), CXCL10 [IFN-c-inducible 10 000molecular weight (MW) protein/IP10] and CXCL11
(IFN-c-inducible T-cell a chemoattractant/ITAC) bind to
their receptor CXCR3.68 Recent studies have shown that
different CXCR3 ligands exhibit unique temporal and
spatial expression patterns, suggesting that they have non-
redundant functions in vivo. Moreover, the CXCR3
ligands share low sequence homology (around 40%
amino acid identity) and exhibit differences in their
potencies and efficacies at CXCR3.912 CXCL11 is believed
to be the dominant CXCR3 agonist, as it is more potent
and efficacious than CXCL10 or CXCL9 as a chemoattr-
actant and in stimulating calcium flux and receptor
desensitization, whereas CXCL9 and CXCL10 exhibit
lower affinities for human CXCR3 in comparison with
CXCL11.6
CXCR3 is preferentially expressed on T helper type 1
(Th1) rather than Th2 cells, and is thought to play a key
role in the recruitment of Th1 cells to sites of inflamma-
tion.1315 It is also expressed on activated CD8+ cells as
well as natural killer cells, malignant B lymphocytes, endo-thelial cells and thymocytes.1315 In addition, functional
CXCR3 is expressed on B cells,1618 mast cells,1921 vascular
pericytes, and several other cell types.2224 Binding of agon-
ists to the CXCR3 receptor results in cellular responses
such as integrin activation, actin reorganization and direc-
tional migration. In T lymphocytes, the stimulation of
CXCR3 by its agonists leads to elevation of intracellular
calcium25 as well as activation of phosphoinositide 3-
kinase (PI3K)/Akt-dependent signalling and p44/p42 extra-
cellular signal-regulated kinase (ERK) pathways.26 CXCR3
Anna Korniejewska,1 Andrew J.
McKnight,2 Zoe Johnson,2 Malcolm
L. Watson1 and Stephen G. Ward1
1Department of Pharmacy and Pharmacology,
University of Bath, Claverton Down, Bath,
and 2UCB, Slough, UK
doi:10.1111/j.1365-2567.2010.03384.x
Received 27 July 2010; revised 19 October
2010; accepted 19 October 2010.
Correspondence: Prof. S. G. Ward,
Inflammatory Cell Biology Laboratory,
Department of Pharmacy and Pharmacology,
University of Bath, Claverton Down, BA2
7AY Bath, UK. Email: [email protected]
Senior author: Stephen G. Ward
Summary
The chemokine receptor CXCR3 and its ligands CXCL9, CXCL10 and
CXCL11 are involved in variety of inflammatory disorders including mul-
tiple sclerosis, rheumatoid arthritis, psoriasis and sarcoidosis. Two alter-
natively spliced variants of the human CXCR3-A receptor have been
described, termed CXCR3-B and CXCR3-alt. Human CXCR3-B binds
CXCL9, CXCL10, CXCL11 as well as an additional ligand CXCL4. In con-
trast, CXCR3-alt only binds CXCL11. We report that CXCL4 induces
intracellular calcium mobilization as well as Akt and p44/p42 extracellular
signal-regulated kinase phosphorylation, in activated human T lympho-
cytes. These responses have similar concentration dependence and time
courses to those induced by established CXCR3 agonists. Moreover, phos-
phorylation of Akt and p44/p42 is inhibited by pertussis toxin, suggesting
coupling to Gai protein. Surprisingly, and in contrast with the other
CXCR3 agonists, stimulation of T lymphocytes with CXCL4 failed to elicit
migratory responses and did not lead to loss of surface CXCR3 expres-
sion. Taken together, our findings show that, although CXCL4 is coupled
to downstream biochemical machinery, its role in T cells is probably dis-
tinct from that of CXCR3-A agonists.
Keywords: chemokine receptors; inflammation; signal transduction; T
cells
2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515 503
I M M U N O L O G Y O R I G I N A L A R T I C L E
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
2/13
activation has also been shown to induce rapid tyrosine
phosphorylation of several proteins including zeta-associ-
ated protein of 70 000 MW (ZAP-70), linker for the activa-
tion of T cells (LAT) and phospholipase-C-c1 (PLCc1).27
Expression of CXCR3-binding chemokines dramatically
increases during inflammation and tissue injury, most
likely as a consequence of increased IFN-c secretion. These
chemokines are crucial in directing activated T cells to the
sites of inflammation and CXCR3 and its agonists have
been implicated in the induction and perpetuation of sev-
eral human inflammatory disorders15 including atheroscle-
rosis,28 autoimmune diseases,29 transplant rejection30,31
and viral infections32 making this receptor an attractive tar-
get for new anti-inflammatory drugs. In recent years, two
variants of the CXCR3 receptor have been identified,
namely CXCR3-B33 and CXCR3-alt.34 Both variants are
generated via alternative splicing of mRNA encoding the
original CXCR3 receptor (henceforth referred to as
CXCR3-A). In the case of CXCR3-B, alternative splicing
results in extension of the N terminus by 52 amino acidsand this form of the receptor has been shown to bind
CXCL4 (platelet factor 4, PF4) in addition to the three
established CXCR3 agonists.33 Agonistreceptor interac-
tions between CXCR3-B and CXCL4 were shown to induce
apoptotic signals in microvascular endothelial cells; how-
ever, neither a chemotactic response towards a CXCL4 gra-
dient nor calcium flux was observed in CXCR3-B
transfectants.33 In contrast, CXCR3-alt is a 101-amino-
acid-truncated version of CXCR3 that consequently exhib-
its a dramatically altered C terminus and a predicted 45
transmembrane domain structure.34 Despite this drastically
modified structure, CXCR3-alt has been shown to bind toCXCL11 and elicit biochemical signals, yet curiously it does
not signal in response to CXCL9 or CXCL10.34 In addition,
CXCL11 (but not other CXCR3 agonists) binds to CXCR7,
a receptor that has been associated with increased adhesive-
ness, invasiveness and reduced apoptosis of human umbili-
cal vein endothelial cells and tumour cells.35,36
In this study we examined the expression of CXCR3
variants on activated human T lymphocytes and used
CXCL4 as a tool to investigate CXCR3-B-mediated
responses in T cells. We observed that CXCL4 induced
biochemical responses (intracellular calcium mobilization
as well as phosphorylation of Akt and p44/42 ERK) in T
lymphocytes. However, despite being comparable in mag-nitude with signals elicited by CXCR3 agonists, the
CXCL4-induced signals are insufficient to elicit a migra-
tory response.
Materials and methods
Reagents
Recombinant human CXCL9, CXCL10, CXCL11 and
CXCL4 were obtained from PeproTech (London, UK).
Phycoerythrin (PE) and fluorescein isothiocyanate (FITC)
-conjugated mouse IgG1, anti-human CXCR3 monoclonal
antibody (clone 49801), IgG2A isotype control, FITC-con-
jugated mouse anti-human CD8 (isotype IgG2B, clone
37006) and appropriate isotype were obtained from R&D
Systems (Abingdon, UK). The FITC-conjugated mouse
anti-human CD3 (isotype IgG1j, clone WT31), CD4
(IgG1j, clone 11830) antibodies and IgG1j isotype con-
trol were purchased from BD Biosciences (Oxford, UK).
Polyclonal anti-phospho-p44/p42 Erk (Thr202/Tyr204)
antibody and polyclonal anti-phospho-Akt (Ser473) anti-
body, both produced in rabbit, were obtained from Cell
Signaling Technology, New England Biolabs (Hitchin,
UK). Akt1 and Erk1 antibodies were obtained from Santa
Cruz Biotechnology (Santa Cruz, CA). Secondary anti-
rabbit horseradish peroxidase (HRP) and anti-goat HRP
antibodies were from Dako Ltd (Cambridge, UK). Borde-
tella pertussis toxin was purchased from Calbiochem
(Leicestershire, UK). The CXCR3 antagonists T487
(AMG487), and NBI-74330 were synthesized and suppliedto S.G.W. for research purposes only by UCB (Cam-
bridge, UK).
Isolation and in vitro expansion of T cells
Procedures for the use of human blood were carried out
under University and Departmental safety and ethical
guidelines for the use of human tissue. Peripheral blood-
derived mononuclear cells (PBMCs) were isolated from
heparinized peripheral blood obtained from healthy vol-
unteers and isolated as detailed previously.37 Briefly,
whole blood was mixed 1 : 1 with RPMI-1640 mediumand separated by differential centrifugation using Lym-
phoprep (Axis-Shield, Cambridgeshire, UK). The PBMC
layer was diluted in RPMI-1640, washed three times and
resuspended in RPMI-1640 complete medium (RPMI-
1640 supplemented with 10% fetal calf serum and 50 U/
ml penicillin plus 50 lg/ml streptomycin). The PBMCs
were stimulated for 3 days using 10 lg/ml Staphylococcal
enterotoxin B (SEB; Sigma-Aldrich, Poole, UK) and cul-
tured at 37 in a humidified 5% CO2 environment. On
day 3, cells were washed from SEB, and kept in culture
in RPMI-1640 complete medium supplemented every
23 days with interleukin-2 (IL-2; 20 ng/ml) (PeproTech).
Cells were maintained up to a maximum of 12 days, andused 912 days after isolation and activation. Our method
of activated peripheral blood-derived T-lymphocyte gen-
eration consistently yielded an almost pure T-lymphocyte
population that was approximately 80% CD4+ at days 5
and 12 post-isolation.37
Reverse transcription-PCR, primers
Total RNA was purified from cultured T cells isolated
from the blood obtained from different donors using
504 2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515
A. Korniejewska et al.
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
3/13
TRIzol reagent (Invitrogen, Paisley, UK) according to
the manufacturers instructions. The cDNA was prepared
by reverse transcription with oligo-dT using the Omni-
script RT kit (Qiagen, Crawley, UK) according to the
manufacturers protocol and used as a template for
amplification by PCR with primers specific to the
CXCR3-A, CXCR3-B and CXCR3-alt genes. The PCR
were performed for CXCR3-A and CXCR3-alt (accession
number X95876), CXCR3-B (accession no: AF469635)
specific primers (CXCR3-A 50 primer: CCAAGTGC-
TAAATGACGCCG; CXCR3-A 30-primer: CAAAGGCCA
CCACGACCACCACCA which yield products of 770 bp;34
CXCR3-B 50 primers ATGGAGTTGAGGAAGTACGGCC
CTGGAAG; CXCR3-B 30 primers: AAGTTGATGTTGAA
GAGGGCACCTGCCAC, which yield 545-bp products;
CXCR3-alt 50 primers CCAAGTGCTAAATGACGCCG,
CXCR3-alt 30 primers CTCCCGGAACTTGACCCCTGTG
which yield 622-bp products. This primer was designed
to combine the CXCR3-alt-specific sequence that arises
from joining bases on positions 695 and 1033.34 b-Actinprimers were used as loading controls. Products were sep-
arated by electrophoresis on a 12% agarose gel and visu-
alized by UV transillumination.
Generation of CXCR3 constructs
To generate the CXCR3 variant constructs, the CXCR3-A,
-B and -alt open-reading frames were amplified by PCR
from human cDNA (Clontech, Saint-Germain-en-Laye,
France). HindIII and KpnI sites were introduced to the
PCR products which were then subcloned into the pEGFP
vector (Clontech) allowing fusion with enhanced greenfluorescent protein at the C termini of CXCR3 variants.
Fragments were then cloned into pcDNA3.1 vector (Invi-
trogen) via HindIII and NotI sites. Plasmids were then
transformed into TOP10 or DH5a bacteria. Positive colo-
nies were screened by colony PCR and confirmed by
sequencing. The HEK293 human embryonic kidney cells
maintained in RPMI-1640 complete medium were
transfected using LT1-Trans transfection reagent (Mirus;
Cambridge BioScience, Cambridge, UK) following the
manufacturers protocol. Mock transfections were carried
in the same fashion with an empty pcDNA3.1 vector.
Cell stimulation and immunoblotting
To analyse biochemical signalling through the CXCR3
receptor, days 912 human T cells were washed three
times in RPMI-1640 medium and re-suspended to a con-
centration of 1 106/500 ll. Cells were then incubated
for 30 min at 37 in the absence or presence of antago-
nists. Cells were stimulated with CXCR3 agonists diluted
in RPMI-1640, then centrifuged and lysed by addition of
100 ll solubilization buffer (50 mM TrisHCl pH 75,
150 mM NaCl, 1% Nonidet P40, 5 mM EDTA, 1 mM
sodium vanadate, 1 mM sodium molybdate, 10 mM sodium
fluoride, 40 lg/ml PMSF, 07 lg/ml pepstatin A, 10 lg/ml
aprotinin, 10 lg/ml leupeptin, 10 lg/ml soyabean trypsin
inhibitor). The samples were mixed and gently rotated at
4 for 20 min and then centrifuged at 600 g for 10 min.
The supernatant was transferred to fresh tubes and diluted
1 : 1 with 10% SDS containing 1 sample buffer. Before
loading into the gel, samples were boiled for 5 min at 100.
The samples were separated by electrophoresis in 10%
SDSPAGE. Proteins were then electro-transferred onto
nitrocellulose membrane, blocked in 5% milk and incu-
bated with rabbit phosphospecific anti-p44/p42 Erk (1/
1000), and anti-Akt/PKB serine 473 (1/1000) as primary
antibody and anti-rabbit HRP (1/10 000) as secondary
antibody. Immune complexes were visualized using
enhanced chemiluminescence (ECL Western blotting sys-
tem; Amersham Bioscience, Little Chalfont, UK). To con-
firm equal loading, membranes were stripped by
incubation in stripping buffer (100 mM 2-mercaptoethanol,
2% SDS, 625 nM TrisHCl pH 67) at 60 for 20 min andre-probed with Akt1 or Erk1 antibodies.
Flow cytometry
Day 912 SEB-activated and IL-2-maintained T cells
(1 106 per sample) were washed, re-suspended in ice-
cold FACS buffer (PBS containing 5% fetal calf serum)
and incubated with PE-conjugated mouse monoclonal
anti-CXCR3 antibody or mouse IgG1 isotype control, on
ice. After 30 min, cells were washed twice in FACS buffer
and analysed using a FACSCanto flow cytometer (BD
Biosciences) and DIVA software.
CXCR3 surface expression assay
CXCR3-expressing T cells were incubated with various
concentrations of CXCL9, CXCL10, CXCL11 or CXCL4
for different times as indicated. In some experiments, T
cells were pre-incubated for 30 min with different con-
centrations of CXCR3 antagonists before the addition of
chemokines. At the end of these experiments, ice-cold
FACS buffer was added, and cells were studied for cell
surface expression of CXCR3 as described above. Mean
fluorescence intensity (MFI) values were obtained by sub-
tracting the MFI of the isotype control from the MFI ofthe positively stained sample. Decrease in CXCR3 surface
expression was expressed as a percentage of baseline
expression using the formula: MFI of stimulated cells/
MFI of untreated cells 100.
In vitro chemotaxis assay
Chemotaxis assays were performed using a 96-well plate-
based ChemoTx system as described previously.38
Briefly, cells were washed and resuspended at
2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515 505
CXCR3 variants in human T lymphocytes
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
4/13
32 106 cells/ml in RPMI-1640 medium containing
01% BSA. Wells were loaded with 29 ll chemokine
(lower chamber) and overlaid with a 5 lm pore-size fil-
ter. The cell suspension (25 ll) was placed on the hydro-
phobic surface surrounding each well on the filter (upper
chamber), and the plate was incubated in a humidified
incubator at 37, 5% CO2 for 3 hr. Cells migrating to the
bottom chamber were counted using flow cytometry as
previously described.39
Intracellular calcium mobilization
Previously activated T cells were washed twice in RPMI-
1640 medium, resuspended at the concentration
1 106 cells/ml in the same medium and loaded with 5 lM
Fluo-4AM (Invitrogen, Renfrew, UK). Cells were then
washed twice, resuspended in assay buffer (147 mM NaCl,
2 mM KCl, 10 mM HEPES, 12 mM glucose, 1 mM MgCl2,
2 mM CaCl2, pH 73 with NaOH) and aliquots were placed
in a 96-well plate at 1 105 cells/well and treated asdescribed in the figure legends. Real-time fluorescence was
recorded (excitation 485 nm, emission 520 nm) every 3
10 seconds using a multimode platereader (Fluostar
Optima; BMG Labtech, Aylesbury, UK) before and after
stimulation with chemokines. Data were expressed as a
change in fluorescence units or fold basal response.
Results
Determining expression of CXCR3 in human-blood-
derived T lymphocytes
Freshly isolated human T lymphocytes express low levels
of CXCR3 on their surface, but expression was markedly
up-regulated following T-cell activation with the superan-
tigen SEB (which provides an intense polyclonal immune
response without the need of antigen-specific recognition)
and subsequent maintenance in IL-2 (Fig. 1a). The com-
mercially available anti-CXCR3 antibodies are unable to
distinguish between CXCR3-A, CXCR3-B and CXCR3-alt,
although selective CXCR3-B antibodies are not widely
available and there are currently no reported CXCR3-alt
specific antibodies. Therefore, we investigated the pres-
ence of mRNA expression for each variant of CXCR3
(Fig. 1b). Our data show that at the mRNA level,CXCR3-A, CXCR3-B and CXCR3-alt are all expressed on
SEB/IL-2-activated T lymphocytes.
CXCR3 agonists and CXCL4 stimulate intracellular
calcium elevation and PI3K/Akt and p44/p42 ERK
signalling
Given the limitations of existing CXCR3-B antibodies,
we assessed responsiveness to CXCL4 as an indirect esti-
mate to establish whether functional CXCR3-B was
expressed on T cells. This chemokine was initially
reported to activate CXCR3-B but not other CXCR3 iso-
forms.33 However, further studies by Mueller et al.40
suggested that CXCL4 binds to and activates both A and
B isoforms of CXCR3. For further examination of the
role of CXCL4 and its receptor interaction in T cells, we
tested the ability of CXCL4 to induce the elevation of
intracellular free calcium and compared this response
with those induced by other CXCR3 agonists. All
chemokines examined, increased intracellular free cal-
cium levels in T cells previously activated with SEB
(Fig. 2). However, CXCL4 elicited a less robust response
compared with other CXCR3 agonists and a high(micromolar) concentration of CXCL4 was required to
induce intracellular calcium elevation to levels compara-
ble with the responses induced by nanomolar amounts
of CXCL9, CXCL10 or CXCL11 (Fig. 2). CXCL11 was
also able to stimulate higher maximal responses than the
other chemokines examined.
To study signalling, the effect of each chemokine on
PI3K/Akt and p44/p42 ERK pathways was assessed in
previously activated T lymphocytes. CXCL9, CXCL10,
CXCL11 and CXCL4 stimulated PI3K/Akt-dependent
(a)
100 Freshly purified T cells
80
60
40
Coun
ts
20
0100 101 102
CXCR3103
Donor 1CXCR3-A
770 bp
CXCR3-alt622 bp
CXCR3-B545 bp
300 bpRT: + +
b-actin
Donor 2
104 100 101 102
CXCR3103 104
100 SEB/IL-2 activated T cells
80
60
40
Coun
ts
20
0
(b)
Figure 1. CXCR3 receptor is highly expressed on activated human
peripheral blood-derived T lymphocytes. (a) Freshly isolated (left his-
togram) and Staphylococcus enterotoxin B (SEB)/interleukin-2 (IL-2)
activated (day 9) T lymphocytes (right histogram) were stained with
anti-CXCR3 monoclonal antibody (open histograms) or with isotype-
matched immunoglobulin controls (filled histograms) as detailed in
Materials and methods. (b) Messenger RNA from 5 106 SEB/IL-2-
activated T cells was extracted and incubated in the presence (+) or the
absence ()) of reverse transcriptase to ensure that samples were not
contaminated with genomic DNA. Reverse transcription-PCR was per-
formed using primers to specifically amplify CXCR3-A, CXCR3-B, and
CXCR3-alt cDNA and products were separated on agarose and visual-
ized under UV light. Data from two donors are shown, representative
of results from three other different donors.
506 2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515
A. Korniejewska et al.
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
5/13
signalling, as measured by phosphorylation of Akt/PKB
at Ser473. In addition, all agonists stimulated p44/p42
phosphorylation at Thr202 and Tyr204 (Fig. 3). Curiously,
the responses to CXCL4 lacked a conventional concen-
tration-dependent profile and the significance of this is
discussed later. The Akt and p44/p42 phosphorylation
responses to all agonists occurred rapidly and transiently
with complete attenuation of responses after 10 min
stimulation (Fig. 4a), although CXCL11-stimulated phos-
phorylation was detectable earlier (within 30 seconds)
and was more sustained in comparison with the other
agonist responses.
(a) (b)
400
300
200
100
Change
influorescenceun
its
0
400
300
200
100
Change
influorescenceun
its
00 20 30 40 50 60
CXCL11 10 nM CXCL9 10 nMCXCL10 10 nM CXCL4 10 MCtl
70 80
Time (seconds)
90 100100 9 8 7 6
Log [agonist] (M)
Figure 2. CXCR3 agonists and CXCL4 induce intracellular calcium flux in T cells. Staphylococcus enterotoxin B (SEB)/interleukin-2 (IL-2) activated
T cells (day 912) were loaded with Fluo-4 AM at 37 for 30 min. Cells were then washed twice in RPMI-1640 medium and aliquoted at
1 105 cells/well as described in the Materials and methods and treated with the indicated concentrations of each agonist (a) or with 10 nm of each
agonist for the times indicated (b). Changes in fluorescence were measured using multimode plate reader (Fluostar Optima). Peak responses from
each stimulation were taken to create a concentrationresponse curve. Error bars represent mean SEM of four experiments using cells from differ-
ent donors.
C 03
200
150
100
50
NormalisedpAkt
immunoreactivity
Normalised
p-p
42/44MAPK
immunoreactivity
0
200
500
400
300
200
100
0
500
600
700
400
300
200100
0
250
150
100
50
0
200
300
100
10001500
1250
1000
750
500250
0
800
600
400
200
0
0
150
100
50
0 03 1 3 10 30 100 03 1 3 10 30 100 03 1 3 10 30 100 03 1 3 10 30 100
CXCL4 (nM) CXCL9 (nM) CXCL10 (nM) CXCL11 (nM)
1 3 10 100
CXCL4 (nM) CXCL9 (nM)
30 C 03 1 3 10 10030
CXCL10 (nM) CXCL11 (nM)
C 03 1 3 10 10030 C 03 1 3 10 100
pAkt
p-p44/p42
Erk130
Figure 3. CXCR3 agonists and CXCL4 induce phosphorylation of p44/p42 extracellular signal-regulated kinase (ERK) and protein kinase B
(PKB)/Akt. Aliquots of activated T cells (1 106 cells/500 ll) were left untreated or stimulated in parallel at 37 with 0.3100 nm CXCR3 agonist
for 2 min. Cells were lysed by the addition of 1 sample buffer. Cell lysates were resolved by SDSPAGE, transferred to nitrocellulose mem-
branes, and immunoblotted with a phospho-specific p44/42 ERK or Akt antibody with affinity for the active Ser473-phosphorylated form of Akt
and proteins were visualized with enhanced chemiluminescence. The blots were stripped and reprobed with anti-Erk1 antibody to verify equal
loading and efficiency of protein transfer (lower panel). p44/p42 ERK and Akt phosphorylation (mean from four experiments, SEM) was quan-
tified by densitometry and corrected for total Erk1 expression on stripped blots. The immnoblots shown are derived from a single experiment
representative of at least four others using cells from different donors.
2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515 507
CXCR3 variants in human T lymphocytes
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
6/13
Sensitivity of CXCR3 agonist responses to pertussis
toxin
The CXCR3 receptor has been previously shown to be
coupled to Gi protein, yet the CXCR3-B variant has been
reported to be pertussis toxin-insensitive and possibly Gscoupled.33 Therefore, for further investigation of signal-
ling through CXCR3-A and CXCR3-B, T lymphocytes
were pre-treated for 16 hr with 10 ng/ml pertussis toxin
and its effect on Akt and p44/42 ERK phosphorylation
was determined. As expected, pre-treatment with pertussistoxin completely inhibited CXCL9-, CXCL10- and
CXCL11-induced phosphorylation of both Akt and p44/
p42 MAP kinases (Fig. 4b). Previously, CXCR3-B-medi-
ated responses to CXCL4 in other systems were reported
to be pertussis toxin-resistant.33 It was surprising there-
fore that in our experimental system, CXCL4-induced
phosphorylation of Akt and p44/p42 was inhibited by
pertussis toxin (Fig. 4b).
Migratory responses to CXCL9, CXCL10, CXCL11
and CXCL4
Having established pertussis toxin-sensitive biochemicalresponsiveness to CXCL4 we next explored whether it
could elicit functional responsiveness by assessing cell
migration. The SEB-activated T lymphocytes mounted
migratory responses to increasing concentrations of
CXCL9, CXCL10 and CXCL11. Commensurate with the
more robust activation of biochemical signals stimulated
by CXCL11, this agonist elicited migratory responses
greater than either CXCL9 or CXCL10 (Fig. 5). In con-
trast, we were unable to detect any migratory response
towards CXCL4 (Fig. 5) over the same concentration
range and which had previously been demonstrated to
elicit biochemical responses (Figs 3 and 4).
Agonist-induced down-regulation of CXCR3 surface
expression in response to CXCL9, CXCL10,
CXCL11 and CXCL4
A feature of chemokine interaction with the G-protein-
coupled receptor (GPCR) is rapid receptor internalization,
which leads to signal attenuation and desensitization,
CXCL4(a) (b)CXCL10
CXCL9
C 05 1 2 5 10 30 C 05 1 2 5 1030 (min)
CXCL11
pAkt
p-p44/42
Erk1
pAkt
p-p44/42
Erk1
pAkt PTX
CXCL
4
CXCL
9
CXCL
10
CXCL
11
+ + + + C
p-p44/42
Erk1
Figure 4. CXCR3 agonists and CXCL4 stimulate time-dependent phosphorylation of p44/p42 extracellular signal-regulated kinase (ERK) and pro-
tein kinase B (PKB)/Akt. Aliquots of activated T cells (1 106 cells/500 ll) were left untreated or stimulated in parallel at 37 with 1 nm CXCR3
agonist for the times indicated (a) or pre-treated with 10 ng/ml pertussis toxin for 16 hr before stimulation with CXCR3 agonists (1 nm) for
2 min (b). Cells were lysed by the addition of 1 sample buffer. Cell lysates were resolved by SDSPAGE, transferred to nitrocellulose mem-
branes, and immunoblotted with a phospho-specific Erk or Akt antibody with affinity for the active Ser473-phosphorylated form of Akt and pro-
teins were visualized with enhanced chemiluminescence. The blots were stripped and reprobed with anti-Erk1 antibody to verify equal loading
and efficiency of protein transfer (lower panel). The data shown are derived from a single experiment performed three times using cells from
different donors.
2000
CXCL11CXCL9CXCL10CXCL4
1750
1500
1250
1000
750
Numberofcellsmigrated
500
2500 10 9 8 7 6
Log [Chemokine] (M)
Figure 5. CXCL9, CXCL10 and CXCL11 but not CXCL4 stimulate
migratory responses in human activated T lymphocytes. Staphylococ-
cus enterotoxin B (SEB)/interleukin-2 (IL-2) activated T lymphocytes
(32 106 cells/ml) were placed on the upper membrane of a 96-well
chemotaxis plate above a lower chamber containing CXCR3 agonists
at the indicated concentrations as described in the Materials and
methods. Cell migration across a 5-lm pore size membrane was
determined after a 3 hr incubation at 37 in 5% CO2. Cells migrat-
ing to the bottom chamber were counted using flow cytometry as
described in the Materials and methods. Data shown are mean
SEM of triplicate values from a single experiment and are representa-
tive of three other experiments using cells from different donors.
508 2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515
A. Korniejewska et al.
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
7/13
providing a regulatory mechanism for intracellular
responses.41,42 We used the loss of surface expression of
CXCR3 as an indirect measurement of internalization in
response to agonist binding. T lymphocytes were exposed
to various concentrations of agonists for 30 min or alterna-
tively were incubated with 100 nM of each agonist for dif-
ferent periods of time. CXCR3 surface expression was then
detected by flow cytometry using a mouse monoclonal
anti-human CXCR3 antibody. Because the antibody does
not distinguish between CXCR3 variants we cannot distin-
guish between effects on CXCR3-A, CXCR3-B and
CXCR3-alt and could only interpret our results as
decreased total surface CXCR3. Accordingly, CXCL9,
CXCL10 and CXCL11 all induced concentration-depen-
dent and time-dependent decreases in total CXCR3 surface
expression (Fig. 6a,b), with CXCL11 being the most effi-
cient stimulus for loss of cell surface CXCR3. Stimulation
with CXCL11 (100 nM) reduced surface expression of
CXCR3 by about 85% of control level after 1 hr incubation
(Fig. 6b). In contrast, the maximum losses of surface
expression detected in response to the same concentrations
of CXCL9 or CXCL10 were around 30% and 50% of basal
level, respectively. Importantly, incubation with CXCL4 did
not result in any detectable internalization of CXCR3 at
comparable time-points and concentrations used for the
other CXCR3 agonists.
Effect of small CXCR3 antagonists on CXCR3-
mediated responses
To investigate further whether the biochemical signalling
elicited by CXCL4 was indeed mediated by a CXCR3 iso-
form, we used the small non-peptide CXCR3 antagonists,
T487 and its analogue NBI-74330.43,44 First, we verified
that these inhibitors targeted CXCR3 by examining their
effect on CXCL11-stimulated migration, loss of receptor
expression and biochemical signalling, given that it exhib-
ited higher potency and efficacy in our experiments in
comparison with CXCL9 and CXCL10. Both T487 and
NBI-74330 inhibited directional migration to CXCL11 ina concentration-dependent manner with IC50 values of 69
and 23 nM, respectively (Fig. 7a), which are comparable
with those reported elsewhere.43,44 Further, loss of surface
expression of CXCR3 in response to CXCL11 was inhib-
ited after treatment with T487 and NBI-74330 (Fig. 7b)
with IC50 values of about 140 and 02 nM, respectively.
However, these antagonists did not completely inhibit the
loss of surface expression, perhaps because of low levels
of constitutive CXCR3 internalization occurring indepen-
dently of agonist binding. Third, both compounds inhib-
ited CXCL11-stimulated phosphorylation of Akt/PKB and
p44/p42 ERK (Fig. 7c). Inhibition of signalling was seenover a concentration range similar to that observed in
our chemotaxis and internalization experiments. Migra-
tory and biochemical responses to CXCL9 and CXCL10
were also inhibited by both T487 and NBI-74330 at con-
centrations known to elicit near-maximum inhibition of
CXCL11 responses (Figs 7d and 8). Neither T487 nor
NBI-74330 had any effect on responses to the CXCR4
agonist CXCL12, which was used as negative control
(Fig. 7d). As CXCL4 was not able to induce migratory
responses in human T cells, we examined the effect of
CXCR3 antagonists against CXCL4-stimulated Akt/PKB
and p42/p44 ERK phosphorylation. We found that nei-
ther Akt/PKB nor p42/p44 phosphorylation induced byCXCL4 was sensitive to these CXCR3 inhibitors (Fig. 8).
CXCR3-B expressing HEK293 cells are responsive to
CXCL4
For further investigation of the responses mediated by
identified CXCR3 isoforms, we transiently expressed
cDNA constructs expressing CXCR3-A, CXCR3-B and
CXCR3-alt in HEK293 cells (Fig. 9a). As reported previ-
ously for other cell types, such as the pre-B-cell line L1.2
(a)
(b)
0
120
100
80
60
40
20
CXCR3surfaceexpress
ion
(%)
CXCR3surfaceexpress
ion
(%)
0
120
100
80
60
40
20
00 1 2 5 10
Time (min)30 60
1011 9 8 7 6
Log [Chemokine] (M)
CXCL11
CXCL9CXCL10
CXCL4
CXCL11
CXCL9
CXCL10
CXCL4
Figure 6. Stimulation with CXCL9, CXCL10 or CXCL11, but not
CXCL4, induces down-regulation of CXCR3 surface expression. Pre-
viously activated T cells (day 912, 1 106/500 ll) were stimulated
with increasing concentrations of CXCL4, CXCL9, CXCL10 or
CXCL11 over 30 min (a), or with 100 nm of each agonist for up
160 min (b). Agonists were then washed off and cells were incu-
bated with anti-CXCR3 antibody or isotype control at 4 followed
by analysis FACSCanto flow cytometer as described in the Materi-
als and methods. Decreases in CXCR3 surface expression is expressed
as a percentage of CXCR3 levels detected on unstimulated cells. Pre-
sented data represent mean SEM of at least three independent
experiments using cells from different donors.
2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515 509
CXCR3 variants in human T lymphocytes
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
8/13
and also in endothelial cells,33,40 consistently lower levels
of surface expression were obtained for CXCR3-B trans-
fectants making direct comparison difficult. In addition,
apparent expression of CXCR3-alt was even lower than
that observed for CXCR3-B. Differences in expression lev-
els may also be explained by different affinities of anti-
body binding of CXCR3-B and CXCR3-alt. We then went
on to assess the ability of CXCL11 and CXCL4 to induce
intracellular calcium elevation in HEK293 expressing each
isoform of CXCR3. CXCL11 (30 nM) induced responses
in HEK293 cells expressing all variants of CXCR3.
Responses detected in CXCR3-A transfectants were more
robust than those observed in CXCR3-B- and CXCR3-alt-
expressing cells. These observations are supported by pre-
vious findings that CXCL11 was shown to have higher
affinity for CXCR3-A than other isoforms,33,34 but may
also reflect different levels of receptor expression. CXCL4
(300 nM) induced calcium elevation in cells expressing
CXCR3-A or CXCR3-B. This was surprising because it
has been previously reported that CXCL4 exhibits the
(a)(c)100
NBI-74330
T487
NBI-74330
NBI-74330 (nM)
p-p44/42
Erk1
p-p44/42
Erk1
Con
tro
l
CXCL
11
CXCL11 +
CXCL11 +
T487 (nM)
01 1 1
0
1
00
10
00
Con
tro
l
CXCL11
01 1 1
0
100
1000
T487
80
60
40
Inhibition
(%)
20
2000
4500
4000
3500
3000
2500
2000
1500
500
0
1000
4500
DMSOT487NBI-74330
4000
3500
3000
2500
2000
1500
500
1000
1500
Num
bero
fce
llsm
igra
ted
Num
bero
fce
llsm
igra
ted
Num
bero
fce
llsm
igra
ted
1000
500
0
100
80
60
40
Inhibition
(%)
20
0
11 10
0 10 9 8 7
9 8 7 6
Log [antagonist] (M)
Log [CXCL10] (M)
0 10 9 8 7
Log [CXCL9] (M)
0 10 9 8 7
Log [CXCL12] (M)
12 10 8 6 40Log [antagonist] (M)
5
(b)
(d)
Figure 7. CXCR3 antagonists inhibit CXCL11-mediated responses in human T cells. Staphylococcus enterotoxin B (SEB)/interleukin-2 (IL-2) acti-
vated T lymphocytes (32 106
cells/ml; day 912 post-activation) were incubated for 30 min with the CXCR3 antagonists T487 or NBI-74330 atconcentrations indicated (a, b, c) or 1 lm and 100 nm, respectively (d). Cells were then used in migration (a,d), biochemical (c) or receptor sur-
face expression assays (b). For migration assays, cells placed on the upper membrane of a 96-well chemotaxis plate above a lower chamber con-
taining 1 nm CXCL11 (a) or concentrations indicated (d). Cell migration across a 5-lm pore size membrane was determined as described in the
Materials and methods. For receptor surface expression assays (b), T cells were stimulated with 30 nm of CXCL11 for 5 min. Agonist was then
washed off and cells were incubated with anti-CXCR3 antibody or isotype control at 4 followed by analysis FACSCanto flow cytometer as
described in the Materials and methods. Data (a, b, d) represent mean SEM of at least three independent experiments using cells from different
donors. (c) Aliquots of activated T cells (1 106 cells/500 ll) were left untreated or stimulated at 37 with 1 nm CXCL11 for 2 min in the
absence or presence of 30 min pre-treatment with T487 or NB-74330 at the concentrations indicated. Cell lysates were resolved by SDSPAGE,
transferred to nitrocellulose membranes, and immunoblotted with a phospho-specific Erk or Akt antibody with affinity for the active Ser473-
phosphorylated form of Akt and proteins were visualized with enhanced chemiluminescence. The blots were stripped and reprobed with
anti-Erk-1 antibody to verify equal loading and efficiency of protein transfer (lower panel). The data are derived from a single experiment repre-
sentative of at least three others using cells from different donors.
510 2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515
A. Korniejewska et al.
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
9/13
highest affinity for the CXCR3-B isoform,33,40 although
the more robust responses detected in CXCR3-A-express-
ing cells might be explained by high surface expression of
CXCR3-A. Elevations in intracellular free calcium were
not observed in cells transfected with an empty vector
(Fig. 9b), indicating that responses were specific for the
receptor transfected.
Despite the relatively low surface expression of CXCR3-
B and CXCR3-alt isoforms in transfected HEK293 cells,
we investigated the effect of CXCL11 and CXCL4 on
detected surface receptor expression (Fig. 9c). We found
that CXCL11 induced down-regulation of the CXCR3-Breceptor to about 60% of basal expression, comparable
with the down-regulation of CXCR3-A. In contrast, upon
stimulation with CXCL11, surface expression of CXCR3-
alt increased by around 25%, and a further 75% increase
was observed after extending the incubation time to
120 min (data not shown). Treatment of the cells with
CXCL4 led to a modest decrease (around 25%) of
CXCR3-B surface expression but no effect on CXCR3-A
was detected. Similarly, the (low basal) level of CXCR3-
alt surface expression remained unchanged.
Discussion
In this study we have demonstrated the expression of
CXCR3 as well as of two of its known variants, CXCR3-B
and CXCR3-alt, in ex vivo activated human peripheral
blood-derived T lymphocytes. The established CXCR3
agonists CXCL9, CXCL10, CXCL11 all elicited elevation
of intracellular calcium and stimulate pertussis toxin-sen-
sitive phosphorylation of p44/p42 ERK and PI3K/Akt in
these cells. Similar responses of comparable magnitude
were also observed following treatment with CXCL4,
which has previously been reported as an agonist forCXCR3-B.33 Remarkably, while CXCL9, CXCL10 and
CXCL11 all stimulate the loss of surface expression of
CXCR3 and elicited directional migration responses of T
lymphocytes, no such responses were observed following
CXCL4 stimulation of these cells. In addition, CXCL4-
stimulated phosphorylation of Akt and p44/42 ERK was
resistant to two non-competitive CXCR3 antagonists at
concentrations that inhibited the phosphorylation of this
signalling molecule in response to the three established
CXCR3 agonists.
(a)
(b)
CXCL10
CXCL10 CXCL9 CXCL4 CXCL12
24004400
2400
2000
1600
1200
800
400
0
1200
1000
800
600
Norma
lise
d
immunoreac
tiv
ity
400
200
0
T487
NB-1
74330
T487
NB-1
74330
T487
NB-1
74330
T487
NB-1
74330
Con
tro
l
Control
Contro
l
T487
NB-174
330 T487
NB-174
330 T487
NB-174
330 T487
NB-174
330
CXCL9 CXCL4 CXCL12
pAkt
p-p44/42
pAkt
p-p44/42
Erk1
Figure 8. CXCR3 antagonists inhibit CXCR3-mediated phosphorylation of p44/p42 extracellular signal-regulated kinase (ERK) and protein kinase
B (PKB)/Akt in human T cells. Aliquots of activated T cells (1 106 cells/500 ll) were left untreated or stimulated at 37 with 1 nm CXCL11 or
CXCL12 for 2 min in the absence or presence of 30 min pre-treatment with T487 or NB-74330 at 1 lm and 100 nm, respectively. Cell lysates
were resolved by SDSPAGE, transferred to nitrocellulose membranes, and immunoblotted with a phospho-specific Erk or Akt antibody with
affinity for the active Ser473-phosphorylated form of Akt and proteins were visualized with enhanced chemiluminescence (a). The blots were
stripped and reprobed with anti-Erk-1 antibody to verify equal loading and efficiency of protein transfer (lower panel). Phosphorylation of Akt
and p44/p42 ERK was quantified by densitometry and corrected for total Erk 1 expression on stripped blots (b). The data are derived from a sin-
gle experiment representative of at least three others using cells from different donors.
2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515 511
CXCR3 variants in human T lymphocytes
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
10/13
All of the CXCR3 agonists elicited transient p44/42
ERK and Akt phosphorylation responses, which is consis-
tent with receptor desensitization and internalization.However, CXCL11 induced the most robust biochemical
and functional responses consistent with previous obser-
vations.42 In addition to binding CXCR3, CXCL11 (unlike
CXCL9 and CXCL10) is also reported to bind CXCR7. It
seems unlikely that the more robust responses to CXCL11
are the result of additional signalling via CXCR7 because
previous studies indicate that CXCL11 is unable to induce
calcium signalling, or p44/42 or Akt phosphorylation,
through CXCR7.45 It is interesting to note however that
while chemotaxis and calcium responses to all three
established CXCR3 agonists were dependent on the C ter-
minus and the DRY sequence, distinct domains are
required for internalization.7 Hence, CXCL11 predomi-nantly induces internalization via a C-terminal indepen-
dent pathway whereas CXCL9- and CXCL10-stimulated
internalization occurs via a C-terminus-dependent path-
way.7
The existence of binding sites or receptors for CXCL4
on T lymphocytes has previously been suggested because
this ligand can suppress T-cell function by decreasing pro-
liferation and IL-2 mRNA expression, as well as inhibiting
the release of IL-2 and IFN-c.46 In addition, CXCL4
induces proliferation of regulatory T cells (CD4+ CD25+)
(a)
(b)
(c)
CXCR3-ACXCR3-BCXCR3-altMock
CXCR3-ACXCR3-BCXCR3-altMock
CXCR3-A
CXCR3-B
CXCR3-alt
CXCR
3-A
CXCR
3-B
CXCR
3-alt
Mock
12 000
15 000
9000
6000
Meanfluorescence
3000
6 CXCL11
CXCL11 CXCL4125
100
75
50
25
0
100
75
50
25
00 1 5 30
Time (min)
0 1 5 30
Time (min)
CXCL4
5
4
3
2
1Foldincreaseabovebaseline
CXCR3surface
expression(%)
CXCR3surface
expression(%)
0
6
5
4
3
2
1Foldincreaseabovebaseline
00 10 20 30 40 50 60
Time (seconds)
70 80 901001100 10 20 30 40 50 60
Time (seconds)
70 80 90100110
0
Figure 9. CXCR3-A and CXCR3-B but not CXCR3-alt transfectants are responsive to CXCL4. (a) HEK293 cells were transfected with plasmids
encoding CXCR3-A, CXCR3-B and CXCR3-alt. Surface expression of each variant of CXCR3 is expressed as mean fluorescence intensity, mea-
sured by flow cytometry after staining with phycoerythrin-conjugated anti-CXCR3 antibody. Staining with an appropriate isotype control was
subtracted. (b) HEK293 cells expressing CXCR3-A, CXCR3-B or CXCR-alt were loaded with Fluo-4 at 37 for 30 min. Cells were then washed
twice in assay buffer and aliquoted at 1 105 cells/well as described in the Materials and methods and treated with indicated concentrations of
each agonist. Changes in fluorescence were measured using a multimode plate reader (Fluostar Optima). Data shown are the mean of two sepa-
rate experiments performed in duplicate. (c) HEK293 cells expressing CXCR3 variants were stimulated with 100 n m CXCL4 or CXCL11 over
30 min. Agonists were then washed off and cells were incubated with anti-CXCR3 antibody or isotype control at 4 followed by analysis on a
FACSCanto flow cytometer as described in the Materials and methods. Decrease in CXCR3 surface expression is expressed as a percentage of
CXCR3 levels detected on unstimulated cells. Presented data represent mean SEM of three independent experiments.
512 2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515
A. Korniejewska et al.
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
11/13
and regulates Th1/Th2 polarization via differential regula-
tion of transcription factors T-bet and GATA-3.47,48 The
significance of T-cell regulation by CXCL4 is unclear
though it has been postulated that the deposition of
micromolar concentrations of CXCL4 by activated plate-
lets onto the endothelium may result in the recruitment
of activated T lymphocytes, leading to their infiltration
into the tissues and the amplification of inflamma-
tion.49,50 Consistent with our data, CXCL4 has previously
been demonstrated to stimulate elevation of intracellular
calcium in activated T lymphocytes.40 Mueller et al. have
reported that CXCL4 induces migration of activated T
lymphocytes in a pertussis toxin-sensitive manner,40
although we were unable to detect this response. One rea-
son for the discrepancy between our data and those of
Mueller et al. may be that the previous study used T cells
that had been activated with concanavalin A, whereas we
used SEB as our initial activating stimulus. This may lead
to many discrepancies between the two model systems
including differences in the overall CD4+/CD8+ ratio inthe two studies. Interestingly, T cells activated with alter-
native stimuli such as anti-CD3/CD28 antibody-coated
beads, also did not migrate to CXCL4 (data not shown),
suggesting that our observations are not restricted to cells
that have been activated with SEB.
It has previously been reported that in addition to
binding the established CXCR3 agonists, CXCR3-B also
binds CXCL4 with high affinity.33 Therefore, one inter-
pretation of our observations relating to the biochemical
responses initiated by CXCL4 is that these reflect expres-
sion and activation of CXCR3-B. Indeed, we can detect
CXCR3-B in activated T cells at the mRNA level. How-ever, several lines of evidence are inconsistent with the
CXCL4 responses being mediated via CXCR3-B. First,
CXCL4-stimulated Akt phosphorylation and p44/p42 ERK
is pertussis toxin sensitive, yet CXCL4-mediated calcium
fluxes and inhibitory effects on proliferation in CXCR3-
B-transfected endothelial cell models are pertussis toxin-
resistant.33 This may simply reflect differential coupling
of CXCR3-B to the pertussis toxin-sensitive Gai/Go
subunits and the pertussis toxin-insensitive Gaq subunits
in different cell types. Second, the biochemical responses
to CXCL4 were resistant to the CXCR3 inhibitor T487
and its analogue NBI-74330. The selectivity of these com-
pounds for CXCR3-A versus CXCR3-B is not known.CXCR3-B differs only in the N-terminus region and given
the non-competitive nature of these compounds, one
might predict that they will inhibit both variants with
similar potencies. A related CXCR3 antagonist is reported
to inhibit CXCL4-induced T-cell migration responses,40
but is unable to displace radiolabelled CXCL4 binding to
CXCR3-B-expressing Chinese hamster ovary (CHO) cells.
The relevance of findings made in CXCR3-B-transfected
CHO cells to observations made using T cells, is ques-
tionable. It is clear though that the interactions of CXCR3
with CXCL4 in T cells seem quite distinct from its inter-
actions with other ligands as CXCL4 is unable to displace
CXCL10 from activated T lymphocytes.40 The lack of a
conventional concentrationresponse relationship with
regard to CXCL4 effects on Akt and p44/42 ERK phos-
phorylation in our studies, underlines this conclusion.
The failure of CXCL4 to elicit loss of CXCR3 surface
expression, may account for the lack of migratory
responses because receptor internalization has been
reported to be necessary for chemotactic responses fol-
lowing activation of CXCR2 in some cell models.5155 In
this regard, b-arrestins are known to play a key role in
the internalization of ligand-activated chemokine recep-
tors.56 The internalized GPCRb-arrestin complex can
form a signalosome that activates signalling proteins such
as ERK1/2, p38 and Jun N-terminal kinase and act as a
scaffold that connects the GPCR to tyrosine kinases,
c-Src, PI3K/Akt and nuclear factor-jB pathways.56 CXCL4
does not cause internalization (as assessed by surface
expression) and is therefore unlikely to lead to the forma-tion/activation of GPCRb-arrestin-dependent signalo-
somes, this may explain the lack of migratory responses.
Although we observed little difference in either kinetics or
magnitude of Akt and p44/p42 ERK phosphorylation, the
CXCL4-stimulated calcium responses were markedly
weaker compared with the other CXCR3 agonists. It is
also important to stress that our assays measure total
cellular biochemical responses and the lack of internaliza-
tion/GPCRb-arrestin-dependent signalosome formation
may impair the correct compartmentalization and locali-
zation of biochemical events that are necessary to provide
the stimulus for migration. However, the requirement forreceptor internalization in migratory responses to chemo-
kines varies according to cell and receptor type and there
are several examples of migration occurring in the
absence of receptor internalization.55,57,58 Indeed, muta-
tion of the DRY sequence can ablate CXCL11-induced
calcium mobilization, p44/42 phosphorylation and
chemotaxis with no effect on CXCR3 internalization.7
It is now apparent that GPCRs can possess multiple
binding sites and are able to modulate multiple signalling
pathways. The concept that different ligands selectively
stabilize different active conformations of GPCRs and, as
such, might be able to selectively regulate different path-
ways is well established.59,60 There is considerable interestin assessing whether such ligands may offer therapeutic
advantage if they regulate a signal associated with a bene-
ficial outcome without activating a second pathway that
may be contraindicated. Our results show that although
CXCL4 does not share functional properties with CXCR3
agonists, it is still able to induce intracellular signalling
that is likely to be independent of the classical CXCR3.
This suggests a distinct role in T-cell biology and regulation
of human immune response that merits further investiga-
tion with the possibility of revealing a new target for
2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515 513
CXCR3 variants in human T lymphocytes
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
12/13
manipulation of T-cell activity during inflammatory or
autoimmune diseases. This is underlined by reports that
it exerts opposite effects on production of Th1 and Th2
cytokines to those observed with CXCL10.47 Importantly,
the design of CXCR3 antagonists with a view to combat
Th1-associated diseases would seem unlikely to have
effects on the Th2-associated effects of CXCL4.
Disclosures
The authors have no financial conflicts of interest related
to this study.
References
1 Luster AD. Chemokines chemotactic cytokines that mediate inflammation. N Engl J
Med 1998; 338:43645.
2 Moser B, Loetscher P. Lymphocyte traffic control by chemokines. Nat Immunol 2001;
2:1238.
3 Sallusto F, Mackay CR, Lanzavecchia A. The role of chemokine receptors in primary,
effector, and memory immune responses. Annu Rev Immunol 2000;18
:593620.4 von Andrian UH, Mackay CR. Advances in immunology: T-cell function and migration
two sides of the same coin. N Engl J Med2000; 343:102033.
5 Zlotnik A, Yoshie O. Chemokines: a new classification system and their role in immu-
nity. Immunity2000; 12:1217.
6 Cole KE, Strick CA, Paradis TJ et al. Interferon-inducible T cell a chemoattrac-
tant (I-TAC): a novel non-ELR CXC chemokine with potent activity on activated
T cells through selective high affinity binding to CXCR3. J Exp Med 1998;
187:200921.
7 Colvin RA, Campanella GSV, Sun JT, Luster AD. Intracellular domains of CXCR3 that
mediate CXCL9, CXCL10, and CXCL11 function. J Biol Chem 2004; 279:3021927.
8 Cox MA, Jenh CH, Gonsiorek W et al. Human interferon-inducible 10-kDa protein
and human interferon-inducible T cell a chemoattractant are allotopic ligands for
human CXCR3: differential binding to receptor states. Mol Pharmacol 2001; 59:707
15.
9 Amichay D, Gazzinelli RT, Karupiah G, Moench TR, Sher A, Farber JM. Genes for
chemokines MuMig and Crg-2 induced in protozoan and viral infections in response to
IFN-c with patterns of tissue expression that suggest nonredundant roles in vivo.
J Immunol1996; 157:451120.
10 Dufour JH, Dziejman M, Liu MT, Leung JH, Lane TE, Luster AD. IFN-c-inducible
protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell gen-
eration and trafficking. J Immunol 2002; 168:3195204.
11 Khan IA, MacLean JA, Lee FS et al. IP-10 is critical for effector T cell trafficking and
host survival in Toxoplasma gondii infection. Immunity2000; 12:48394.
12 Widney DP, Xia YR, Lusis AJ, Smith JB. The murine chemokine CXCL11 (IFN-induc-
ible T cell a chemoattractant) is an IFN-c- and lipopolysaccharide-inducible glucocorti-
coid-attenuated response gene expressed in lung and other tissues during endotoxemia.
J Immunol2000; 164:632231.
13 Loetscher M, Gerber B, Loetscher P et al. Chemokine receptor specific for IP10 and
Mig: structure, function, and expression in activated T-lymphocytes. J Exp Med 1996;
184:9639.
14 Loetscher M, Loetscher P, Brass N, Meese E, Moser B. Lymphocyte-specific chemokine
receptor CXCR3: regulation, chemokine binding and gene localization. Eur J Immunol
1998; 28:3696705.
15 Qin SX, Rottman JB, Myers P et al. The chemokine receptors CXCR3 and CCR5 mark
subsets of T cells associated with certain inflammatory reactions. J Clin Invest 1998;
101:74654.
16 Jones D, Benjamin RJ, Shahsafaei A, Dorfman DM. The chemokine receptor CXCR3 is
expressed in a subset of B-cell lymphomas and is a marker of B-cell chronic lympho-
cytic leukemia. Blood 2000; 95:62732.
17 Muehlinghaus G, Cigliano L, Huehn S et al. Regulation of CXCR3 and CXCR4 expres-
sion during terminal differentiation of memory B cells into plasma cells. Blood 2005;
105:396571.
18 Trentin L, Agostini C, Facco M et al. The chemokine receptor CXCR3 is expressed on
malignant B cells and mediates chemotaxis. J Clin Invest 1999; 104:11521.
19 Brightling CE, Ammit AJ, Kaur D et al. The CXCL10/CXCR3 axis mediates human
lung mast cell migration to asthmatic airway smooth muscle. Am J Respir Crit Care
Med 2005; 171:11038.
20 Brightling CE, Kaur D, Berger P, Morgan AJ, Wardlaw AJ, Bradding P. Differential
expression of CCR3 and CXCR3 by human lung and bone marrow-derived mast cells:
implications for tissue mast cell migration. J Leukoc Biol 2005; 77:75966.
21 Jinquan T, Anting L, Jacobi HH et al. CXCR3 expression on CD34+ hemopoietic pro-
genitors induced by granulocyte-macrophage colony-stimulating factor: II. Signaling
pathways involved. J Immunol 2001; 167:440513.
22 Bonacchi A, Romagnani P, Romanelli RG et al. Signal transduction by the chemokine
receptor CXCR3 activation of Ras/ERK, Src, and phosphatidylinositol 3-kinase/Akt
controls cell migration and proliferation in human vascular pericytes. J Biol Chem 2001;
276:994554.
23 Palmqvist C, Wardlaw AJ, Bradding P. Chemokines and their receptors as potential tar-
gets for the treatment of asthma. Br J Pharmacol 2007; 151:72536.
24 Wang XK, Yue TL, Ohlstein EH, Sung CP, Feuerstein GZ. Interferon-inducible protein-
10 involves vascular smooth muscle cell migration, proliferation, and inflammatory
response. J Biol Chem 1996; 271:2428693.
25 Rabin RL, Park MK, Liao F, Swofford R, Stephany D, Farber JM. Chemokine receptor
responses on T cells are achieved through regulation of both receptor expression and
signaling. J Immunol 1999; 162:384050.
26 Smit MJ, Verdijk P, van der Raaij-Helmer E et al. CXCR3-mediated chemotaxis of
human T cells is regulated by a G(i)- and phospholipase C-dependent pathway and not
via activation of MEK/p44/p42 MAPK nor Akt/PI-3 kinase. Blood 2003; 102:195965.
27 Dar WA, Knechtle SJ. CXCR3-mediated T-cell chemotaxis involves ZAP-70 and is reg-
ulated by signalling through the T-cell receptor. Immunology 2007; 120:46785.
28 Mach F, Sauty A, Iarossi AS et al. Differential expression of three T lymphocyte-activating
CXC chemokines by human atheroma-associated cells. J Clin Invest1999; 104:104150.
29 Sorensen TL, Tani M, Jensen J et al. Expression of specific chemokines and chemokinereceptors in the central nervous system of multiple sclerosis patients. J Clin Invest 1999;
103:80715.
30 Hancock WW, Lu B, Gao W et al. Requirement of the chemokine receptor CXCR3 for
acute allograft rejection. J Exp Med 2000; 192:15159.
31 Hancock WW, Gao W, Csizmadia V, Faia KL, Shemmeri N, Luster AD. Donor-derived
IP-10 initiates development of acute allograft rejection. J Exp Med2001; 193:97580.
32 Liu MT, Chen BP, Oertel P et al. Cutting edge: the T cell chemoattractant IFN-induc-
ible protein 10 is essential in host defense against viral-induced neurologic disease.
J Immunol2000; 165:232730.
33 Lasagni L, Francalanci M, Annunziato F et al. An alternatively spliced variant of CXCR3
mediates the inhibition of endothelial cell growth induced by IP-10, Mig, and I-TAC, and
acts as functional receptor for platelet factor 4. J Exp Med2003; 197:153749.
34 Ehlert JE, Addison CA, Burdick MD, Kunkel SL, Strieter RM. Identification and partial
characterization of a variant of human CXCR3 generated by posttranscriptional exon
skipping. J Immunol 2004; 173:623440.
35 Burns JM, Summers BC, Wang Y et al. A novel chemokine receptor for SDF-1 and
I-TAC involved in cell survival, cell adhesion, and tumor development. J Exp Med
2006; 203:220113.
36 Balabanian K, Lagane B, Infantino S et al. The chemokine SDF-1/CXCL12 binds to and
signals through the orphan receptor RDC1 in T lymphocytes. J Biol Chem 2005;
280:357606.
37 Coopman K, Smith L, Wright KL, Ward SG. Temporal variation in CB2R levels follow-
ing T lymphocyte activation: evidence that cannabinoids modulate CXCL12-induced
chemotaxis. Int Immunopharmacol2007; 7:36071.
38 Smith LD, Hickman ES, Parry RV, Westwick J, Ward SG. PI3K c is the dominant iso-
form involved in migratory responses of human T lymphocytes: effects of ex vivo main-
tenance and limitations of non-viral delivery of siRNA. Cell Signal 2007; 19:252839.
39 Webb A, Johnson A, Fortunato M et al. Evidence for PI-3K-dependent migration of
Th17-polarized cells in response to CCR2 and CCR6 agonists. J Leukoc Biol 2008;
84:120212.
40 Mueller A, Meiser A, McDonagh EM et al. CXCL4-induced migration of activated T
lymphocytes is mediated by the chemokine receptor CXCR3. J Leukoc Biol 2008;
83:87582.
41 Aragay AM, Ruiz-Gomez A, Penela P et al. G protein-coupled receptor kinase 2
(GRK2): mechanisms of regulation and physiological functions. FEBS Lett 1998;
430:3740.
42 Sauty A, Colvin RA, Wagner L, Rochat S, Spertini F, Luster AD. CXCR3 internalization
following T cell-endothelial cell contact: preferential role of IFN-Inducible T cell a
chemoattractant (CXCL11). J Immunol 2001; 167:708493.
43 Heise CE, Pahuja A, Hudson SC et al. Pharmacological characterization of CXC
chemokine receptor 3 (CXCR3) ligands and a small-molecule antagonist. FASEB J 2005;
19:A1415.
44 Johnson M, Li AR, Liu JW et al. Discovery and optimization of a series of quinazoli-
none-derived antagonists of CXCR3. Bioorg Med Chem Lett 2007; 17:333943.
45 Proost P, Mortier A, Loos T et al. Proteolytic processing of CXCL11 by CD13/amino-
peptidase N impairs CXCR3 and CXCR7 binding and signaling and reduces lympho-
cyte and endothelial cell migration. Blood 2007; 110:3744.
514 2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515
A. Korniejewska et al.
7/30/2019 Expression and Agonist Responsiveness of CXCR3variants in Human T Lymphocytes
13/13
46 Fleischer J, Grage-Griebenow E, Kasper B et al. Platelet factor 4 inhibits proliferation
and cytokine release of activated human T cells. J Immunol 2002; 169:7707.
47 Romagnani P, Maggi L, Mazzinghi B et al. CXCR3-mediated opposite effects of
CXCL10 and CXCL4 on Th1 or Th2 cytokine production. J Allergy Clin Immunol 2005;
116:13729.
48 Liu CY, Battaglia M, Lee SH, Sun QH, Aster RH, Visentin GP. Platelet factor 4 differ-
entially modulates CD4+ CD25+ (regulatory) versus CD4+ CD25 (nonregulatory) T
cells. J Immunol 2005; 174:26806.
49 Sachais BS, Turrentine T, Mckenna JMD, Rux AH, Rader D, Kowalska MA. Elimina-
tion of platelet factor 4 (PF4) from platelets reduces atherosclerosis in C57BI/6 and
apoE/ mice. Thromb Haemost 2007; 98:110813.
50 Pitsilos S, Hunt J, Mohler ER et al. Platelet factor 4 localization in carotid athero-
sclerotic plaques: correlation with clinical parameters. Thromb Haemost 2003;
90:111220.
51 Richardson RM, Pridgen BC, Haribabu B, Ali H, Snyderman R. Differential cross-regu-
lation of the human chemokine receptors CXCR1 and CXCR2 evidence for time-
dependent signal generation. J Biol Chem 1998; 273:238306.
52 Fan GH, Yang W, Wang XJ, Qian QH, Richmond A. Identification of a motif in the
carboxyl terminus of CXCR2 that is involved in adaptin 2 binding and receptor inter-
nalization. Biochemistry2001; 40:791800.
53 Benbaruch A, Bengali KM, Biragyn A et al. Interleukin-8 receptor-b the role of the
carboxyl-terminus in signal-transduction. J Biol Chem 1995; 270:91218.
54 Yang W, Wang DZ, Richmond A. Role of clathrin-mediated endocytosis in CXCR2
sequestration, resensitization, and signal transduction. J Biol Chem 1999; 274:1132833.
55 Richardson RM, Marjoram RJ, Barak LS, Snyderman R. Role of the cytoplasmic tails of
CXCR1 and CXCR2 in mediating leukocyte migration, activation, and regulation.
J Immunol2003; 170:290411.
56 Vroon A, Heijnen CJ, Kavelaars A. GRKs and arrestins: regulators of migration and
inflammation. J Leukoc Biol 2006; 80:121421.
57 Cole SW, Jamieson BD, Zack JA. cAMP up-regulates cell surface expression of lympho-
cyte CXCR4: implications for chemotaxis and HIV-1 infection. J Immunol 1999;
162:1392400.
58 Arai H, Monteclaro FS, Tsou CL, Franci C, Charo IF. Dissociation of chemotaxis from
agonist-induced receptor internalization in a lymphocyte cell line transfected with
CCR2B evidence that directed migration does not require rapid modulation of signal-
ing at the receptor level. J Biol Chem 1997; 272:2503742.
59 Kenakin T. Collateral efficacy in drug discovery: taking advantage of the good (alloste-
ric) nature of 7TM receptors. Trends Pharmacol Sci 2007; 28:40715.
60 Baker JG, Hill SJ. Multiple GPCR conformations and signalling pathways: implications
for antagonist affinity estimates. Trends Pharmacol Sci 2007; 28:37481.
2011 The Authors. Immunology 2011 Blackwell Publishing Ltd, Immunology, 132, 503515 515
CXCR3 variants in human T lymphocytes
Top Related