Evaluation of Phenotypic Changes of Acyl-CoA Binding Protein / Diazepam
Binding Inhibitor Overexpression inTransgenic Mice and Rats
Doctoral dissertation
To be presented by permission of the Faculty of Natural and Environmental Sciences
of the University of Kuopio for public examination in Auditorium L1,
Canthia building, University of Kuopio,
on Friday 3rd October 2008, at 1 p.m.
Department of Biolotechnology and Molecular MedicineA.I. Virtanen Institute for Molecular Sciences
University of Kuopio
SANNA OIKARI
JOKAKUOPIO 2008
KUOPION YLIOPISTON JULKAISUJA G. - A.I. VIRTANEN -INSTITUUTTI 65KUOPIO UNIVERSITY PUBLICATIONS G.
A.I. VIRTANEN INSTITUTE FOR MOLECULAR SCIENCES 65
Distributor : Kuopio University Library P.O. Box 1627 FI-70211 KUOPIO FINLAND Tel. +358 40 355 3430 Fax +358 17 163 410 http://www.uku.fi/kirjasto/julkaisutoiminta/julkmyyn.html
Series Editors: Research Director Olli Gröhn, Ph.D. Department of Neurobiology A.I . Virtanen Institute for Molecular Sciences
Professor Michael Courtney, Ph.D. Department of Neurobiology A.I . Virtanen Institute for Molecular Sciences
Author’s address: Department of Biotechnology and Molecular Medicine A.I . Virtanen Institute for Molecular Sciences University of Kuopio P.O. Box 1627 FI-70211 KUOPIO FINLAND Tel. +358 40 355 3690 E-mail : [email protected]
Supervisor : Professor Karl-Heinz Herzig, M.D., Ph.D. Department of Biotechnology and Molecular Medicine A.I . Virtanen Institute for Molecular Sciences University of Kuopio
Department of Physiology Institute of Biomedicine University of Oulu
Reviewers: Professor Paul Trayhurn, Ph.D., FRSE Obesity Biology Unit University of Liverpool, UK
Professor Kalervo Hiltunen, M.D., Ph.D. Department of Biochemistry University of Oulu
Opponent: Professor Wolfgang Langhans, D.V.M., Ph.D. Institute of Animal Sciences ETH Zurich, Switherland
ISBN 978-951-27-1124-6ISBN 978-951-27-1106-2 (PDF)ISSN 1458-7335
KopijyväKuopio 2008Finland
Oikari, Sanna. Evaluation of Phenotypic Changes of Acyl-CoA Binding protein / Diazepam Binding
Inhibitor Overexpression in Transgenic Mice and Rats. Kuopio University Publications G. -A.I.Virtanen
Institute for Molecular Sciences 65. 2008. 79 p.
ISBN 978-951-27-1124-6
ISBN 978-951-27-1106-2 (PDF)
ISSN 1458-7335
ABSTRACT Obesity and metabolic syndrome are growing health problems worldwide and they are closely linked to
fatty acid metabolism. Elevated free fatty acid levels are observed in both disorders. Recent studies have
shown that fatty acids or their metabolites are linked to the pathophysiology of various diseases associated
with obesity and metabolic syndrome. In the cytosol, fatty acids are converted to acyl-CoAs. Acyl-CoAs
are important intermediates of lipid and glucose metabolism and they have been shown to function as
regulators of many metabolic processes, therefore their intracellular availability is tightly controlled. This
is achieved by the presence of binding proteins e.g. fatty acid binding proteins (FABPs), acyl-CoA binding
protein (ACBP) and sterol carrier protein-2. Of these proteins, ACBP has the highest affinity and
specificity towards medium and long chain acyl-CoAs. ACBP is a 10 kDa protein that is ubiquitously
expressed throughout the body and it has been shown to be able to function as an intracellular pool former
and transporter of acyl-CoAs. In addition, various other cellular functions have been proposed for ACBP,
including inhibition of diazepam binding to benzodiazepine receptors. Therefore, ACBP has also been
named as diazepam binding inhibitor (DBI). Although, ACBP has been associated with several
biochemical processes at the cellular level, its physiological significance in mammalians is less clear. In
order to reveal the physiological effects of this interesting protein we have created a mouse and rat lines
overexpressing the endogenous mouse ACBP gene under the gene’s own promoter region.
Our results show that ACBP overexpressing mice display an enlargement of the lateral ventricles,
decreased plasticity of excitatory synapses and impairment of hippocampus-dependent form of learning
and memory. In contrast to previous results, our animals did not show any signs of anxiety or pro-conflict
behaviour nor did the ACBP overexpression influence the kainate or pentylenetetrazole induced seizure
activity of transgenic mice. Furthermore, it was shown that in rats ACBP increased the liver and adipose
tissue acyl-CoA pool size. The ACBP induced elevation was dependent on the acyl-CoA form and on the
fed-fasted state of the animals. On the contrary, high levels of ACBP did not influence serum or plasma
levels of other lipid forms. In addition, constant overexpression affected the glucose tolerance of
transgenic animals only if these animals were challenged with a high fat diet enriched with medium chain
fatty acids for four weeks. To further investigate the possible mechanisms behind these physiological
changes we studied ACBPs influence on the mRNA levels of transcription factors involved in the
regulation of lipid metabolism and on the protein levels of AMP-activated protein kinase (AMPK). Our
results demonstrated that ACBP influences PPAR , PPAR and SREBP-1 expression of the transgenic
animals in a nutrition state dependent manner and that the regulation of SREBP-1 is mediated through
increased AMPK protein levels. Furthermore, our results indicated that the constantly elevated levels of
ACBP does not influence food intake or the body weight of the transgenic animals. ACBP regulates the
hypothalamic mRNA levels of two key enzymes of fatty acid metabolism: fatty acid synthase is down-
regulated and carnitine palmitoyltransferase 1 up-regulated. In the hypothalamus, inhibition of these
enzymes is associated with reduced food intake. In addition, ACBP down-regulates the hypothalamic
expression levels of PPAR and SIRT-1, transcription factors regulating lipid and glucose metabolism.
These results demonstrate that long-term overexpression ACBP has a limited effect on the phenotype of
transgenic mice and rats, since it does change the expression pattern of particular genes involved in
regulation of glucose and lipid metabolism. Our findings provide new information on the physiological
role of ACBP, especially in the regulation of transcriptions factors.
National Library of Medicine classification: QU 75, QU 85, QU 90, QU 135, QU 450, QU 475
Medical Subject Headings: Diazepam Binding Inhibitor; Acyl Coenzyme A; Peroxisome Proliferator-Activated
Receptors; PPAR gamma; PPAR delta; Sterol Regulatory Element Binding Protein 1; AMP-activated protein kinase;
Gene Expression Regulation; Appetite Regulation; Animals, Genetically Modified; Mice, Transgenic; Rats;
Phenotype; Lateral Ventricles; Neuronal Plasticity; Synapses; Learning; Memory; Hippocampus; Transcription
Factors; Lipid Metabolism; Blood Glucose; Nutritional Status; Fatty Acids
ACKNOWLEDGEMENTS
This thesis work was carried out at the A.I. Virtanen Institute for Molecular Sciences during the years
2002-2008. I wish to express my profound gratitude to Professor Karl-Heinz Herzig, M.D., Ph.D. for
introducing me to this fascinating research subject and for all the support and guidance during these years.
You have though me a valuable way to look at science in wider perspective.
I wish to thank also Prof. Paul Trayhurn, D.Sc., FRSE and Prof. Kalervo Hiltunen, M.D., Ph.D. for the
review of this thesis, your expert comments and suggestions were of great help. Ewen Macdonald, Ph.D. is
gratefully acknowledged for the language revision.
My sincere thanks belong to all co-authors of the publications. Prof. Leena Alhonen, Ph.D. and now
deceased Prof. Juhani Jänne, M.D., Ph.D. are acknowledged for creation of the animal lines and Veli-
Pekka Korhonen, Ph.D. and Tiina Wahlfors, Ph.D. for the isolation of ACBP gene. My sincere thanks
belong for Hanna Siiskonen, M.Sc., B.Med. for her great contribution for the mouse paper. I’m deeply
grateful also for Tiia Ahtialansaari, M.Sc., B.Med. for all your help and stimulating conversations during
the rat studies. I wish to thank Miika Heinonen, M.Sc., B.Med. and Anne Huotari, M.Sc. for your valuable
help, especially in animal handling and for the moments shared during these years. Prof. Seppo Auriola,
Ph.D., Prof. Asla Pitkänen, M.D., Ph.D., Prof. Siegfried Wolffram, D.V.M., Ulrich Fölsch, M.D., Juhana
Hakumäki, M.D., Selma Kaasinen, Ph.D., Mikko Kettunen, Ph.D., Karlheinz Kiehne, M.D., Timo
Mauriala, Ph.D., Markku Penttonen, Ph.D., Raimo Pussinen, Ph.D., Vootele Voikar, M.D., are
acknowledged for their contribution to the publications.
My sincere thanks are owned to all the members of Molecular Physiology Research Group. I’m deeply
grateful to Riitta Kauppinen, Medical Laboratory Technologist for all the help in lab issues and arranging
things. My sincere thanks to Anna-Kaisa Purhonen, Ph.D., B.Med. for all the help and refreshing
conversations on science and life in general. Thanks also to Miia Kilpeläinen, M.Sc. (Pharm), Katja
Klausz, M.Sc. Kari Mäkelä, M.Sc., Maria Vlasova, Ph.D., for help and moments shared during these
years.
Many thanks also to Mrs Kaija Pekkarinen, Mrs. Riitta Laitinen and Mrs. Helena Pernu for secretarial
help, you were always willing to assist in arranging things. Pekka Alakuijala, Phil. Lic. and Jari Nissinen,
Ph.D. are acknowledged for all the help in solving practical things.
From the world outside science, I would like to thank all my relatives and friends. I’m deeply grateful for
my parents Raili Pääkkönen and Reino Uotila for all your love, encouragement and support. Many thanks
also to Karin and Seppo Oikari for your help and to Virpi, Mika, Anne, Teemu, Sirpa and Petri for your
friendship and great times during the years.
Finally, my warmest thanks go to my loving husband Sami and to our children Laura and Arttu. Thank
you for being there for me whatever comes and for all the support and patience during these years.
Hopefully the years to come are as good as they have been.
This study was supported in part by the Finnish Cultural Foundation of Northern Savo.
In Kuopio, August 2008
ABBREVIATIONS
ACBP acyl-CoA binding protein
ACC acyl-CoA carboxylase
ACS acyl-CoA synthetase
AMPK AMP-activated protein kinase
ANOVA analysis of variance
ANT adenine nucleotide translocase
BMI body mass index
CCK cholecystokinin
cDNA complementary DNA
CNS central nervous system
CPT-1 carnitine palmitoyltransferase 1
CSF cerebrospinal fluid
DBI diazepam binding inhibitor
ER endoplasmic reticulum
FABP fatty acid binding protein
FAS fatty acid synthase
FFA free fatty acid
GABA γ-aminobutyric acid
GABAA type A γ-aminobutyrate receptor
GTT glucose tolerance test
HNF-4α hepatocyte nuclear factor-4α
i.c.v intracerebroventicularly
i.p. intraperitoneally
KA kainate
LC long chain fatty acids
LTP long-term potentiation
MC medium chain fatty acids
MRI magnetic resonance imaging
mRNA messenger ribonucleic acid
ODN octadecaneuropeptide
PCR polymerase chain reaction
PPAR peroxisome proliferator-activated receptor
PBR peripheral benzodiazepine receptor
PTZ pentylenetetrazole
RNA ribonucleic acid
sg syngenic
SIRT sirtuin
SNP single nucleotide polymorphism
SREBP sterol regulatory element-binding protein
tg transgenic
Thr threonine
TTN triakontatetraneuropeptide
LIST OF PUBLICATIONS
This thesis is based on the following publications, which are referred to by their corresponding Roman
numerals:
I Siiskonen H*, Oikari S*, Korhonen VP, Pitkanen A, Voikar V, Kettunen M, Hakumaki J,
Wahlfors T, Pussinen R, Penttonen M, Kiehne K, Kaasinen SK, Alhonen L, Janne J, Herzig
KH. (2007) Diazepam binding inhibitor overexpression in mice causes hydrocephalus,
decreases plasticity in excitatory synapses and impairs hippocampus-dependent learning. Mol
Cell Neurosci. 34 (2): 199-208.
II Oikari S, Ahtialansaari T, Heinonen MV, Mauriala T, Auriola S, Kiehne K, Fölsch UR, Janne
J, Alhonen L, Herzig KH. (2008) Downregulation of PPARs and SREBP by acyl-CoA-binding
protein overexpression in transgenic rats. Pflugers Arch. 456 (2): 369-77.
III Oikari S, Ahtialansaari T, Huotari A, Kiehne K, Fölsch UR, Wolffram S, Janne J, Alhonen L,
Herzig KH. (2008) Effect of medium and long chain fatty acid diet on PPARs and SREBP-1
expression and glucose homeostasis in ACBP overexpressing transgenic rats. Acta Physiol
(Oxf). 194 (1): 57-64.
IV Oikari S, Huotari A, Mauriala T, Auriola S, Purhonen AK, Heinonen MV, Kiehne KH, Fölsch
UR, Alhonen L, Herzig KH. Role of ACBP overexpression on candidate genes (PPAR,
SREBP-1, Sirt-1, AMPK, FAS and CPT-1c) involved in fatty acid metabolisms in rat
hypothalamus. Manuscript.
*Equal contribution
TABLE OF CONTENTS
1. INTRODUCTION ................................................................................................................................. 15
2. REVIEW OF THE LITERATURE ..................................................................................................... 17
2.1 Acyl-CoAs ........................................................................................................................................ 17
2.2 ACBP ............................................................................................................................................... 18
2.2.1 ACBP gene ............................................................................................................................... 18
2.2.2 ACBP protein ........................................................................................................................... 20
2.2.3 ACBP expression ...................................................................................................................... 21
2.2.4 Functions of ACBP ................................................................................................................... 23
2.2.4.1 Functions associated with receptor binding or central nervous system ............................. 23
2.2.4.1.1 Receptor binding ....................................................................................................... 23
2.2.4.1.2 Implications of benzodiazepine receptor binding ...................................................... 26
2.2.4.1.3 Other central nervous system related functions ......................................................... 28
2.2.4.2 Peripheral and acyl-CoA binding associated functions ..................................................... 28
2.2.4.2.1 Acyl-CoA binding ..................................................................................................... 28
2.2.4.2.2 Regulation of transcription factors ............................................................................ 32
2.2.4.3 Other described functions of ACBP .................................................................................. 33
2.3 Transcription factors ......................................................................................................................... 35
2.3.1 Peroxisome proliferator-activated receptors ............................................................................. 35
2.3.2 Sterol regulatory element binding proteins ............................................................................... 36
2.4 AMP-activated protein kinase .......................................................................................................... 38
3. AIMS OF THE STUDY ........................................................................................................................ 40
4. MATERIALS AND METHODS .......................................................................................................... 41
4.1 Isolation of mouse ACBP/DBI gene................................................................................................. 41
4.2 Animals ............................................................................................................................................ 41
4.3 Western blotting ............................................................................................................................... 43
4.4 Real-Time Quantitative PCR ............................................................................................................ 43
4.5 Histological and morphological analysis .......................................................................................... 44
4.5.1 Immunohistochemistry ............................................................................................................. 44
4.5.2 Cellular localization of DBI ...................................................................................................... 45
4.5.3 Measurement of ventricle areas ................................................................................................ 45
4.6 High resolution magnetic resonance imaging (MRI)........................................................................ 45
4.7 Behavioural testing ........................................................................................................................... 45
4.7.1 Fear conditioning (FC) ............................................................................................................. 46
4.7.2 Water maze (WM) .................................................................................................................... 46
4.8 Synaptic transmission and induction of long-term potentiation (LTP) ............................................. 47
4.9 Seizure induction .............................................................................................................................. 47
4.9.1 Kainic acid ................................................................................................................................ 47
4.9.2 Pentylenetetrazole (PTZ) .......................................................................................................... 48
4.9.3 Histological evaluation ............................................................................................................. 48
4.10 Acyl-CoA extraction and measurement .......................................................................................... 48
4.11 Triglyceride, free fatty acid and cholesterol measurement ............................................................. 49
4.12 Glucose tolerance test (GTT) ......................................................................................................... 49
4.13 Statistical analysis of data............................................................................................................... 49
5. RESULTS .............................................................................................................................................. 50
5.1 Gene ................................................................................................................................................. 50
5.2 ACBP expression.............................................................................................................................. 50
5.2.1 Mouse line ................................................................................................................................ 50
5.2.2 Rat line ...................................................................................................................................... 50
5.3 Phenotype of the mouse line ............................................................................................................. 51
5.3.1 Ventricle size ............................................................................................................................ 51
5.3.2 Behavioural testing ................................................................................................................... 51
5.3.3 Long term potentiation (LPT) ................................................................................................... 52
5.3.4 Seizure induction ...................................................................................................................... 52
5.4 Phenotype of the rat line ................................................................................................................... 53
5.4.1 Weight ...................................................................................................................................... 53
5.4.2 Food intake ............................................................................................................................... 53
5.4.3 Acyl-CoA levels ....................................................................................................................... 53
5.4.4 Free fatty acids, triglycerides and cholesterol ........................................................................... 54
5.4.5 Glucose tolerance ..................................................................................................................... 54
5.5 Gene regulation ................................................................................................................................ 54
5.5.1 Peroxisome proliferator-activated receptors ............................................................................. 54
5.5.2 Sterol regulatory element-binding proteins .............................................................................. 55
5.5.3 AMP-activated protein kinase .................................................................................................. 55
5.5.4 Gene expression in the hypothalamus....................................................................................... 57
5.5.5 AMP-activated protein kinase in the hypothalamus ................................................................. 57
6. DISCUSSION ........................................................................................................................................ 58
6.1 ACBP gene and animal models ........................................................................................................ 58
6.2 ACBP in central nervous system ...................................................................................................... 59
6.3 ACBP and hypothalamic regulation of food intake .......................................................................... 61
6.4 ACBP and physiology of rats ........................................................................................................... 63
6.5 ACBP and regulation of gene expression ......................................................................................... 64
6.5.1 PPARs ....................................................................................................................................... 64
6.5.2 SREBP-1 ................................................................................................................................... 65
6.5.3 AMPK ....................................................................................................................................... 65
7. SUMMARY ........................................................................................................................................... 67
8. REFERENCES ...................................................................................................................................... 69
15
1. INTRODUCTION
Obesity is a major health problem worldwide. During the last years its prevalence has increased at such
an alarming rate that has been described even as an epidemic. According to World Health Organisation
(WHO) in year 2005, worldwide approximately 1.6 billion adults (over 15 year old) were overweight
(body mass index (BMI) over 25) and of these 400 million were obese (BMI over 30 in Western
population or BMI over 27 in East Asian population). An even greater concern is that worldwide at least
20 million children under 5 years old are overweight. Traditionally obesity has been considered as a
problem only in the Western countries, but recent development has been the dramatic increase in the
numbers of obese people also in the low- and middle-income countries. In Finland, recent report revealed
that approximately 57% of men and 43% of women are overweight and that about 15% of both men and
women are obese (Helakorpi et al., 2008). Obesity has been associated with various diseases such as type
II diabetes, heart disease, stroke, hypertension and some cancers, to mention only a few. In addition to
obesity, these diseases can also be considered as a part of metabolic syndrome, a condition characterized
by a group of metabolic risk factors accumulating in one person. These include abdominal obesity, high
blood triglyceride levels, low blood HDL cholesterol levels, elevated blood pressure and insulin
resistance or glucose intolerance. The prevalence of metabolic syndrome and obesity go hand in hand,
although a person with metabolic syndrome is not necessarily obese. Central obesity is more important
than BMI in the definition of metabolic syndrome (The IDF consensus worldwide definition of the
Metabolic syndrome, 2006).
Both obesity and metabolic syndrome are closely linked to fatty acid metabolism. Hence it is not
surprising that various enzymes and other factors regulating the metabolism of fatty acids have been
associated with the pathology of these diseases. The fact that fatty acids and their derivates have been
shown to be involved in the regulation of cellular metabolism makes them extremely interesting in
understanding the cellular changes in several diseases (Jump et al., 2005). In the cytosol, free fatty acids
are converted to acyl-CoAs. Acyl-CoAs are important intermediates of lipid and glucose metabolism, but
in addition they have been shown to function as regulators of various metabolic processes (Corkey et al.,
2000; Faergeman and Knudsen, 1997). Especially the role of fatty acids and acyl-CoAs in the regulation
of gene expression via their influence on different transcription factors has lately been associated with
the pathophysiology of various diseases. In the cytosol, acyl-CoAs bind to proteins e.g. fatty acid binding
proteins (FABPs), acyl-CoA binding protein (ACBP) and sterol carrier protein-2. These proteins act as
pool formers and transporters of intracellular fatty acids and acyl-CoAs. The binding properties and their
ability to influence metabolic and regulatory functions of fatty acids and acyl-CoAs are different for each
of these proteins. The role of FABPs in the regulation of gene expression has gained much interest. Not
only FABPs but also ACBP has been shown to modulate the regulatory functions of acyl-CoAs
(Knudsen et al., 2000; Schroeder et al., 2008).
16
Acyl-CoA binding protein (ACBP) is a 10 kDa protein that binds acyl-CoAs with high affinity and
specificity. It is believed to function as an intracellular acyl-CoA pool former and transporter (Knudsen
et al., 1993). In addition, ACBP can influence the regulatory functions of acyl-CoAs. It can release acyl-
CoA induced inhibition of certain enzymes and moreover can influence acyl-CoA mediated regulation of
gene expression via peroxisome proliferator-activated receptors (reviewed by Schroeder et al., 2008). A
recent study has also indicated that ACBP can influence transcriptional regulation of lipid metabolism
through hepatocyte nuclear factor-4α (HNF-4 )(Petrescu et al., 2003). In addition to its important role in
lipid metabolism, ACBP has been shown to displace diazepam from its binding sites on the type A -
aminobutyrate receptors (GABAA) and therefore the protein has also been named as diazepam binding
inhibitor (DBI) (Guidotti et al., 1983). Although there is extensive data on the role of ACBP in many
different processes, the detailed physiological importance and effects of the endogenously expressed
form of this versatile protein are still unclear. This study aimed to investigate the different physiological
aspects of ACBP as well as the molecular mechanism behind them.
17
2. REVIEW OF THE LITERATURE
2.1 Acyl-CoAs
Fatty acids are normally an important source of metabolic energy, but they also act as substrates for
membrane biogenesis and as storage forms of energy. Free fatty acids enter the cells either by diffusion
or by protein-mediated transport and are esterificated to acyl-CoAs by Acyl-CoA synthetase (ACS).
Acyl-CoAs are then bound and transported by intracellular proteins such as fatty acid binding proteins
(FABPs), acyl-CoA binding protein (ACBP) or sterol carrier protein-2. Acyl-CoAs are the active forms
of fatty acids that can further be utilized in metabolic pathways. In addition to the extracellular import of
free fatty acids combined to esterification, acyl-CoAs can be formed in biosynthesis from citrate through
acetyl-CoA and malonyl-CoA. The main metabolic pathways that utilize acyl-CoAs include the
formation of energy in mitochondrial β-oxidation, back-conversion to free fatty acids and usage as
glycerolipids like triacylglycerols and phospholipids in membrane formation. In addition, intracellular
acyl-CoA concentrations are also regulated by the activity of acyl-CoA hydrolases found in most
subcellular locations. The concentration of acyl-CoAs is reported to be in the range of 5-160 μM,
depending on tissue and metabolic state (reviewed by Faergeman and Knudsen, 1997). There are several
factors e.g. fasting, diets, diseases such as diabetes and some drugs, which have been reported to
influence the intracellular acyl-CoA levels. There are substantial differences also in the subcellular
concentrations. In addition to being intermediates of cellular metabolism, acyl-CoAs have been shown to
regulate processes like lipid and energy metabolism and signal transduction. In metabolism, acyl-CoAs
have been shown to either inhibit or to stimulate many enzymes such as acetyl-CoA carboxylase, AMP-
activated protein kinase and acyl-CoA synthetase. In signal transduction, acyl-CoAs are indicated to
regulate membrane trafficking, ion channels and ion pumps and dependent on the subtype either
stimulate or inhibit the function of protein kinase C (reviewed by Corkey et al., 2000; Faergeman and
Knudsen, 1997). Recent data has also shown that acyl-CoAs are involved in the regulation of gene
expression through transcription factors like peroxisome proliferator-activated receptors and HNF-4α
(Faergeman and Knudsen, 1997; Schroeder et al., 2008).
Figure 1. Acyl-CoAs: their role in cellular
metabolism and processes that are regulated
by acyl-CoAs. FFA = free fatty acids, TG =
triglycerides, FAS = fatty acid synthase,
CPT-1 = carnitine palmitoyltransferase 1.
18
2.2 ACBP
ACBP is a 10 kDa protein that binds acyl-CoA esters (C14 to C22) with high specificity and affinity
(Rasmussen et al., 1990; Rosendal et al., 1993). The same, identical protein was also isolated from rat
brain by its ability to displace diazepam from its binding sites on type A γ-aminobutyrate receptors
(GABAA receptors) and consequently named as diazepam binding inhibitor (DBI) (Guidotti et al., 1983).
ACBP homologues have been identified from all eukaryotics studied, including animals, plants, protozoa
and algae. Even though ACBP homologues have not been identified in most of the bacteria and archaea
species, some pathogenic eubacterial species have genes that resemble ACBP (Burton et al., 2005). The
ACBP protein is highly conserved across species; the rat and mouse proteins are 98.8% identical, while
there is 79.3% similarity between rat and human proteins. In addition, ACBP has a broad tissue
distribution, it has been found in all mammalian tissues investigated. This suggests that ACBP is
associated with one or more basic cellular functions.
2.2.1 ACBP gene
The mouse, rat and human ACBP genes consists of four exon regions and three introns (Fig. 3), but the
size of the gene varies from 5.6 kb in humans to 8.7 kb in rats. Also the chromosomal location of
functional ACBP gene varies from species to species. In rats, ACBP is located in chromosome 13, while
in humans it is in chromosome 2 and in mouse in chromosome 1. The rat ACBP gene family consists of
one expressed, functional gene and four additional processed pseudogenes of which one was shown to
exist in two allelic forms (Mandrup et al., 1992). Although multiple transcription initiation sites were
observed in the rat ACBP gene, there is no evidence for alternative splicing and hence only one variant
coding for an 87 amino acid protein is expressed (Mandrup et al., 1992). Unlike rats, both humans and
mice have multiple variants of the ACBP gene. The mouse ACBP gene can give rise to two splice
variants that are reported to be due to alternative usage of exon 1. The two variants are 87 and 135 amino
acid residues long and display differences in the N-terminal part of the protein (Nitz et al., 2005). In
mouse, there are no reported pseudogenes, although there is a gene coding for endozepine-like peptide
(ELP) that has over 50% protein similarity with ACBP. In addition, the ligand binding motifs of these
two proteins are highly conserved. The ELP gene has only one intron in the 5' untranslated region and
hence it has been suggested that ELP gene might have evolved by retroposon-mediated gene duplication
of the ancient ACBP gene (Valentin et al., 2000). In humans, there are three variants of the ACBP gene.
They encode for proteins of 86, 88 or 104 amino acid residues (Kolmer et al., 1995; Nitz et al., 2005).
The differences are in the N-terminal part of the proteins and do not interfere with the functional acyl-
CoA binding motifs. These alternative variants arise from differential usage of exon 1, pointing to the
possibility of differential promoter usage.
The promoter region of the rat ACBP gene displays all the key features of a housekeeping gene
(Mandrup et al., 1992). Nevertheless, it has been demonstrated that ACBP expression levels vary from
19
tissue to tissue, with the highest levels being found from tissues, which have a high lipid turn-over.
Furthermore, hormones, like insulin and androgens, fasting, feeding and state of cell differentiation can
influence the ACBP gene expression (Bhuiyan et al., 1995; Hansen et al., 1991; Swinnen et al., 1996).
The rat and human ACBP genes are regulated by transcription factors that are involved in lipid
metabolism. Intron 1 of the rat ACBP gene contains a peroxisome proliferator activated receptor (PPAR)
response element (PPRE) that is conserved also in human and mouse genes (Helledie et al., 2002a). This
PPRE binds and is activated by both PPARα and PPARγ, but not PPARδ (Neess et al., 2006; Sandberg et
al., 2005). PPRE in the intron 1 deviates from the classical PPAR response element by having a
guanine as a spacer between the two repeats instead of an adenine, this reduces the binding affinity of
PPAR (Helledie et al., 2002a). ACBP is a PPARα regulated gene, which displays a discrepancy in its
response to fasting. PPARα is involved in the fasting response by up-regulating the gene expression. In
contrast to the other PPAR regulated genes, ACBP’s expression tends to be reduced by fasting
(Bhuiyan et al., 1995). From rat ACBP gene, a second PPRE was located from the promoter region, but
transient transfection studies revealed that it is not functional (Helledie et al., 2002a). In addition to
PPARs, the involvement of CCAAT/enhancer binding protein (C/EBP) has been proposed, as there is a
response element in the rat promoter region, but a more detailed investigation revealed that the rat ACBP
gene is not activated by C/EBPα (Helledie et al., 2002a). Analysis of the human and rat ACBP promoter
revealed the presence of a conserved sterol regulatory element (SRE)-like sequence and further studies
confirmed that ACBP is activated by sterol regulatory element binding protein (SREBP) isoforms (Neess
et al., 2006; Swinnen et al., 1998). The function of SREBP isoforms is enhanced by the auxiliary
transcription factors SP-1 and nuclear factor-Y (NF-Y), whose binding sites are located upstream of the
functional SRE element (Neess et al., 2006). The co-regulation with SREBP and PPARα might be a
possible explanation for the reduction in ACBP transcription after fasting, since SREBP is known to be
involved in the down-regulation of genes in response to fasting.
The human ACBP gene has been considered as a candidate gene for several diseases and the occurrence
and association of single nucleotide polymorphism (SNP) of the ACBP gene has been investigated.
Multiple missense mutations in the ACBP gene have been found in patients suffering from
schizophrenia. A total of 18 novel SNPs were found, three of which caused missense changes in
conserved amino acids. The case-control association analyses of the three major SNPs showed no
significant association with the disease (Niu et al., 2004). SNPs of the ACBP gene have also been
investigated from patients with anxiety disorders. The exonic SNP rs8192506 was found to be associated
with anxiety disorders with panic attacks. The rare allele guanine in the SNP was overrepresented in the
control group. The resulting Val88Met change was determined to have a protective role against anxiety
disorders with panic attacks (Thoeringer et al., 2007). In addition, a significant association with type 2
diabetes and an SNP of the ACBP gene has been reported in two independent German study populations.
A minor allele of SNP rs2084202 of the human ACBP gene was shown to be associated with a reduced
20
risk of the disease. Since the SNP is located in the promoter region of the ACBP slice variant 1-c, it was
proposed that the SNP causing the adenine to guanine substitution could alter a site important for
transcription regulation, thus affecting ACBP expression levels (Fisher et al., 2007).
2.2.2 ACBP protein
The ACBP gene codes for an approximately 10 kDa protein, depending on species and possible
transcription variants. The protein is monomeric and forms a four-helix bundle structure. Either NMR or
crystal structures have been published from bovine, Plasmodium falciparum and human ACBP
(Andersen et al., 1991; Taskinen et al., 2007; van Aalten et al., 2001). All the known structures have the
same four-helix bundle folding, with a topology of up-down-down-up. The helices A2 and A3 form a
parallel helix pair with a 13 residue loop between them, also helices A1 and A3 are assembled as two
parallel pairs (Fig. 2) The binding of acyl-CoA molecule induced only a few structural changes near to
the binding pocket in all the structures studied (Kragelund et al., 1993; Taskinen et al., 2007; van Aalten
et al., 2001). The acyl-CoA binding pocket can be divided into three parts, 1) the adenine ring binding
pocket formed by Tyr 32 (human) and the acyl moiety of the acyl-CoA molecule. 2) The 3'-phosphate
binding site formed by Tyr 29, Lys 33 and Lys 55 (human). 3) A hydrophobic groove for the acyl moiety
binding formed by multiple amino acids (Taskinen et al., 2007). In all, 40% of the total binding affinity
is accounted for by the interactions with the 3'-phosphate of the CoA part of the ligand (Faergeman et al.,
1996; Kragelund et al., 1999). The most recent data on the structure of human ACBP protein revealed
that in addition to a monomeric binding of acyl-CoA, ACBP can also bind to acyl-CoAs in a dimeric
form where one ACBP molecule will bind the adenine part of the acyl-CoA and the ω-end of the acyl
chain will be bound by a second ACBP molecule (Taskinen et al., 2007). This model might help to
explain the mechanism by which ACBP is able to accept and donate acyl-CoA molecules from various
targets such as membrane structures and enzymes.
In addition to the full-length ACBP protein, several processing products of the protein have been
identified from rat brain and shown to have functional significance. These peptide fragments, which
contain the same C-terminal structure originating from amino acids 33-50 of the native ACBP protein,
are formed by posttranslational processing by endopeptidases and possess differential biological
activities (Slobodyansky et al., 1989). Further studies have indicated that these peptides, commonly
called endozepines, can also be found outside central nervous system. The most abundant and longest of
these peptide fragments is triakontatetraneuropeptide, TTN which consists of amino acids 17-50 of
native rat ACBP protein. In a hydrophobic environment, this peptide can adopt an α-helical structure
unlike the other peptide fragments (Berkovich et al., 1990). A second processing product, which has
been intensively studied, is called octadecaneuropeptide, ODN which consists of amino acids 33-50 of
native rat ACBP protein. The least studied fragment is the eicosapentaneuropeptide, EPN which consist
of amino acids 26-50 of the full-length ACBP protein (Ferrero et al., 1986b; Slobodyansky et al., 1989).
21
The occurrence of shorter fragments originating from these three processing products and their biological
function has also been investigated.
2.2.3 ACBP expression
ACBP is ubiquitously expressed throughout the whole body, although there are significant differences in
the expression levels from tissue to tissue. The highest levels are found from tissues with either high lipid
metabolism or steroid synthesis. In certain tissues, ACBP expression is located in specialized cells. In the
brain, the highest levels of either ACBP mRNA or ACBP-like immunoreactivity can be found in
cerebellum, hypothalamus and reticular thalamic nucleus (Alho et al., 1985; Ball et al., 1989; Ferrarese et
al., 1989). The ACBP expression is also localized in brain areas, in cerebellum the highest levels of
ACBP are found in Bergmann glia, whereas levels are low in Purkinje and Golgi neurons. In the
hypothalamus, the highest ACBP concentrations are found in the nerve terminals of the arcuate nucleus
and median eminence (Alho et al., 1985; Alho et al., 1988). The ACBP protein and its prcessing
products, ODN and TTN, have been detected in both neurons and in glial cells, although some suggest
predominantly glial expression (Tong et al., 1991; Alho et al., 1995; Tonon et al., 1990). The amino acid
sequence of rat ACBP does not have a apparent signal sequence for transmembrane passage (Mocchetti
et al., 1986), nevertheless ACBP has been located in synaptic vesicles and it is released after nerve
depolarisation in both rat brain tissue and in primary neuronal cultures (Costa and Guidotti, 1991).
Recent data has shown that horizontal optokinetic stimulation of rabbit retina evokes an increased
expression of ACBP from Müller cells. Furthermore, it was shown that threonine phosphorylated ACBP
is also secreted from these cells after potassium chloride or phorbol myristic acetate stimulation. It is
Figure 2. Schematic drawing of the bovine ACBP protein structure. N and C
labels for the N-terminus and C-terminus of the polypeptide. The helices are
labelled as A1, A2, A3 and A4. Modified from Taskinen et al. 2007.
22
likely that protein kinase C is responsible for the phosphorylation of ACBP (Qian et al., 2008). Unlike
the situation in rats and humans, in Drosophila melanogaster ACBP is not expressed in the adult nervous
system, only the larval and pupal brains of the species had detectable levels of ACBP (Kolmer et al.,
1994). In the periphery, the highest ACBP levels have been found from liver, kidney, adrenal gland,
intestine and adipose tissue. In liver, ACBP levels are high throughout the tissue, while in kidneys and
adrenal gland there are specialised cells containing higher levels of ACBP expression compared to the
rest of the tissue. In adrenal cortex, high concentrations of ACBP-like immunoreactivity were found in
the cells of zona glomerulosa, while the levels in the zona fasciculata and reticulata were considerably
lower (Bovolin et al., 1990). In kidneys, ACBP expression is concentrated in the epithelial cells of the
convoluted tubules and the ascending limb of the loop of Henle (Bovolin et al., 1990). High levels of
ACBP were also found in the Leydig cells of testis (Schultz et al., 1992). In the muscle tissue, which has
a relatively low expression of ACBP, it was observed that ACBP levels are different, depending on the
muscle fiber type. The highest levels were found in slow-twitch oxidative soleus muscle and lowest from
fast-twitch glycolytic white gastrocnemius. The ACBP expression in muscle correlated with the
expression of carnitine palmitoyltransferase-1 (CPT-1) expression levels and it was found to be increased
in obese Zucker rats (Franch et al., 2002).
Figure 3. Main characterstics of the rat ACBP gene (A) and protein (B and C). The rat
ACBP gene consists of four exons as indicated by numbered boxes (A). Gray boxes
indicate known transcription regulation sites. The rat ACBP protein is a 87 amino acid
peptide with three known processing products, the length and relative location in the
native peptide being shown (B). Section C summarizes the structural and functional
differences between the native ACBP protein and the two processing products. PPRE=
peroxisome proliferator activated receptor (PPAR) response element, SRE= sterol
regulatory element, NF-Y= nuclear factor-Y, TTN= triakontatetraneuropeptide, ODN=
octadecaneuropeptide, EPN= eicosapentaneuropeptide, PBR= peripheral benzodiaze-
pine receptor.
23
Traditionally ACBP is considered as a cytosolic protein, although it has been shown to be secreted after
nerve depolarisation in both rat brain tissue and in primary neuronal cultures (Costa and Guidotti, 1991).
In the cytosol of mammalian cells, fluorescently labelled ACBP was shown localize mainly to
endoplasmic reticulum (ER) and Golgi (Hansen et al., 2007). This localization was found to be ligand-
binding dependent; a mutated ACBP unable to bind acyl-CoAs did not shown a similar localization as
the normal protein. Furthermore, depletion of fatty acids from cells significantly reduced the ACBP
localization to Golgi while fatty acid overloading enhanced the association (Hansen et al., 2007). In
addition to cytosolic localization, it has been shown that ACBP as well as its ligands, the acyl-CoAs, are
present in the nucleus of rat liver and hepatoma cells (Elholm et al., 2000). Further experiments
confirmed nuclear localization of ACBP also in 3T3L1 adipocytes and showed that the expression of
ACBP in CV-1 cells resulted in substantial accumulation in nucleus (Helledie et al., 2000).
2.2.4 Functions of ACBP
Originally ACBP was identified as a putative modulator of type A -aminobutyrate (GABAA) receptors
by Guidotti et al. (1983). Further studies revealed that ACBP can modulate also the function of
peripheral-type benzodiazepine receptors (Besman et al., 1989; Guidotti et al., 1983; Yanagibashi et al.,
1988) and metabotropic receptors that are positively coupled to phospholipase C via a pertussis toxin-
sensitive G protein (do Rego et al., 2007). An identical protein was independently isolated from bovine
liver by Morgensen et al. (1987) and was shown to bind long-chain acyl-CoA esters. Over the years,
further effects have been added to the list of putative functions, e.g. inhibition of glucose induced insulin
release from pancreas (Chen et al., 1988), cholecystokinin (CCK) release in intestine (Herzig et al.,
1996) and calpain activation in cell death (Shulga and Pastorino, 2006).
2.2.4.1 Functions associated with receptor binding or central nervous system
2.2.4.1.1 Receptor binding
Type A -aminobutyrate (GABAA) receptors are heteropentameric membrane proteins that form ligand-
gated ion channels that respond to gamma-aminobutyric acid (GABA). Binding of GABA to the synaptic
recognition site on the receptors leads to opening of anionic channels, allowing the influx of Cl-
ions
(reviewed by Bormann 1988). In addition to the recognition site for GABA, these receptors have
multiple modulatory binding sites for benzodiazepines, barbiturates, neurosteroids and ethanol
(Bormann, 1988). The vast majority of the GABAA receptors are characterized by their sensitivity to
benzodiazepines, although this response is dependent on the subunit structure of the receptor, as this
heteropentameric peptide can be formed from several classes of subunits (α1-6, β 1-3, γ1-3, δ, ε, π and
ρ1-3) with different modulatory properties (reviewed by Rudolph and Mohler, 2006). Early studies
identified at least two different allosteric modulatory sites for benzodiazepines in GABAA receptors that
are relevant for the action of ACBP. One site binds the anxiolytic benzodiazepines (diazepam) and the
24
anxiogenic β-carboline carboxylate esters. In addition, it can bind the benzodiazepine antagonist
flumazenil (reviewed by Costa and Guidotti, 1991). The second site can bind a convulsant
benzodiazepine, 4'-chlorodiazepam. The function of this modulatory site is resistant to flumazenil
inhibition (Costa and Guidotti, 1991). Originally ACBP was shown to inhibit binding of [3H]diazepam to
GABAA receptors, thus it was named diazepam binding inhibitor (DBI) (Guidotti et al., 1983). In
subsequent studies, ACBP was shown to inhibit also [3H]methyl-beta-carboline-3-carboxylate,
[3H]flumazenil and [
3H]PK 11195 binding to various allosteric modulatory centres of GABAA receptors
(Barbaccia et al., 1988). ACBP did not affect the gating of the GABAA receptor in the absence of GABA,
but was demonstrated to be a negative modulator of GABA induced Cl- ion conductance in primary
cultures of spinal cord neurons and in neurons prepared from mouse embryos. The effect of ACBP was
shown to be dose dependent (at dosages 1 to 10 μM) and was inhibited by flumazenil (Bormann et al.,
1985; Bormann, 1988). From further pharmacological profiling with recombinant rat GABAA receptors
expressed in kidney cells, it was concluded that ACBP could function as a partial intrinsic negative
modulator of GABAA receptors (Costa and Guidotti, 1991).
In addition to GABAA, the peripheral benzodiazepine receptor (PBR, also known as translocator protein
and mitochondrial benzodiazepine receptor) has been found to bind benzodiazepines. PBR is wildly
expressed throughout the body, the highest levels are found in steroid producing tissues. In the central
nervous system, PBR expression is restricted to ependymal and glial cells. Unlike GABAA, PBRs are
intracellular receptors located mainly at mitochondrial outer membrane. The described functions of this
receptor include regulation of steroidogenesis and apoptosis (reviewed by Casellas et al., 2002). PBR
transports cholesterol to the inner mitochondrial membrane and therefore has been suggested to be a rate-
limiting step in the steroid and bile acid synthesis (reviewed by Lacapere and Papadopoulos, 2003).
Binding of the benzodiazepines to PBR was found to stimulate cholesterol transport and the formation of
steroids, although chronic administration did not have the same effect as acute treatments (Lacapere and
Figure 4. GABAA receptor. Besides GABA
recognition site this Cl-ionophore has
multiple modulatory binding sites for
benzodiazepines, barbiturates and neuro-
steroids.
25
Papadopoulos, 2003). In addition to porphyrins, ACBP has been identified as an endogenous ligand for
PBR. Early studies revealed that ACBP lacking two carboxyterminal amino acids (Gly-Ile) could
stimulate steroidogenesis in bovine adrenals (Besman et al., 1989; Guidotti et al., 1983). Further studies
have confirmed that des-(Gly-Ile)-ACBP purified from rat or bovine brain and testis stimulates the
cholesterol transport in isolated adrenocortical and Leydig cells (reviewed by Papadopoulos and Brown,
1995). Moreover, it was shown that both native and recombinant ACBP are able to stimulate cholesterol
loading of Cyp11a1 (first enzyme involved in synthesis steroids) in an in vitro reconstituted enzyme
system (Brown and Hall, 1991). In addition, high affinity PBR drug ligands are displaced by ACBP
(Bovolin et al., 1990; Garnier et al., 1993; Papadopoulos et al., 1992) and ACBP and PBRs are able to
form a protein complex in Leydig cells (Garnier et al., 1994). The endogenous effect of ACBP has been
studied by using ACBP knock-down with antisense oligonucleotides. Experiments in hormone
responsive MA-10 cells and constitutively steroid producing R2C Leydig cells indicated that suppression
of ACBP terminated the steroid production in these cells (Boujrad et al., 1993; Garnier et al., 1994).
In addition to the native ACBP protein, also its processing products ODN and TTN bind and modulate
the function of benzodiazepine receptors. The affinities and the effects of the processing products are
different from each other and from the native ACBP protein. Differences in the affinity and effects of
ODN and TTN can be explained by their sequence length (34 amino acids versus 18) and by differences
in the secondary structures. ODN is able to displace [3H]flumazenil from rat brain membranes, but is
unable to effect binding of [3H]PK 11195. On the contrary, TTN can actively displace [
3H]PK 11195, but
inactive against [3H]flumazenil binding. TTN can also enhance the inhibitory effect of picrotoxin on
GABA-dependent [3H]flunitrazepam binding in a similar manner as 4'-chlordiazepam (Slobodyansky et
al., 1989). ODN prefers the benzodiazepine sites of GABAA receptors that bind also anxiolytic
bendodiazepines and anxiogenic β-carboline carboxylate esters and are sensitive to flumazenil, while
TTN prefers sites that bind the convulsant benzodiazepine, 4'-chlorodiazepam, and is insensitive to
flumazenil (reviewed by Barbaccia et al., 1990). The two processing products prefer separate binding
sites and have a different ability to replace drug ligands from the benzodiazepine binding sites, also
distinct from the unprocessed, native ACBP. ODN and TTN have an effect at lower concentrations
compared to whole ACBP (Costa and Guidotti, 1991). ACBP can also be secreted in a threonine
phosphorylated form from retinal Müller cells. It was shown that threonine phosphorylated ODN has a
higher affinity towards the GABAA receptor compared to unphosphorylated ODN or unphosphorylated
ACBP (Qian et al., 2008). The affinities of the ACBP, ODN and TTN towards PBRs are also different.
ODN shows no significant affinity towards PBRs and is not able to stimulate steroid synthesis, as does
native ACBP. On the contrary, the affinity of TTN towards PBRs is higher than that of the unprocessed
ACBP and it is able to stimulate the steroid synthesis in cell lines in a similar fashion as native ACBP
(Berkovich et al., 1990; Papadopoulos et al., 1991; Papadopoulos et al., 1992).
26
2.2.4.1.2 Implications of benzodiazepine receptor binding
GABAergic neurotransmission is one of the best known inhibitory mechanisms operating in the central
nervous system. Enhancement of GABAergic neural inhibition and hence the activation of its receptors
represents the basis of the therapeutic treatment of many disorders and diseases like generalized anxiety,
panic anxiety, sleep disturbances and epilepsy. ACBP can affect the function of GABAA receptors either
directly or via neurosteroid synthesis by regulating PBR activity in glial cells. Neurosteroids are shown
to bind and influence the activity of GABAA receptors, although the effect is dependent on the steroid
form (Bormann, 1988). A modified version of the Vogel punishment test, a test that measures the anti-
conflict and pro-conflict activity of drugs that act at GABAA receptors, was originally utilized to
investigate biological actions of intracerebroventicular (i.c.v.) injection of ACBP (Ferrero et al., 1986a;
Ferrero et al., 1986b). These studies showed that ACBP could reverse the anti-conflict effects of
diazepam and that the pro-conflict effect of ACBP was antagonised by the pre-treatment with flumazenil.
In addition to native ACBP, also the effect of ODN and TTN has been investigated. Both processing
products were even more potent in producing a pro-conflict action than the unprocessed protein. In drug
ligand displacing studies, the action of ODN was competitively prevented by flumazenil, whereas TTN
was resistant to this drug (Slobodyansky et al., 1989). It was noted that i.c.v injections of ODN in male
mice led to increased aggressive behaviour in a dose dependent manner. This effect was reduced by the
benzodiazepine receptor antagonist (Kavaliers and Hirst, 1986). Furthermore, i.c.v injections of ODN to
both mouse and rats induced anxiety (De Mateos-Verchere et al., 1998). These effects were antagonised
by both diazepam and flumazenil, indicating that the effect of ODN was being mediated through GABAA
receptors. Interestingly, i.c.v injections of high doses of ODN did not induce tonic and/or clonic
convulsion in rats. In this way ODN differs from native ACBP (Ferrero et al., 1986b). Furthermore, in
mice low doses of ODN reduced convulsions and mortality induced by pentylenetetrazole (Garcia de
Mateos-Verchere et al., 1999). Pentylenetetrazole can block GABAA receptors chloride channels and it
has been used to evaluate the effect of anticonvulsant drugs acting on GABAA receptors.
Since ACBP is involved in anxiety and pro-conflict behaviour in animals, ACBP levels have been
determined from patients suffering from various diseases linked to either GABAA receptor function or
neurosteroid synthesis. The level of ACBP like immunoreactivity was increased in the cerebrospinal
fluid (CSF) of individuals with major depression with a severe anxiety component (Barbaccia et al.,
1986; Ferrero et al., 1988; Roy et al., 1988). The role of ACBP in anxiety has been further studied in
rodents. In a study utilizing acute noise stress in rats, it was found that both ACBP and ODN protein
levels were increased in the hippocampus of stressed animals (Ferrarese et al., 1991). Furthermore,
psychological stress increased cerebral ACBP mRNA expression in mice, while physical stress did not
have the same effect (Katsura et al., 2002). ACBP levels has been measured from individuals defined as
pathological gamblers, it was found that there were increased levels of ACBP in a subgroup of patients
showing clear signs of depression (Roy et al., 1988). Reports on patients with multi-infarct dementia or
27
dementia with Parkinson's disease indicated that there is no change in CSF ACBP-like immunoreactivity
(Barbaccia et al., 1986; Ferrero et al., 1988). Interestingly, a subsequent study showed that Parkinsonian
subjects with dementia have elevated ACBP levels in CSF (Ferrarese et al., 1990). There are conflicting
results also from patients with Alzheimer's disease. Studies by Barbaccia et al. (1986) and Ferrero et al.
(1988) reported no significant difference in ACBP like immunoreactivity between Alzheimer patients
and controls, while Ferrarese et al. (1990) showed increased CSF ACBP levels. Furthermore, it has been
demonstrated that beta-amyloid peptides can stimulate the ACBP mRNA expression and ACBP related
peptide release in cultured rat astrocytes (Tokay et al., 2005). In addition, somatostatin, a peptide which
levels have been shown to be reduced in Alzheimer's disease (Cervia and Bagnoli, 2007), can influence
the ACBP levels. Somatostatin can decrease the expression and release of ACBP from rat astrocytes
(Masmoudi et al., 2005). ACBP levels have been measured also from CSF of patients with various other
diseases. In schizophrenic patients there was no change observed in ACBP levels (Barbaccia et al.,
1986), while patients with Huntington's chorea exhibited decreased ACBP levels (Ferrarese et al., 1990).
Patients with hepatic encephalopathy showed increased cerebrospinal fluid ACBP levels. Normalization
of the mental status of these patients reduced the ACBP levels back to normal levels (Rothstein et al.,
1989). Significantly elevated plasma ACBP levels have been measured from adult patients with epilepsy.
Plasma levels of pediatric epilepsy patients were also elevated, although not to the same extent as seen in
adults (Ferrarese et al., 1998). Strikingly, when the patients were divided into subgroups, it was found
that the highest increments of ACBP levels were found from adult patients with generalized epilepsy and
from drug-resistant adult and pediatric patients (Ferrarese et al., 1998). Previous studies with
intrahippocampal injection ACBP peptide fragments (amino acids 42 to 50 and 43 to 50) have provided
further evidence for a possible role of ACBP in epilepsy. Injections of these fragments to rats evoked
limbic seizures typical of epilepsy. These seizures could be inhibited by administration of PK 11195
(selective antagonist of the benzodiazepine receptor subtype of GABAA receptor) (Vezzani et al., 1991).
Anxiety is considered to be one of the clinical features commonly found in the withdrawal syndromes
caused by alcohol (ethanol), nicotine and morphine. A single dose of ethanol did not affect mouse
cerebral cortex ACBP mRNA expression or the protein content, but induction of alcohol dependence by
inhalation of alcohol vapour for 8 days caused a significant increase in both ACBP mRNA and protein
levels in mouse cerebral cortex (Katsura et al., 1995). Furthermore, withdrawal of ethanol from these
animals caused a further enhancement of ACBP expression (Katsura et al., 1995; Katsura et al., 1998a).
Similar results have been obtained also from ethanol incubations of primary cultures of cerebral cortical
neurons (Katsura et al., 1998a). In addition, long-term administration of both morphine and nicotine
increased ACBP levels of cerebral cortex and withdrawal further increased the expression (reviewed by
Ohkuma et al., 2001). Further studies demonstrated that the effect of nicotine to ACBP expression was
mediated through nicotinic acetylcholine receptors (Katsura et al., 1998b), while the effect of morphine
28
occurred through activation of mu-opioid receptors, but not by kappa- or delta-opioid receptors (Katsura
et al., 1998b; Shibasaki et al., 2007).
2.2.4.1.3 Other central nervous system related functions
The lateral area of hypothalamus displays high ACBP expression levels (Alho et al., 1985). This region
has been shown to play a major role in the control of food intake. In addition, agonists of benzodiazepine
receptors increased the palatability and evoked hyperphagic responses (Cooper, 1989). Injection of
ACBP into the fourth ventricle of mouse suppressed the intake of 5% sucrose, water and 0.9 mM
quinine-HCl and inhibited the preference of the animals to drink 0.05% saccharin instead of water
(Manabe et al., 2001). Furthermore, i.c.v injection of ODN to rodents deprived of food for 10 hours
dose-dependently reduced food intake during the 12h follow-up period (de Mateos-Verchere et al.,
2001). In rats, continuous i.c.v. infusion of ODN for 15 days reduced the food intake during the first days
of its administration. The appetite reducing effect of ODN was not influenced by pre-treatment with
diazepam (de Mateos-Verchere et al., 2001). Moreover, i.c.v. administration of the ODN peptide to rats
resulted in increased expression corticotropin-releasing hormone mRNA and decreased expression of
neuropeptide Y, both peptides known to be involved in the regulation of food intake (Compere et al.,
2005). Since diazepam, a GABAA receptor and PBR agonist does not affect the suppression of food
intake caused by ODN, the mechanism of its function was further investigated. Recent results indicate
that the effect of ODN is mediated through the metabotropic receptor positively coupled to
phospholipase C via a pertussis toxin-sensitive G protein (do Rego et al., 2007). The anorexigenic effect
of ODN has been recently demonstrated also in goldfish (Matsuda et al., 2007). In addition to the
receptor mediated role in the regulation of food intake, ACBP might influence appetite also through acyl-
CoAs, as these esterified fatty acids have been found to play an important role in hypothalamic control of
food intake (reviewed by Lopez et al., 2007).
2.2.4.2 Peripheral and acyl-CoA binding associated functions
ACBP has been shown to have important functions outside the central nervous system that are not related
to the receptor binding ability of this protein. Consequently, ACBP was independently characterized as
an impurity in fatty acid binding protein preparations and was shown to induce synthesis of medium
chain acyl-CoA esters by goat mammary gland fatty acid synthetase (Mogensen et al., 1987). Further
analysis showed that this protein is identical to ACBP/DBI isolated from rat brain.
2.2.4.2.1 Acyl-CoA binding
ACBP is able to bind saturated acyl-CoA esters with a carbon chain length over 8 recidues, the acyl-
CoAs with a shorter chain length (2 to 4 carbons) did not show any significant binding (Knudsen et al.,
1989; Mikkelsen and Knudsen, 1987). The acyl-CoA binding affinity of ACBP is highest towards chain
29
lengths of 14 to 22 carbons, while ability to bind shorter and longer acyl-CoA esters is considerably
lower. ACBP binds specifically acyl-CoAs, as it exhibited no affinity towards nonesterified fatty acids
and only low affinity towards free CoA (Kd 2 μM). ACBP showed no binding to acylcarnitines,
cholesterol, or to a number of nucleotides (Rosendal et al., 1993). The Kd of ACBP towards acyl-CoAs
ranged from 0.6 to 7 nM, depending on the acyl-CoA form and the method of determination (Faergeman
et al., 1996; Schroeder et al., 2008). More detailed studies revealed that ACBPs binding affinity is
influenced by the degree of saturation, the relative affinities being as follows: saturated >
monounsaturated > polyunsaturated (Frolov and Schroeder, 1998; Huang et al., 2005). Evidence on the
physiological role of ACBPs ability to bind acyl-CoA has been obtained from yeast, rat hepatoma cell
lines and from mouse liver. In the yeast, Saccharomyces Carlsbergensis, overexpression of yeast ACBP
gene resulted in a significant increase of intracellular acyl-CoA pool (Knudsen et al., 1994). In a rat
hepatoma cell line, McA-RH 777, stable integration of rat ACBP cDNA led to elevated ACBP levels and
to increased incorporation of palmitic acid when the cells were incubated with it (Yang et al., 2001). The
most compelling data on the physiological role of ACBP in acyl-CoA pool size regulation has thus far
been obtained from liver of a transgenic mouse line overexpressing mouse ACBP cDNA under the
control of phosphoglycerate kinase promoter (Huang et al., 2005). These animals display a 33%
elevation in their liver ACBP protein level, resulting in an approximately 69% increase in liver acyl-CoA
pool. The liver acyl-CoA pool was increased in carbon chain dependent manner; mainly the levels of
saturated and polyunsaturated acyl-CoA were increased while there was no change in the levels of
monounsaturated acyl-CoAs. The ACBP effected also the intracellular location of the acyl-CoAs, with
the highest increment of acyl-CoA levels found in the liver membrane/organelle fraction (Huang et al.,
2005).
In vitro investigations on the effects of ACBP on the cellular function demonstrate in part the
mechanisms by which ACBP can influence the intracellular acyl-CoA pool size and also reveal new
intracellular effects of the protein. The ability of ACBP to extract membrane bound acyl-CoAs
(Rasmussen et al., 1994) can increase the soluble fraction of acyl-CoAs. By binding and extracting acyl-
CoAs from membrane-associated enzyme acyl-CoA synthetase (ACS), an enzyme that converts fatty
acids to acyl-CoAs, it was found that ACBP could release ACS of the end-product inhibition and
enhanced its function (Rasmussen et al., 1993). In addition, the activities of acyl-CoA carboxylase
(ACC) and adenine nucleotide translocase (ANT), two proteins involved in lipid metabolism whose
function is inhibited by acyl-CoA, were influenced by ACBP. It has been shown that ACBP can
efficiently release these proteins from acyl-CoA inhibition at acyl-CoA/ACBP ratios under 0.9
(Rasmussen et al., 1993). Furthermore, ACBP was able to protect acyl-CoA esters from hydrolysis by
microsomal hydrolases (Rasmussen et al., 1993). This in vitro data indicate that ACBP is capable of both
increasing acyl-CoA production and decreasing its hydrolysis and hence it can increase the overall
30
intracellular acyl-CoA pool, as was proven in two cell lines and also more recently in vivo in mouse
liver.
In addition to being able to function as a pool former of acyl-CoAs, in vitro data suggests that ACBP can
also act as an intracellular transporter of acyl-CoAs. In addition to extracting acyl-CoAs from
membranes, ACBP can also transport the extracted acyl-CoAs to mitochondria or ER and donate them
for either β-oxidation or glycerolipid synthesis (Rasmussen et al., 1994). The role of ACBP in the β-
oxidation was further supported by studies showing that carnitine palmitoyltransferase 1 (CPT-1), an
enzyme mediating the transport of acyl-CoAs to mitochondrial β-oxidation, is capable of interacting with
the acyl-CoA/ACBP complex. The activity of CPT-1 is correlated with the concentration of ACBP
bound acyl-CoAs, but not with levels of free acyl-CoAs (Abo-Hashema et al., 2001). Also other enzymes
have a similar preference for the acyl-CoA/ACBP complex over free acyl-CoAs. It has been claimed that
in isolated macrophage microsomes any elevation in the ACBP concentration can inhibit the activity of
acyl-CoA:cholesterol acyltransferase if the acyl-CoA pool is hold constant (Kerkhoff et al., 1997). On
the contrary, a recent study has shown that in isolated liver microsomes, ACBP's influence is dependent
on the presence of exogenous cholesterol as is the case with the other fatty acyl-CoA binding proteins
(fatty acid binding protein and sterol carrier protein-2) involved in the regulation of acyl-CoA:cholesterol
acyltransferase activity. This study demonstrated that in the presence of exogenous cholesterol, ACBP is
a strong stimulator of acyl-CoA:cholesterol acyltransferase activity, whereas in the absence of exogenous
cholesterol, ACBP functioned as an inhibitor of this enzyme (Chao et al., 2003). Similarly to CPT-1 and
acyl-CoA:cholesterol acyltransferase, also acyl-CoA:lysophospholipid acyltransferase from human red
blood cells preferred the acyl-CoA/ACBP complex over free acyl-CoAs (Fyrst et al., 1995). These
results demonstrate that ACBP is able to function as an intracellular transporter of acyl-CoAs and
possibly it can create a pool of acyl-CoAs to be directed for specific cellular purposes. In addition,
ACBP can influence also other regulatory functions of acyl-CoAs. Peptides with S-acylation sites have
been demonstrated to be able to be acylated at significant rates in the presence of acyl-CoAs. Addition of
ACBP under physiological molar ratios with respect to acyl-CoAs can inhibit this process (Leventis et
al., 1997). It is assumed that ACBP sequesters the acyl-CoAs in a complex, which is unable to serve as
an S-acyl donor, and as a consequence, ACBP may be able to prevent the spontaneous nonenzymatic S-
acylation caused by acyl-CoAs (Leventis et al., 1997). ACBP was also demonstrated to be able to
enhance the acyl-CoA induced activation of Ca2+
release channel of skeletal muscle sarcoplasmic
reticulum, indicating that the ACBP/acyl-CoA complex either interacted directly with components of
terminal cisternae membranes or indirectly through intermediates able to donate acyl-CoA to binding
sites on the membranes (Fulceri et al., 1997).
Besides results emerging from ACBP overexpression experiments, data on the physiological function of
ACBP has also been obtained from knock-out and knock-down studies in yeast, Trypanosoma brucei and
31
different mammalian cell lines. In addition, there is a mouse line with a spontaneous deletion of 400 kb
area in chromosome 1 containing the ACBP gene (Lee et al., 2007; Ohgami et al., 2005). Disruption of
the ACB1 gene, a gene that codes for the yeast homolog of ACBP, from Saccharomyces cerevisiae
resulted in slight reduction of the growth rate when the yeast cells were grown on ethanol, but no effect
was observed if they were grown on glucose (Schjerling et al., 1996). Despite of the fact that ACBP
disruption had only a limited effect on growth rates, this altered strain could not compete with wild type
cells when they were cultivated on the same plate. Interestingly, the knock-out of ACBP in yeast resulted
in 1.5 to 2.5 fold increase in overall intracellular acyl-CoA levels, although the increase in the acyl-CoA
level was caused solely by de novo synthesized stearoyl-CoA (C18:0). Further experiments revealed that
in the absence of ACBP, yeast fatty acid synthetase tended to form mainly long chain acyl-CoAs.
Addition of ACBP resulted in a decrease in the chain length of synthesized acyl-CoAs, suggesting that
ACBP efficiently transported the newly synthesized acyl-CoAs for further utilization (Schjerling et al.,
1996). In a more recent study utilizing the ACB1 gene depleted S. cerevisiae strain, it was noted that the
deletion originally caused a slower growing phenotype that adapted into a faster growing phenotype
(Gaigg et al., 2001). Further experiments with a strain having a conditional knock-out of the ACB1 gene
detected no change in the total acyl-CoA pool, but a significant increase in stearoyl-CoA (C18:0)
amount, as found also in the previous study. Depletion of ACBP did not affect the general glycerolipid
synthesis; there was no change in the phospholipid pattern, rate of synthesis or in the turnover of
phospholipid classes. In contrast, depletion of ACBP caused a reduction in total fatty acids with a chain
length of C26:0 and also a 50-70% reduction in the sphingolipid synthesis. As a consequence the
mutated strain accumulated 50-60 mm vesicles and autophagocytotic-like bodies in the cytosol and
displayed perturbed plasma membrane structures. These results suggest that ACBP is involved in yeast
membrane assembly and organization by creating a specific pool of acyl-CoAs required in membrane
trafficking (Gaigg et al., 2001).
Several mammalian cell lines have been used to study the effects of reduced ACBP expression.
Antisense RNA or siRNA constructs have been utilized to knock-down the ACBP protein levels in
mouse 3T3-L1 cells and in human HeLa, HepG2 and Chang cells. The ACBP antisense RNA used in
3T3-L1 cells caused inhibition of the adipocyte differentiation process. The treated cells showed a
significant reduction in the lipid accumulation and the morphological differentiation level of the cells
was accordingly reduced. The inhibition of differentiation was correlated with the expression levels of
ACBP antisense RNA (Mandrup et al., 1998). Further investigation on the effects of ACBP knock-down
revealed that it caused a reduction in the expression of two transcription factors involved in the terminal
stages of adipocyte differentiation, PPARγ and C/EBPα. On the other hand levels of transcription factors
C/EBPβ and C/EBPδ, both believed to be involved in the initiation of adipocyte differentiation, were
slightly elevated. Although knock-down of ACBP altered the differentiation of the adipocytes, it did not
affect the clonal expansion or the growth rate of the antisense transfected 3T3-L1 cells (Mandrup et al.,
32
1998). In human HeLA, HepG2 and Chang cells, the siRNA technique was utilized to knock-down the
ACBP protein expression. Targeted knock-down resulted in visual growth arrest and detachment of cells
in all three cell lines. ACBP depletion in HeLA cell induced apoptosis (Faergeman and Knudsen, 2002).
Similar results have also been obtained from T. brucei in which attempts to create a total knock-out
ACBP were unsuccessful. A conditional knock-out of ACBP in the same species showed that after 48 h
of ACBP depletion, the cells were unable to divide and underwent cell death over the next 4 days (Milne
et al., 2001). In contrast to the results obtained by Faergeman and Knudsen, a more recent study by
Shulga and Pastorino (2006) found that ACBP knock-down did not cause cell apoptosis in HeLA cells,
rather the opposite. In their study, ACBP was found to influence the components of calpain-induced cell
death and that the knock-down of ACBP actually inhibited cell damage (Shulga and Pastorino, 2006).
A mouse line with a 400 kb deletion in chromosome 1 (nm1054 mice) has also been utilized to
investigate the physiological effects of ACBP in vivo. Originally this mutation nm1054 arose in the
CBA/J mouse line but it has been subsequently transferred also to C57BL/6J and 129S6/SvEvTac lines
(Ohgami et al., 2005). The deleted region contains multiple areas that code for functional or predicted
genes, with ACBP being one of them. With respect to ACBP, one of the most interesting phenotypes of
the mutated mouse line is abnormal skin and hair development. The animals have sebocyte hyperplasia
and sparse, matted hair with a greasy appearance (Lee et al., 2007). In addition, these mice show altered
fatty acid metabolism with changes in hair triacylglycerol levels. To study in detail which of the genes
deleted are involved in this phenotype, Lee et al. (2007) have utilized nm1054 mice with additional
transgenic expression of specific regions originally deleted from these mice. These studies indicated that
transgenic expression of the region containing the ACBP gene and a novel predicted gene
3110009E18Rik (BAB29121) could reverse the skin phenotype of the mutated nm1054 mouse back to
normal. As the authors could detect only mRNA expression of ACBP from these transgenic nm1054
mice, they concluded that knock-out of ACBP was most likely responsible for the deranged skin and hair
phenotype of the mouse line (Lee et al., 2007).
2.2.4.2.2 Regulation of transcription factors
ACBP is located in the cytosol as well as in the nucleus of cells. Using real-time imaging and
fluorescently labelled recombinant ACBP, it was shown that about 22% of the protein is located inside
the nucleus (Schroeder et al., 2008). In addition, acyl-CoAs have been found to modulate regulation of
gene expression (reviewed by Black et al., 2000; Jump et al., 2005; Schroeder et al., 2008), indicating
that ACBP might have an additional role in these processes. Studies utilizing ACBP knock-out yeast
strains detected changes in the gene expression (Knudsen et al., 2000; Schjerling et al., 1996). Further
studies investigating the effects of ACBP on PPAR activation have shown that ACBP could inhibit the
trans-activation of PPAR subtypes (Helledie et al., 2000; Helledie et al., 2002b). These experiments
utilized a monkey kidney cell line (CV-1) transfected with a reporter construct and the vector expressing
33
one of the PPAR subtypes. Tetradecylthioacetic acid (TTA), a ligand that activates all PPAR subtypes
and is metabolized to CoA ester, or a PPARγ specific activator BRL49653 were used as activating
ligands. Results from these studies demonstrated that ACBP attenuated the ligand induced activation of
all three PPAR subtypes when TTA was utilized as activating agent, whereas ACBP was unable to
influence the function of BRL49653. Furthermore, these studies showed that the effect of ACBP seemed
to be mediated through the ligand-binding part of PPARs. These data indicate that the effect of ACBP is
mediated through binding of the ligand that activates PPARs, not by a direct interaction with the
transcription factor (Helledie et al., 2000; Helledie et al., 2002b).
Hepatocyte nuclear factor-4α (HNF-4α) is a transcription factor regulating genes involved in both lipid
and glucose metabolism. It has been shown that acyl-CoAs are able to either activate or inhibit the
function of HNF-4 , depending on the chain length and degree of saturation (Hertz et al., 1998; Petrescu
et al., 2002). Both in vitro and in vivo experiments showed that ACBP is able to physically and
functionally interact with HNF-4α. The first line of evidence about the ability of ACBP to influence
HNF-4α came from the fact that ACBP and HNF-4α were co-immunoprecipitated by antibodies to either
one of these proteins. The double immunolabeling and laser scanning confocal microscopy results
confirmed the colocalization in the nucleus and revealed that the intermolecular distance between these
two proteins is only 53 Å. The close distance between ACBP and HNF-4α was further confirmed by
immunogold electron microscopy, demonstrating that this colocalization is indeed specific. ACBP
exhibited no interactions with the other nuclear proteins studied (Petrescu et al., 2003). In addition, direct
interaction with ACBP elicits changes in the secondary structure of HNF-4 enhancing the trans-
activation (Petrescu et al., 2003). Interestingly, the ability of ACBP to increase the activity of HNF-4 is
dependent on the ACBP/HNF-4α ratio. When the ratio is below 0.7 there is a clear correlation in the
ACBP amount and HNF-4 activation, but with ratios higher than 0.7 the correlation disappears. This
might be due to competition for the ligand, namely acyl-CoAs, as both proteins can bind these
compounds with high affinities. This protein level dependent influence might be important factor
determining the influence of ACBP on HNF-4α activity (Petrescu et al., 2003).
2.2.4.3 Other described functions of ACBP
ACBP has been associated with several other functions. In the duodenum, ACBP has been shown to be
involved in trypsin sensitive cholecystokinin (CCK) release. ACBP was isolated from porcine duodenum
in the search for a peptide responsible of proteases sensitive CCK releasing factors. Further
investigations demonstrated that in rats ACBP is involved in the feedback regulation of pancreatic
secretion and the postprandial release of CCK (Li et al., 2000). By utilizing STC-1 cells, a murine tumor
cell line known to express CCK, it was shown that ACBP could elicit Ca2+
oscillations via the voltage-
dependent L-type Ca2+
channels. This change in the intracellular Ca2+
content resulted in increased
secretion of CCK from these cells (Yoshida et al., 1999).
34
ACBP can alter also the endocrine secretion of pancreas. ACBP is expressed in δ- and α-cells of islets
and in the epithelial cells of exocrine pancreas (Chen et al., 1988; Ostenson et al., 1991). The effect of
ACBP on pancreatic insulin secretion has been studied in several models. Utilizing isolated rat islets and
porcine ACBP, Ostenson et al. (1990) demonstrated that ACBP did not influence the basal insulin
secretion at 3.3 mM glucose or arginine stimulated insulin secretion, but inhibited glucose or 3-isobutyl-
1-methylxanthine stimulated insulin release. Furthermore, the negative effect of ACBP on insulin
secretion is specific and does not change glucose stimulated release of somatostatin or the glucagon
release (Ostenson et al., 1990; Ostenson et al., 1991). Similar results were obtained using rat ACBP in
isolated rat islets in either static or perifusion experiments. In addition, the processing product, ODN, had
similar effects on insulin secretion as native peptide, whereas TTN had no effect on either glucose
stimulated or on the basal insulin secretion (Borboni et al., 1991). Further studies with the processing
products ODN and TTN in both isolated rat islets and hamster insulinoma (HIT-T15) cells confirmed
previous results, showing that the effects of ODN on glucose and glibenclamide stimulated insulin
release are most likely mediated by cytoplasmic Ca2+
levels (De Stefanis et al., 1995). In contrast to these
short term experiments, cultivation of fetal rat pancreatic islets enriched in beta-cells for three days in a
medium with different concentration of porcine ACBP exhibited no effects on islet insulin and
polyamine levels or in the insulin secretion. This long term incubation of pancreatic cells with ACBP
resulted only in a dose-dependent inhibition of beta-cell DNA synthesis which could be overcome by
glucose stimulation (Sjoholm et al., 1991). Intravenous infusion of ACBP to rats caused a moderate and
transient reduction in plasma insulin levels in glucose stimulated animals. Further investigation with peri
fused rat islets showed that ACBP was mainly affecting the acute-phase of glucose stimulated insulin
release (Ostenson et al., 1994). These results indicate that ACBP can function as a short term modulatory
effector of glucose stimulated insulin release. This can be either through the abilities of ACBP or ODN
to alter the signalling pathways that influence cytoplasmic Ca2+
levels or through changes in the acyl-
CoA pool.
ACBP has also been shown to influence cell death through calpain activation. Calpains are proteases that
have been claimed to have an important role in apoptosis and necrosis (review by Harwood et al., 2005).
ACBP has been proposed to function as an m- and μ-calpain activator. Activation of both calpains
requires Ca2+
ions. ACBP has been demonstrated to drastically lower the Ca2+
concentrations needed to
activate m-calpain, while the effect on μ-calpain is similar but less drastic. The activating effect of ACBP
was shown to be dependent on calcium, but not to be affected by the acyl-CoA binding state of ACBP
(Melloni et al., 2000). Further experiments have shown that ACBP has a critical role in Bid (a
proapoptotic protein that is activated by proteolytic activation by caspase-8 or calpains) induced
activation of calpains (Shulga and Pastorino, 2006). In isolated mitochondria, activated Bid can increase
the ACBP content of supernatant without altering the mRNA expression of the protein. Furthermore,
35
knock-out of ACBP by siRNA was shown to inhibit Bid induced cell death and that ACBP required the
presence of PBR to be able to influence the function of Bid protein. It was proposed that Bid protein can
mediate its calpain activating and hence apoptosis activating effects through the ACBP/PBR complex,
enabling further activation of additional Bid proteins and other apoptosis inducing factors (Shulga and
Pastorino, 2006).
2.3 Transcription factors
2.3.1 Peroxisome proliferator-activated receptors
Peroxisome proliferator-activated receptors (PPARs) are transcription factors belonging to the steroid
hormone nuclear receptor super family, which comprises a large group of ligand dependent transcription
factors. PPARs have been claimed to have a wide range of functions in the regulation of lipid
metabolism, energy balance and inflammation. In addition, PPARs have been shown to be involved in
various diseases like obesity, diabetes and atherosclerosis. Like other family members, PPARs have both
a DNA binding domain and a ligand binding domain. The C-terminal ligand binding domain directs the
specific binding of the ligands needed for activation of the PPARs. In addition to ligand binding, this
domain is also required for heterodimerization with the retinoid X receptor (RXR) and for undergoing an
interaction with other transcriptional co-factors. The central DNA binding domain facilitates the binding
of ligand activated PPARs to specific regions called PPAR response elements (PPREs) located in the
promoters of regulated genes. Since they are ligand dependent transcription factors, activation of PPARs
starts with binding of a specific ligand, causing a conformation change that facilitates the formation of
the heterodimer with RXR. This complex is then able to bind to PPREs. In the absence of ligand, PPAR-
RXR heterodimers exhibit active repression by co-repressors, histone deacetylases and chromatin-
modifying factors preventing the function of PPARs. Ligand binding also facilitates the binding and
release of accessory factors that can have a profound effect on the functionality of the complex. The
known co-factors of PPARs include repressors like N-CoR and SMRT and activator proteins like PPARγ
co-activator-1 (PGC-1) and CREB (reviewed by Ahmed et al., 2007; Seedorf and Aberle, 2007; Zoete et
al., 2007). Furthermore, the activity of PPARs is regulated by various protein kinases (reviewed by
Burns and Vanden Heuvel, 2007). The function of factors regulating PPARs is cell and tissue specific
and although normally the PPAR complex activates gene expression, in some circumstances the effect
may be opposite (reviewed by Ahmed et al., 2007). The PPAR family consists of three isotypes PPARα,
PPARγ and PPARδ, which is also named PPARβ. They all share the same basic structure and method of
activation, but have differences in their preferred ligands, tissue distribution and in the cellular processes
that they regulate. In addition to functional differences, these proteins are encoded by separate genes.
PPARα was the first member of the PPAR transcription factor family to be characterized. Originally it
was isolated from mice and found to interact with drugs that caused peroxisomal proliferation in liver
36
(Issemann and Green, 1990), consequently all isoforms were named as peroxisome proliferator-activated
receptors. PPARα is expressed in liver, heart, kidney, skeletal muscle, intestine and pancreas. Lower
levels have also been detected in many other tissues. In general, PPAR is mainly expressed in tissues
with high oxidative capacities. In accordance to its tissue distribution, PPARα has been associated with
regulation of fatty acid oxidation, lipid metabolism and inflammation, thus far approximately 80-100
genes have been identified as being regulated by PPAR (Ahmed et al., 2007). In addition to synthetic
drug ligands, i.e. the fibrates, PPAR ligands include both saturated and unsaturated long chain fatty
acids, branched chain fatty acids and eicosanoids. In addition to fatty acids, also long chain acyl-CoAs
are able to bind PPARα with high affinities. The role of acyl-CoAs on PPARα function is controversial;
some studies have reported an inhibitory effect on gene expression through recruitment of co-repressors
while others have shown that acyl-CoAs have activating effects on PPARα regulated genes (Reviewed
by Gilde and Van Bilsen, 2003; Schroeder et al., 2008).
The highest levels of PPARγ isoform are found in the adipose tissues. Other sites of expression include
skeletal muscle, liver, heart, intestine and the cells of the vascular and immune system. PPARγ ligands
include long chain polyunsaturated fatty acids, nitrated forms of some fatty acids and some
prostaglandins. Thiazolidinedione drugs like pioglitazone and rosiglitazone serve as synthetic ligand
activators of PPARγ. PPAR has an essential role in adipocyte differentiation and lipid storage. In
addition, it is involved in the regulation of glucose homeostasis and inflammation (Reviewed by Ahmed
et al., 2007).
PPARδ, is the least extensively studied isoform of the PPAR family. Compared to the other two
isoforms, its expression is more ubiquitous, including the adipose tissue, skeletal muscle and heart. It
seems that especially in muscle tissue, PPARδ has an important role, as its expression is 10 to 50 times
higher than that of the other isoforms. PPARδ has been found to alter gene expression in a rather similar
manner as PPARα, it enhances fatty acid catabolism and energy uncoupling. The main difference
between the two isoforms is the tissues involved, with PPARα mainly affecting liver while PPARδ
functions in muscle. PPARδ has also been indicated to regulate membrane lipid synthesis and turnover,
fat storage and lipid accumulation in macrophages (Reviewed by Ahmed et al., 2007; Seedorf and
Aberle, 2007). Natural ligands of PPARδ seem to include saturated fatty acids of chain length 14 to 18
and polyunsaturated fatty acids of chain length 16 to 20. In addition, some eicosanoids have been shown
to be able to bind PPARδ. GW501516, derivate of phenoxyacetic acid, is a specific synthetic ligand for
PPAR (Seedorf and Aberle, 2007).
2.3.2 Sterol regulatory element binding proteins
Sterol regulatory element binding proteins (SREBPs) are a family of transcription factors regulating
genes involved in cholesterol and lipid metabolism. They have been shown to play important roles for
37
example in adipocyte differentiation and insulin-dependent gene regulation. Separate genes code for
SREBP-1 and SREBP-2. SREBP-1 is further divided to SREBP-1a and SREBP-1c; these originate from
the presence of a differential transcription start sites. SREBP proteins consist of an N-terminal
transcription factor domain that is linked by two transmembrane segments to the C-terminal regulatory
domain. SREBPs are synthesized as large precursor proteins that are inserted into the ER. Precursors are
transported from ER to the Golgi apparatus and activated by cleavage of the transcriptional domain,
which then can enter the nucleus. The main control of the SREBP activity occurs in the ER where the
protein is bound by the SREBP-cleavage-activating protein (Scap), which acts as a sterol sensor. In sterol
depleted cells, the Scap/SREBP complex is able to interact with the COPII coat proteins, enabling
SREBP to be incorporated into vesicles and transported to the Golgi where two proteases (site 1 (S1p)
and site 2 (S2p) proteases) cleave the peptide and release the active domain of SREBP. The released
transcriptional domain of SREBP is transported into nucleus as a dimer by importin β, a protein required
for the transfer of the complex across the nuclear envelope. In the presence of sterols, Scap binds also the
sterols and hence the complex is no longer able to interact with COPII coat proteins, but rather undergoes
interactions with Insig-1 and Insig-2 (insulin-induced genes). The binding of the Scap/SREBP complex
to Insig proteins retains them on the ER and prevents the activation of SREBPs (reviewed by
Bengoechea-Alonso and Ericsson, 2007; Eberle et al., 2004; Espenshade, 2006; Shimano, 2001). The
active fragment of SREBP forms a basic helix-loop-helix leucine zipper transcription factor that is able
to bind to both classical E-boxes and sterol regulatory elements (SREs). Maximal activation of genes by
SREBP requires the presence of additional DNA-binding proteins, namely NF-Y, CREBP or Sp1,
depending on the gene. The nuclear SREBPs are targets of various posttranslational modifications that
can affect their functions; these include phosphorylation, acetylation, sumoylation and ubiquitination. A
number of co-factors like p300, CBP and PGC-1β have also been shown to alter the regulatory functions
of SREBPs. SREBPs are in part also regulated at the transcriptional level, for example insulin and other
nutritional status related factors have been shown to regulate SREBP expression in various tissues. There
is also evidence that liver X receptor (LXR) can regulate the expression of SREBP. Variation in binding
affinities, co-regulator usage and other modifications affect differentially the functions of the three
SREBP forms. SREBP-2 is mainly involved in the regulation of cholesterol metabolism, whereas
SREBP-1s are involved general energy metabolism including fatty acid and glucose/insulin metabolism.
There are further differences between SREBP-1a and SREBP-1c, with SREBP-1a being the more potent
regulator due to its larger transcriptional domain. Overall more than 30 genes have thus far been
identified as SREBP target genes. There are also differences in the tissue distribution between SREBP-1c
and SREBP-1a. SREBP-1c is expressed in most tissues with high levels in liver, adipose tissue, skeletal
muscle and brain, whereas SREBP-1a is highly expressed in certain tissues like spleen and intestine
(reviewed by Bengoechea-Alonso and Ericsson, 2007; Espenshade, 2006; Shimano, 2001).
38
2.4 AMP-activated protein kinase
AMP-activated protein kinase (AMPK) is one of the main regulators of energy balance, switching cells
from an anabolic state to a catabolic state and it can influence hypothalamic regulation of food intake.
AMPK is a heterotrimeric protein consisting of the catalytic subunit and the regulatory β and
subunits. There are multiple genes coding for each subunit, two for subunits and β and three for
subunit , making 12 possible heterotrimeric combinations (reviewed by Hardie, 2008). The subunit
contains a kinase domain and a C-terminal domain that interacts with the β-subunit. The β-subunit has
domains that interact with both - and -subunits and a carbohydrate binding domain that is believed to
function in fuel sensing. The -subunit has multiple domains involved in the activation of the complex
(reviewed by McGee and Hargreaves, 2008).
The main activator of AMPK is 5´-AMP. AMPK is activated both by a direct allosteric effect and by 5´-
AMP promoted phosphorylation of the critical threonine 172 on the -subunit. In total, 5´-AMP is able
to induce 1000-fold increase in the kinase activity. In addition to 5´-AMP, upstream kinases have been
shown to activate AMPK. The most common kinase is tumor suppressor kinase LKB1 and its two
accessory proteins STRAD and MO25 (Woods et al., 2003). A second upstream kinase believed to be
able to phosphorylate the critical Thr 172 is calmodulin-dependent protein kinase kinase (CaMKK)-
and –β (Hardie, 2008). At the whole body level, certain hormones such as leptin and adiponectin have
been found to influence the activity of AMPK in various tissues.
AMPK activation promotes catabolic pathways that generate ATP and at the same time it down-regulates
anabolic pathways that consume ATP. A key pathway involved is the glucose metabolism: AMPK is
increasing the glucose uptake of muscle tissue both by increasing translocation of glucose transporter-4
(Glut-4) to plasma membranes and by enhancing its gene expression. In other tissues AMPK is
influencing the glucose uptake by increasing the activity of glucose transporter-1 (Glut-1) (Hardie,
2008). In addition, AMPK can also induce glycolysis and inhibit gluconeogenesis. In addition, AMPK
Figure 5. Pathways relevant for ACBP related processes that
are activated (→) or inhibited (─┤) by AMPK.
39
regulates the fatty acid metabolism through acyl-CoA carboxylase (ACC). Phosphorylation of ACC by
AMPK has been shown to inactivate it. This results in inhibition of fatty acid synthesis and through the
reduced malonyl-CoA levels in increased oxidation of fatty acids. Malonyl-CoA can regulate the rate-
limiting step of fatty acid oxidation by inhibiting the function of CPT-1. In addition to direct effects on
enzymes regulating metabolism, it has been shown that AMPK is involved in transcriptional regulation
of genes. Phosphorylation by AMPK has been found to influence the function of multiple transcription
factors and other regulators of gene expression, including PPARs and HNF-4 (reviewed by McGee and
Hargreaves, 2008). In addition to influencing cellular energy balance, AMPK can also alter the whole
body energy status by influencing hypothalamic regulation of food intake (Lopez et al., 2007). The
ability of AMPK to modify a multitude of metabolic processes in many different tissues means that it is
one of the main regulators of energy homeostasis.
40
3. AIMS OF THE STUDY
The aim of this study was investigate the physiological role of acyl-CoA binding protein (ACBP) /
diazepam binding protein (DBI) by utilizing transgenic mouse and rat lines overexpressing mouse ACBP
gene under the control of endogenous promoter. In order to generate the animal models, the mouse
ACBP gene was isolated and characterized.
Specific aims of this thesis were
1. To investigate the long-term effects of endogenously expressed ACBP in mouse central nervous
system, in particular the role of ACBP in the behaviour of the animals. (I)
2. To investigate the effects of long-term overexpression of ACBP on physiological parameters of rats
and the molecular mechanisms behind possible changes, with a special focus on lipid and glucose
metabolism. (II)
3. To study the influence of different dietary conditions on glucose and fat metabolism in transgenic rats
overexpressing ACBP. (III)
4. To characterize the role of ACBP on gene expression regulation in the hypothalamus. (IV)
41
4. MATERIALS AND METHODS
4.1 Isolation of mouse ACBP/DBI gene
Mouse DBI gene was isolated from a genomic library of mouse strain 129/SvJ (Stratagene, La Jolla, CA,
USA) by PCR screening method using two primer pairs (Israel, 1993). The first pair amplified a 255 bp
region of the first intron of mouse DBI gene (GenBank acc. L76367). For the second primer pair, rat DBI
gene was compared to a mouse EST sequence database in GenBank using BLAST. One EST containing
sequence originating from intron three of mouse DBI gene was found and primers were designed to
amplify the region from intron three to exon four of the DBI gene. The genomic library was plated into
96 well cell culture plate at density 1000 pfu/well. Samples were analysed by PCR and secondary
screening was performed. After tertiary screening, phages from positive wells were plated on LB-agar
and individual plaques were picked up for PCR analysis. Positive clones were selected and subcloned
into Bluescript KS (Stratagene). One positive clone was sequenced on both strands by primer walking
and transposon-mediated DNA sequencing according to the manufacturer's instructions (Template
Generation System, Finnzymes, Finland).
4.2 Animals
The isolated gene (GenBank AF220221) was microinjected using standard techniques into the pronuclei
of zygotes derived from Balb/c x DBA/2 mice or from Wistar rats. In mice studies, both female and male
adult transgenic (tg) and syngenic (sg) mice were utilized. In rat studies, adult male tg and sg animals
were used. The weight of the rats was measured at the age of 6 weeks and 1 year. Food intake of the 6
week old rats was measured by weighing the food pellets once a day for a period of four days. To study
effects of changes in the nutritional status, rats were either ad libitum fed or 16 h fasted. The effect of
high fat diets with low energy content (energy content of 13.1-13.4 KJ/kg and 44-49% of energy from
fat) was studied with four month old male rats (average weight 380 g) that were divided into two groups:
I. Fed with high fat diet enriched with medium chain fatty acids (MC) (mainly octanoic (C8) and
decanoic acid (C10), Tables 1 and 2) for 4 weeks and fasted overnight (16 h) before sample collection. II.
Fed with high fat diet enriched with long chain fatty acids (LC) (mainly hexadecanoic (C16) and
octadecanoic acid (C18), Tables 1 and 2) for 4 weeks and fasted as the MC diet group. The high fat diets
were formulated (Institute of Animal Nutrition and Physiology, Kiel University) to have low energy
content compared to commercial high fat diets (19.8 kJ kg-1
; Table 1) in order to investigate the effects of
different fatty acid chain lengths without interference of high energy content. To study the involvement
of AMPK in the regulation of the transcription factors, AMPK inhibitor ((compound C (6-[4-(2-
piperidin-1-ylethoxy)phenyl]-3-pyridin-4-ylpyrazolo[1,5-a]pyrimidine), Sigma) at a dose of 11 mg/kg
body weight or control injections with dimethylsulphoxide were administrated i.p. to fed tg rats. Animals
42
Table 1. Composition of high fat diets used.
Component LC diet MC diet
g/kg diet
Fat (LC = palm oil, MC =
synthetic triglycerides) 128.8 145.6
Soy bean oil 30.7 30.1
Lecithin 25.8 25.3
Corn starch 178.5 175.1
Casein 155.8 152.8
Methionine 1.8 1.8
Gelatine 11.7 11.4
Wheat bran 31.3 30.7
Water 386.5 379.1
Vitamin premix 8.0 7.8
Mineral premix 41.1 40.3
Energy content* 13.4 kJ kg-1 13.14 kJ kg-1
*For comparision: High fat diet from Research Diets (New
Brunswick, NJ, USA) D12451: 19,80 kJ/kg diet (45 kcal% from fat)
Table 2. Fatty diet composition of MC and LC diet
Fatty acid LC diet MC diet
Content g/kg diet
C8:0 n.n 85.5
C10:0 n.n 31.6
C12:0 0.4 0.5
C14:0 1.5 n.n
C16:0 50.8 4.9
C16:1 n.n n.n
C18:0 59.5 1.6
C18:1 7.6 7.1
C18:2 21.7 21.8
C18:3 2.9 2.9
Others 1.0 n.n
n.n. = Not detectable
43
were sacrificed by decapitation, tissues were collected in either liquid nitrogen or RNAlater solution
(Qiagen, Hilden, Germany) and stored at -70°C until further analysis unless otherwise stated. All animals
were housed in groups of two to six (two to three for rats or three to six for mice) animals per cage under
a controlled environment (temperature 20 ± 1°C, humidity 50-60%, lights on 07.00-19.00), unless
otherwise stated. The experiments were approved by Institutional Animal Care Committee of the
University of Kuopio and by the Provincial Government. Procedures were conducted in accordance with
the guidelines set by the European Community Council Directives 86/609/EEC.
4.3 Western blotting
Tissues were homogenized with Ultra-Turrax (IKA, Staufen, Germany) in buffer (25mM TRIS, 0.1 mM
EDTA, 1 mM DTT and protease and phosphate inhibitor cocktails if required (Sigma, St Luis, MO,
USA)). Equal amounts of protein were separated in SDS-PAGE and electrophoretically transferred onto
0.2 μm nitrocellulose or PVDF membranes. Nonspecific binding was blocked by 5% powdered milk in
TBST (20 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% Tween-20). ACBP, AMPKα and Thr 172
phosphorylated AMPKα were detected with incubation in specific antibody (ACBP 1:1000 dilution;
Peninsula Laboratories, Bachem, Bubendorf, Switzerland or 1:400 dilution Santa Cruz Biotechnology,
Santa Cruz, CA, USA, AMPK and Phospho AMPKα 1:1100 dilution, Cell Signaling Technology,
Danvers, MA, USA) followed by HRP labelled secondary antibody (1:17 000 dilution, Zymed
Laboratories, San Francisco, CA, USA). Antibody-antigen complexes were visualized with ECL Plus
(GE Healthcare, Chalfont St. Giles, UK). Detection was done with either Typhoon 9400 Imager (GE
Healthcare) or Storm 860 Imager (GE Healthcare). Band densities were analyzed with ImageQuant™ TL
program (GE Healthcare). Equal loading of the proteins was controlled with simultaneous detection of ß-
actin or α-tubulin (Cell signaling technology, 1:1500 dilution).
4.4 Real-Time Quantitative PCR
Total RNA was isolated from tissues by RNeasy mini kit (Qiagen, Hilden, Germany). Genomic DNA
was digested by Dnase I (Qiagen) and RNA was reverse transcribed to cDNA (TaqMan Reverse
Transcription Reagents, Applied Biosystems, Foster City, CA, USA).
Quantitative gene expression analysis was performed on an ABI PRISM 7700 (Applied Biosystems)
using SYBR Green technology and 18s RNA as a control gene. PCR primers (Table 3) were designed
with eprimer3 program or taken from the literature (Hoekstra et al., 2003; Rodgers et al., 2005;
Schmittgen and Zakrajsek, 2000). Reactions contained 2 l sample cDNA (40-60 ng), 1* SYBR Green
master mix (Applied Biosystems), 2-15 pmol of primers in a total volume of 30 µl. All samples were
handled as duplicates in the following conditions: 2 min at 50ºC and 10 min at 95ºC followed by 40
cycles of 15 s at 95ºC and 1 min at 60ºC. Each assay included a relative standard curve of three serial
dilutions of cDNA from control sample and no template controls.
44
TABLE 3: Primers used in quantitative RT-PCR.
Gene Forward Reverse
Mouse ACBP/DBI gene CACTCAGGCAACCTACATC GAACAGCATCTCTTCATCAG
Mouse and rat ACBP mRNA GAAGCGCCTCAAGACTCAGC TTCAGCTTGTTCCACGAGTCC
Rat PPAR α TGAACAAAGACGGGATG TCAAACTTGGGTTCCATGAT
Rat PPAR δ GAGGGGTGCAAGGGCTTCTT CACTTGTTGCGGTTCTTCTTCTG
Rat PPAR γ CATGCTTGTGAAGGATGCAG TTCTGAAACCGACAGACTGACT
Rat SREBP-1 AGCGCTACCGTTCCTCTATC GCGCAAGACAGCAGATTTAT
Mouse and rat 18s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG
Rat SIRT-1 CAGTGTCATGGTTCCTTTGC CACCGAGGAACTACCTGAT
Rat PGC-1α ACTGAGCTACCCTTGGGATG TAAGGATTTCGGTGGTGACA
Rat FAS CAGTTTCCGTGAGTCCATC TCATCAAAGGTGTGCTCATC
Rat CPT-1c AATCCTTCACCCTCATCGTC ATCCCAACTGGAAGCACTCT
4.5 Histological and morphological analysis
Mice were perfused intracardially with 20 ml of PBS and then 3x20 ml of 4% PFA. Brains were
immerse-fixed in 4% PFA for 4 hours and moved to PBS. Cryoprotection was carried out using 20%
sucrose in PBS for 24 hours. Brains were frozen in liquid nitrogen-isopentanol solution for 20 minutes.
Brain slices of 16 μm were cut using cryotome. The whole brain was cut and every third slice was taken
for staining.
4.5.1 Immunohistochemistry
DBI-immunoreactive neurons were stained utilizing the biotin-avidin technique (Lewis et al., 1986).
Briefly, the sections were treated with 1% hydrogen peroxide to remove endogenous peroxidase, and
washed in potassium phosphate–buffered saline (KPBS), pH 7.4 before blocking in 10% normal goat
serum (NGS) and 0.5% Triton X-100 in KPBS. Thereafter, sections were incubated for 3 days (+4°C) in
DBI antibody (1:16 000, Paesel-Lorei, Hanau, Germany) in 1% NGS, 0.5% Triton X-100 in KPBS. The
sections were washed with KPBS containing 2% NGS before incubation for 1h with biotinylated goat
anti-rabbit immunoglobulin G (1:1500 Vector, Burlingame, CA, USA). After washing in KPBS with 2%
NGS, sections were incubated in avidin-biotin solution (Vectastain Elite ABC kit (Standard), Vector) for
45 min and washed in KPBS with 2% NGS. Incubations in the secondary antibody and in the avidin–
biotin solution were repeated. The DBI-antibody complex was visualized with 0.05% 3',3'-
diaminobenzidine (DAB; Pierce Chemical, Rockford, IL, USA), and 0.05% hydrogen peroxide in KPBS.
Sections were mounted onto gelatin-coated slides, dried overnight at 37°C, and intensified with osmium
tetroxide and thiocarbohydrazide.
45
4.5.2 Cellular localization of DBI
To examine the cellular localization of DBI, double immunostaining with neuronal (neuronal nuclei,
NeuN), astrocytic (glial fibrillary acidic protein, GFAP) was performed. In short, sections were rinsed in
KPBS, blocked in 10% normal horse serum (NHS) and incubated for 3 days at 4°C in a primary antibody
mix containing DBI antibody (1:1000, Peninsula Laboratories) and NeuN antibody (1:15 000, Chemicon
International, Temecula, CA, USA) or GFAP antibody (1:2000, Roche, Mannheim, Germany). After
washing, the sections were incubated overnight at 4ºC with the secondary antibody mix containing Cy2-
conjugated donkey anti-rabbit IgG (1:200, Jackson ImmunoResearch Laboratories, West Grove, PA,
USA) and biotinylated horse anti-mouse IgG (1:200, BA-2000, Vector, Burlingame, CA, USA) followed
by an incubation of Cy5-conjugated streptavidin (2 μg/ml, Jackson ImmunoResearch Laboratories).
Sections were mounted on non-gelatinized slides with GelMount and dried overnight before analysis.
Photographs were taken from the granule cell layer and the CA3 layer of hippocampus with Nikon
Eclipse/Ultra WIEW (Tokyo, Japan) confocal microscope.
4.5.3 Measurement of ventricle areas
The ventricle areas were measured from Nissl stained slides at 48 μm intervals using Stereo Investigator
2000 (MicroBrightField, Williston, VT, USA) program in a system comprising of Olympus BX50
microscope linked to a personal computer. Both ventricles from each section were measured blinded
regarding to phenotype and the means were calculated.
4.6 High resolution magnetic resonance imaging (MRI)
Adult mice (tg n=5 and sg n=5) were anesthetized with an i.p. injection (50 μl/10 g body weight) of a
mixture of fentanyl-fluanisone and midazolam, and externally fixed to a custom-built animal holder for
high resolution magnetic resonance imaging (MRI). Warm air was blown through the magnet bore
during MRI. A s.m.i.s. console (Surrey Medical Imaging Systems, Guildford, UK) interfaced to a 9.4 T
vertical magnet (Oxford Instruments, Oxford, UK) was used for MRI with a single loop surface coil
(diameter 27 mm) in the transmit/receive mode. Multi-slice T2-weighted images were acquired using a
single-echo spin-echo method (time-to-repetition 3000 ms, time-to-echo 45 ms, 4 scans/line, field of
view 25.6x12.8 mm2 (transversal) or 25.6x25.6 mm2 (coronal), matrix size 256x64 and slice thickness
0.75 mm).
4.7 Behavioural testing
Five sg and 6 tg male, 12 sg and 12 tg female mice (6 months old at the time of testing) were used for
behavioural analysis. Behavioural test battery included the tests for exploratory activity (elevated plus
maze, light-dark box, Y-maze, open field), nociception (hot plate), coordination (beam walking, rotarod),
46
and learning and memory (fear conditioning, water maze). All tests were performed essentially as
described by Voikar et al. (2004).
4.7.1 Fear conditioning (FC)
This classical conditioning analyses two memory components – association of unconditioned stimulus
(foot-shock, US) with a particular compartment (contextual memory) and simple association of
conditioned stimulus (tone, CS) with shock. The experiments were carried out employing a computer-
controlled fear conditioning system (TSE, Bad Homburg, Germany). Training was performed in a clear
acrylic cage (35 x 20 x 20 cm) within a constantly illuminated (550 lx) fear conditioning box. A
loudspeaker provided a constant, white background noise (68 dB) for 120 seconds followed by 10 kHz
tone (CS, 75 dB, pulsed 5 Hz) for 30 seconds. The tone was terminated by a foot shock (US, 0.7 mA, 2
seconds, constant current) delivered through a grid floor. Two CS-US pairings were separated by a 30-
second pause.
Contextual memory was tested 24 h after the training. The animals were returned to the conditioning box
and total time of freezing (defined as an absence of any movements for more than 3 seconds) was
measured by infrared light barriers scanned continuously with a frequency of 10 Hz. The CS was not
used during this time. Memory for CS (tone) was tested 2 h later in a novel context. New context was a
similarly sized acrylic box. The light intensity was reduced to 100 lx, the floor was plain (without a
shock grid) and the background colour was black (as opposed to the white colour used in training
context). After 120 seconds of free exploration in the novel context, the CS was applied for an additional
120 seconds and freezing was measured as above. In addition, the activity was registered in all phases of
training and testing. Freezing behaviour and activity were later corrected for the baseline measures
(preconditioning for context test and new context for cue test) and expressed as a change from the
respective baselines.
4.7.2 Water maze (WM)
The WM test was introduced for testing spatial learning and memory in rodents (Morris, 1981). The
system used here consisted of a black circular swimming pool (diameter 120 cm), escape platform
(diameter 10 cm) submerged 0.5 cm under the water surface in the centre of one of four imaginary
quadrants and computer interfaced video tracking system (EthoVision, Noldus, The Netherlands). The
animals were released to swim in random positions facing the wall and the time to reach the escape
platform was measured in every trial. Two training blocks consisting of three trials each were conducted
daily. The interval between trials was about 5 min and between training blocks about 5 h. The platform
remained in a constant location for 3 days (6 sessions) and was thereafter moved to the opposite quadrant
for 2 days (4 sessions). The transfer tests were conducted approximately 18 h after the 4th, 6th and 10th
training sessions. The spatial memory was estimated by the time spent in the zone around the platform
47
(covering 6.25% of the total area of the water tank) and in the corresponding zones of the three
remaining quadrants. In addition, the swimming distance and the thigmotaxis were measured.
Thigmotaxis was defined as the time spent swimming within the outermost ring of the water maze (10
cm from the wall).
4.8 Synaptic transmission and induction of long-term potentiation (LTP)
Tg mice (n=17) and their sg littermates (n=18), 5-8 months old, were used. Both females (n=20) and
males (n=15) were investigated to see whether a sex difference causes changes in synaptic
neurotransmission and/or plasticity. Mice were anesthetized with halothane and brains rapidly dissected.
Slices were obtained from the middle third of hippocampi in both hemispheres and stored in a holding
chamber at room temperature (~24°C). The holding chamber was continuously gassed with 95% O2-5%
CO2. Individual hippocampal slices were transferred for recording into a submerged chamber held at 32
± 1°C with a bathing solution containing (in mM) NaCl 124, KCl 3, KH2PO4 1.25, CaCl2 3.4, MgSO4
1.0, NaHCO3 26, D-glucose 10 and L-ascorbate 2. Slices were bubbled with 95% O2-5% CO2 to prevent
calcium precipitation and perfused with a rate of 2.0 ml/min.
Electrophysiological recordings were made from the apical dendritic field of CA1 area in the
hippocampal slice using a glass microelectrode filled with 2 M NaCl. A Bipolar electrode made of
twisted tungsten wire (50 μm) for stimulation was placed in the stratum radiatum of CA1 at a lateral
distance of minimum 200 μm from the recording electrode. The stimulation intensity was adjusted to
obtain about 50% of the maximal excitatory postsynaptic potential (EPSP) amplitude and input was
stimulated (0.1 ms pulse duration) every 30 seconds. If the baseline of EPSP responses did not stabilize,
the experiment was discontinued. Paired pulse facilitation (PPF) was assessed by measuring the percent
change of the second response relative to the first response to a pair of stimulation pulses separated by 75
msec. After a stable baseline period (20 min), LTP was elicited in the pathway by two applications of 10
bursts (inter-burst interval 30 s) of high frequency stimulation in a 'theta burst' pattern (TBS), i.e. 100 Hz
trains of 4 pulses separated by 200 ms (Larson and Lynch, 1986; Pussinen and Sirvio, 1998). For
maximal induction of LTP, the stimulation intensity was increased by setting the pulse duration to 0.3
ms. Monosynaptic field EPSPs were band-pass filtered from 0.1Hz to 3 kHz and digitized at 10 kHz.
Data were recorded and analyzed by a microcomputer using the pCLAMP8.0 program (Axon
Instruments, Foster City, CA, USA).
4.9 Seizure induction
4.9.1 Kainic acid
26-30 mg/kg of kainate (KA) (in 0.9% NaCl, 26 – 30 mg/kg, Opika-1™ Kainic Acid, Ocean Produce
International, Nova Scotia, Canada) was administered intraperitoneally (i.p.) to either 5 or 8 month old tg
48
and sg mice. One observer, blind to the genotype of the animals, determined the occurrence of
behavioural seizures in mice visually for four hours after KA injection. The time to the first behavioural
manifestations of seizures, number and severity of behavioural seizures during the 4 h follow-up period
were scored according to a modified Racine´s scale (Lahteinen et al., 2003; Racine, 1972)
4.9.2 Pentylenetetrazole (PTZ)
(Sigma). Eight sg and 8 tg male mice (5 months old, weight 27.0-38.5 g) were used for studying the
seizure threshold with PTZ. PTZ was dissolved in 0.9% NaCl and 60 mg/kg was injected i.p. Two
observers, blind to the genotype, monitored the animals for one hour after the injection. Time to the first
behavioural manifestations of seizures, number and severity of the seizures during the 1 hour follow-up
were recorded.
4.9.3 Histological evaluation
Mice, which had been injected with 28 mg/kg KA were perfused as described above 48 hours after
injection. Brain sections were made in the coronal plane (30 μm, one-in-five series). The amount of
degenerating neurons after KA injection was evaluated using Fluoro-Jade B staining. After incubation in
decreasing alcohol concentrations, the slides were bathed in a solution containing 0.06% potassium
permanganate for 15 min, washed and incubated in Fluoro-Jade B solution containing 0.001% Fluoro
Jade stain in acetic acid. After washing, the slides were dried, dehydrated in an alcohol series and xylene
and mounted with DePeX. The amount of degenerating neurons in granule, hilus, CA3a, CA3b, CA3a
and CA1 areas were visually evaluated as triplicates and scored. Evaluation started at the section where
the suprapyramidal and infrapyramidal blades connected for the first time and continued for the six
following sections.
4.10 Acyl-CoA extraction and measurement
Acyl-CoAs were extracted and measured from 6 independent samples of visceral adipose tissue and liver
of transgenic and syngenic rats as described by Mauriala et al. (2004). In brief, tissue samples were
powdered under liquid nitrogen and heptadecanoyl-CoA (C17:0) was added as an internal standard.
Powdered tissues were homogenized in 5 ml ice-cold isopropanol-K2HPO4 and acidified with glacial
acetic acid and washed with hexane-isopropanol and hexane. The hexane phase was discarded and
proteins in lower phase were precipitated with saturated ammonium sulphate and methanol-chloroform
solution. After centrifugation, the protein pellet was washed, centrifuged and supernatants combined.
After addition of water the upper aqueous phase was washed with chloroform. The extracted chloroform
phases were combined with the lower phase, washed with water and the aqueous phases from the
extractions were then pooled. Prior to the analysis samples were dried under nitrogen and re-dissolved in
49
5% methanol-water. Acyl-CoAs were detected using on-line HPLC-ESI-MS/MS. This method was
validated in the range of 0.1-15.0 pmol/μl of acyl-CoAs and recovery was 60±5%.
4.11 Triglyceride, free fatty acid and cholesterol measurement
Serum free fatty acids were measured from fed tg and sg rats using an enzymatic colorimetric method by
NEFA C kit (Wako, Neuss, Germany). Plasma triglycerides and cholesterol were determined with
Ecoline S reagents (DiaSyS, Holzheim, Germany).
4.12 Glucose tolerance test (GTT)
A glucose dose, 1 g/kg body weight, was administered i.p. to unanaesthetized rats, blood samples were
collected from saphenous vein at 0, 10, 20, 60 and 120 min after injection. Plasma glucose was measured
using EPOS 5060 (Eppendorf, Hamburg, Germany) and serum insulin by rat insulin ELISA (Crystal
Chem, Downers Grove, IL, USA).
4.13 Statistical analysis of data
Results of the GTT and insulin levels were analyzed with two-way repeated measurements ANOVA and
Bonferroni post-tests. Significance of differences in mean values of synaptic responses and LTP were
tested by analysis of variance (ANOVA, MANOVA). Otherwise differences between groups were
assessed by Student’s t – Test or Mann-Whitney U test when appropriate. Statistical significance was
defined as p value < 0.05. All statistical tests were done using Graph Pad Prism (Graph Pad software,
San Diego, CA, USA) or SPSS 11.5 software.
50
5. RESULTS
5.1 Gene
In order to create the transgenic animal lines, mouse ACBP/DBI gene was isolated from a genomic
library. The ACBP gene (11.1 kb) consisted of 1.8 kb promoter, 4 exon regions including the recently
found alternative exon 1 (Nitz et al., 2005) and 1.9 kb 3 ' flanking region. The promoter region contained
various potential binding sites for transcription factors including peroxisome proliferator activated
receptors (PPARs) that have been previously reported to take part in the regulation of ACBP/DBI
expression (Helledie et al., 2002b). The exon/intron structure was similar to that of the rat and human
genes. Comparison of the exon sequences with mouse ACBP/DBI cDNA revealed no base differences in
the protein coding region. The nucleotide sequence of the isolated mouse ACBP/DBI gene has been
submitted to GenBank database under accession number AF220221.
5.2 ACBP expression
5.2.1 Mouse line
Microinjections created two mouse lines carrying the ACBP/DBI transgene. The line designated
UKU302F was chosen for further studies on basis of higher expression levels. Transgenic (tg) mice were
viable and fertile. Quantitative real-time PCR from genomic DNA of the tg mice confirmed that there is
a 30 times increase in the gene copy number and the brain ACBP/DBI mRNA levels were 6.2 times
higher in the tg animals than in their sg littermates (Paper I, Fig.1). Western blots confirmed that the tg
animals had 37 times more ACBP/DBI protein than the sg littermates. Tg animals had elevated mRNA
and protein levels also in the other tissues studied.
The sites of transgenic expression of ACBP in the central nervous system were studied in more detail.
Staining with ACBP/DBI antibody showed excessive expression in the infragranular region of the
dentate gyrus in tg animals (Paper I, Fig.2). Double staining with neuron specific NeuN and glial cell
marker GFAP demonstrated that both in the infragranular region as well as in the CA3 field of the
hippocampus DBI was mainly expressed in glial cells (Paper I, Fig. 3).
5.2.2 Rat line
The isolated endogenous mouse ACBP gene (AF220221) including the promoter region was used to
create a rat line overexpressing ACBP. Transgenic rats overexpressing ACBP were viable and fertile.
Quantitative real-time PCR results from liver, adipose tissue and isolated hypothalamus showed that
ACBP mRNA was about 6-27 times higher in tg animals than in sg controls (Paper II, Fig.1 and Paper
IV, Fig.1) Especially in adipose tissue there was a considerable increase (27 times) in ACBP mRNA
51
levels. Western blot results confirmed the elevated ACBP levels. Furthermore, quantitative real-time
PCR results revealed that in liver of transgenic (tg) animals, fasting doubled the ACBP mRNA levels
(Paper II, Fig.1).
The effects of the high fat diets on the expression of ACBP mRNA were investigated in liver and in
visceral adipose tissue. In liver, both sg and tg rats showed a similar trend to increased ACBP expression
with the LC diet compared to the MC diet fed rats (Paper III, Fig.1). On the contrary, in adipose tissue,
the MC diet-fed tg rats had significantly elevated levels of ACBP compared to the LC diet fed tg rats
(Paper III, Fig.1). There was no difference between diets in the sg controls.
5.3 Phenotype of the mouse line
5.3.1 Ventricle size
Basic histology revealed enlarged ventricles in the tg animals, therefore more detailed investigations
were performed. Mean ventricle areas were calculated for each mouse and compared between tg and sg
animals by planemetrical analysis. Adult tg mice exhibited a significantly larger mean ventricle area than
sg controls. In addition, the difference in ventricle size was confirmed by MRI study showing that the
adult tg animals had a five times larger mean ventricle area than their sg littermates (Paper I, Fig. 4).
MRI studies with newborn mice revealed that the differences were already evident at birth and evaluation
of the rat line (Fig. 6) confirmed that the hydrocephalus is specific effect of increased ACBP levels and
not caused by an insertional mutagenesis.
5.3.2 Behavioural testing
ACBP has been indicated to induce pro-conflict behaviour and anxiety (De Mateos-Verchere et al., 1998;
Ferrero et al., 1986a; Ferrero et al., 1986b). Evaluation of the behaviour of transgenic animals showed
that there was no major difference between the groups in motor and exploratory activity as assessed by
open field, elevated plus maze, light-dark and Y-maze tests. Furthermore, the pain sensitivity (hot plate)
and coordination (rotarod, beam balancing) were not affected by the overexpression of the ACBP/DBI
transgene. Nonetheless, in the fear conditioning experiments tg males displayed significantly reduced
Figure 6. Hydrocephalus in rats.
MRI pictures shown enlarged
vesicles in tg rats. Mean ventricle
volume in sg 15.4±5.16 mm3 and in
tg 53.2±37.14 mm3.
52
freezing in conditioning context (a hippocampus-dependent form of memory) as compared with sg males
(Paper I, Fig 5). However, there was no difference between females (effect of genotype F(1,31)=3.6,
p=0.067; interaction of genotype and sex F(1,31)=6.8, p=0.014). The extent of freezing in response to the
conditioned stimulus (tone; amygdala-dependent) did not differ between the sg and tg mice.
All groups learned to find the hidden escape platform in the water maze experiment (Paper I, Fig.6a).
However, in the first transfer test (after 4 learning blocks), the sg mice displayed a clear preference for
the trained quadrant whereas the tg mice did not show any spatial selectivity (Paper I, Fig. 6b). After
prolonged training (2 additional blocks of trials) tg mice also learned to search in the trained quadrant
(Paper I, Fig. 6c). Both groups were able to learn to find the platform in the new (opposite) location and
showed a preference for the new zone in the third transfer test (Paper I, Fig. 6d). All mice rapidly learned
to swim to the platform when it was made visible, confirming that they possessed sufficient motor and
motivational abilities to perform the swimming navigation task.
5.3.3 Long term potentiation (LPT)
The effect of ACBP on spatial and emotional learning and memory was further analysed with LPT. Field
EPSP waveforms evoked by Schaffer-collateral stimulation were measured in CA1 during the baseline
recording period. Comparable stimulation currents elicited equivalent amplitude responses in tg and sg
slices and no differences in responses were observed between the groups in any parameter tested
(amplitude, slope, half-width; n.s)(Paper I, Table 1).
Theta burst stimulation led to a transient post tetanic potentiation up to three minutes in both sg and tg
mice. In contrast, it evokes to a long-term potentiation of synaptic strength only in sg but not in tg mice.
In sg mice, Schaffer-collateral synapses exhibited approximately 100% increase in EPSP amplitude
measured 10-45 minutes after high frequency stimulation, whereas the potentiation was approximately
20% in DBI tg mice during this time period (Paper I, Fig. 7). There was no difference between the sexes
(for gender effect F=0.06, n.s.). Thus, there were significant differences in the long term potentiation of
EPSP amplitude between female tg and sg mice (for group effect F=5.20, p<0.05) and between male tg
and sg mice (for group effect F=6.13, p<0.05). In all mice, there were significant differences in the long-
term potentiation of EPSP amplitude between tg and sg mice (for group effect F=11.21, p<0.01)(Paper I,
Fig.7).
5.3.4 Seizure induction
In order to investigate in more detail the possible effect of ACBP on GABAA receptor function, i.c.v
injections of KA and PTZ were performed. All mice, except one sg female treated with 30 mg/kg of KA,
developed seizures during the four hour observation period (Paper I, Table 2). The highest mortality
(38.5%) in tg mice occurred at 28 mg/kg. In sg mice, the highest mortality (58.3%) was seen at 30
53
mg/kg. The time period from injection to death was longest at the lowest dose 26 mg/kg used in both tg
and sg animals. The time became shorter as the dose was increased in tg mice but this was not observed
in sg animals, however the difference was not statistically significant. Furthermore, there were no
significant differences between sg and tg mice in the total numbers of seizures or in the latency to first
seizure during the 4-hr observation period (Paper I, Table 3). There was no difference in the amount of
degenerating neurons in granule, hilus, CA3a, CA3b, CA3a and CA1 areas (Paper I, Table 4).
All mice injected with 60 mg/kg PTZ developed seizures. Sg animals had even higher mortality (37%)
than tg mice (0%) but there were no statistical differences in either the number or the time period to the
first seizure.
5.4 Phenotype of the rat line
5.4.1 Weight
It has been shown that ODN, a processing product of ACBP can influence the weight and food intake of
rodents (de Mateos-Verchere et al., 2001). In our tg animals, no weight difference was observed when
these rats were compared sg littermates at the age 6 weeks (188±25 g for sg versus 169±35 g for tg) or at
the age of 1 year (515±29 g for sg versus 524±25 g for tg). During the four week period on the MC or
LC high fat diets, the weight of the animals was monitored. There was no significant difference between
tg and sg rats within the same diet group.
5.4.2 Food intake
The daily food consumption was measured for four days. The mean daily food intake (in grams) was not
affected by the increased ACBP expression (19.8 ± 1.7 g for sg versus 18.8±2.5 g for tg). Taking into
account the weight of the animals did not influence the results.
5.4.3 Acyl-CoA levels
It has been shown that overexpression of ACBP increases the acyl-CoA content of yeast and mouse liver
(Huang et al., 2005; Knudsen et al., 1994). To ensure that mouse ACBP gene was functionally active in
rats and to study whether overexpression of ACBP could affect acyl-CoA contents, we measured acyl-
CoA levels from visceral adipose tissue, liver and brain of fed and fasted animals. Our results
demonstrate that the mouse ACBP gene is functionally active in rats: liver C16 acyl-CoA levels were
increased (C16:0 2.8 times and C16:1 2.3 times higher) as well as the C20 levels (C20:0 1.4 times and
20:4 1.3 times higher) in fed animals. There was no difference in any of the liver acyl-CoAs measured
from fasted animals (Paper II, Fig.2, note the different scale). In adipose tissue, there was a 5 to 11 times
increase in C16:0, C16:1 and C18:1 in the fed state. In fasted animals, levels of C16:0, C16:1, C18:0 and
54
C18:1 were 2 to 4 times higher in tg animals (Paper II, Fig.2). In brain there was an increase of C20:4 in
the fed tg rats. Interestingly, the fasted tg rat had an decrease in C20:0 levels compared to sg littermates
(Paper IV, Fig.2).
5.4.4 Free fatty acids, triglycerides and cholesterol
Overexpression of ACBP did not influence serum free fatty acid, plasma triglyceride and cholesterol
levels of tg rats fed with standard diet (Paper II, Table 2). In addition, high ACBP expression did not
affect the free fatty acid levels of tg rats fed with either medium or long chain high fat diets.
5.4.5 Glucose tolerance
GTT was performed to test whether overexpression of ACBP and/or the subsequent changes with
increased levels of cellular acyl-CoAs affect plasma glucose levels or insulin secretion. There was no
significant difference between tg rats and their sg controls in the glucose tolerance or in the insulin levels
when fed with normal diet (Paper II, Fig.3).
GTT was also performed after feeding a MC and LC high fat diet for four weeks. The MC diet fed tg
animals had improved glucose tolerance (ANOVA p=0.0036. Paper III, Fig.2), and a significant
reduction in overall insulin levels (ANOVA p=0.016). The insulin levels were significantly lower at 20
min and 120 min (p< 0.05. Paper III, Fig.2) indicative of an improved insulin responsiveness. In LC diet
fed animals, there was no difference in glucose tolerance or in the insulin levels (Paper III, Fig.2).
5.5 Gene regulation
5.5.1 Peroxisome proliferator-activated receptors
To study the effects of ACBP overexpression on regulators of metabolic responses, mRNA levels of
transcription factors PPAR , and were measured in liver and adipose tissue of tg and sg animals in
different metabolic states: fed and fasted state and after feeding high fat diets with MC or LC fatty acids
for four weeks. In fed tg animals, expression of liver PPAR and PPAR mRNA was down-regulated by
82% and 62% respectively compared to sg littermates (Paper II, Fig.4), whereas there was no significant
difference in PPAR mRNA levels. In adipose tissue, there was a decrease in PPARγ by 23% and by
43% in PPARδ levels (Paper II, Fig.4).
In contrast, fasting significantly increased the expression of all liver PPARs by 2 to 7 times in tg rats
(Paper II, Fig.4a), while in sg rats there was simply a trend to higher expression of PPAR , but there
was no change in the PPARγ and δ levels. In adipose tissue, PPAR levels were reduced by 70% in
fasted syngenic rats, while expression was increased by 37% in the tg littermates. The expression of
55
PPAR was significantly increased (3.3 times) by fasting in tg rats, but remained unchanged in the sg
controls (Paper II, Fig.4b). Fasting abolished the difference in liver PPARγ and δ expression levels
between tg and sg animals. On the contrary, in adipose tissue, fasting evoked higher PPAR γ and δ
expression in tg animals when compared to their sg controls.
Furthermore, dietary factors can influence the PPAR expression. Expression of liver PPARα or PPARγ
in sg animals did not change under the MC compared to the LC diet, but liver PPARδ levels were
increased in MC diet fed sg rats compared to the LC diet (Paper III, Fig.3). The tg rats fed with the MC
diet had decreased expression levels of liver PPARα and PPARγ when compared to the LC diet fed
animals and no change in PPARδ. Tg animals fed with the LC diet had 2 to 3 times higher levels of liver
PPAR mRNA expression than their sg littermates fed with the same diet. In the MC diet group, tg rats
had significantly reduced (by 43%) levels of liver PPARγ when compared to sg controls. In adipose
tissue, there were no significant changes in PPARγ or PPARδ expression between MC and LC diet fed tg
or sg animals. The MC diet fed tg rats displayed significantly increased (by 31%) levels of PPARγ
compared to the sg animals fed with the same diet (Paper III, Fig.3).
5.5.2 Sterol regulatory element-binding proteins
Another metabolic regulator known to be involved in ACBP and PPAR regulation is SREBP (Fajas et
al., 1999; Neess et al., 2006; Swinnen et al., 1998). The effects of ACBP overexpression on SREBP-1
mRNA was measured from liver and adipose tissue. Expression of SREBP-1 mRNA was down-regulated
by 77% in liver and by 23% in adipose tissue (Paper II, Fig.5). In sg rats, fasting reduced the SREBP-1
mRNA levels in both liver and adipose tissue. In tg animals, fasting reduced SREBP-1 mRNA levels
only moderately and only in liver (Paper II, Fig.5).
The differences in SREBP expression were also investigated in response to the diets with the sg and tg
animals having a lower liver SREBP-1 expression when fed with the MC diet compared to the LC diet.
The tg rats fed with the MC diet exhibited decreased levels (by 35%) of liver SREBP-1 compared to sg
controls. On the contrary, after the LC diet tg rats had 1.5 times higher SREBP-1 levels compared to
their sg littermates (Paper III, Fig.3). In adipose tissue, both sg and tg animals had similar levels of
SREBP-1 expression when on the MC diet. Tg animals fed the LC diet had increased SREBP-1 levels
when compared to sg controls (Paper III, Fig.3), in sg rats, SREBP-1 expression was unchanged.
5.5.3 AMP-activated protein kinase
SREBP-1 and PPARs have been demonstrated to be regulated by AMP-activated protein kinase (AMPK)
(Leff, 2003; Zhou et al., 2001). Therefore, we determined protein levels of the subunit of AMPK in the
liver of fed rats. The levels of total AMPKα and its active form, Thr 172 phosphorylated AMPKα, were
significantly elevated in the liver tissue of tg rats (Paper II, Fig.6). Furthermore, intraperitoneal
56
Table 4. Summary of the effects of nutritional state and ACBP on PPAR and SREBP-1
mRNA expression and AMPK protein levels.
tg compared to
sg in fed state
tg compared to
sg in fasted state
fasted compared
to fed in sg
fasted compared
to fed in tg
Liver
PPAR no change no change no change +
PPAR - no change no change +
PPAR - no change no change +
SREBP-1 - no change - -
AMPK +
Adipose tissue
PPAR - + - +
PPAR - + no change +
SREBP-1 - no change - no change
+ up-regulation, - down-regulation
Table 5. Summary of the effects of high fat diets and ACBP on PPAR and SREBP-1
mRNA levels and AMPK protein levels.
MC compared
to LC in sg
MC compared
to LC in tg
tg compared to
sg in MC
tg compared to
sg in LC
Liver
PPARα no change - no change +
PPARγ no change - - +
PPARδ + no change no change +
SREBP-1 - - - +
AMPK no change -
Adipose tissue
PPARγ no change no change + no change
PPARδ no change no change no change no change
SREBP-1 no change no change no change +
+: up-regulation, -: down-regulation,
MC: medium chain high fat diet, LC: long chain high fat diet
57
injectionsof the AMPK inhibitor, compound C, to tg rats resulted in 17% reduction in protein levels of
Thr 172 phosphorylated AMPKα (Paper II, Fig.7a), while quantitative real-time PCR analysis of
SREBP-1 and PPARs detected a 2.2 fold increase in SREBP-1 mRNA expression in compound C treated
tg animals with no difference in PPARγ nor PPARδ mRNA levels (Paper II, Fig.7b).
The effect of the two high fat diets on the AMPK levels was also investigated. There was no difference
in AMPK protein levels between MC and LC diet fed animals. In the LC diet fed group, tg animals had
48% lower (p=0.02) protein levels of AMPKα than their sg littermates (Paper III, Fig.4).
5.5.4 Gene expression in the hypothalamus
The changes in mRNA expression of several transcription factors known to be involved in hypothalamic
or peripheral regulation of fatty acid metabolism and two key enzymes participating in hypothalamic
fatty acid induced food intake regulation were measured from fed and fasted animals. In the fed state, the
tg rats had a reduction in the expression levels of FAS (Paper IV, Fig.3), sirtuin-1 (SIRT-1) and PPARδ
(Paper IV, Fig.4) when compared to sg controls. In addition, the tg animals had an increase in the mRNA
levels of CPT-1c (Paper IV, Fig.3). Fasting increased the SIRT-1 expression of the tg rats, while it did
not influence the expression of the sg animals nor alter the expression of PPARδ, FAS or CPT-1c of the
tg animals. On the contrary, the sg rats displayed decreased FAS levels and increased CPT-1c expression
after fasting, but no change in PPARδ expression. There were no difference in the expression of SREBP-
1 between tg and sg animals in either the fed or fasted state, both tg and sg rats showed a fasting induced
reduction in SREBP-1 levels (Paper IV, Fig. 4).
5.5.5 AMP-activated protein kinase in the hypothalamus
The possible role of AMPK, a known regulator of hypothalamic food intake, was investigated. The
protein levels of both total AMPKα and the active form, Thr 172 phosphorylated AMPKα were
measured from hypothalamus of fed tg rats and sg littermates. There were no significant differences in
the total AMPKα or the phosphorylated AMPK levels between tg and sg animals (Paper IV, Fig.5).
58
6. DISCUSSION
6.1 ACBP gene and animal models
Acyl-CoA binding protein (ACBP) / diazepam binding protein (DBI) is a 10 kDa protein ubiquitously
expressed throughout the whole body. Many different functions have been associated with this protein.
ACBP can displace diazepam from type A γ-aminobutyrate receptors (GABAA receptors) (Guidotti et al.,
1983) and modify the function of peripheral benzodiazepine receptors (PBR) (Bovolin et al., 1990;
Garnier et al., 1993; Papadopoulos et al., 1992). In addition to its effects on the benzodiazepine
receptors, the ability to bind and act as a pool former and transporter of acyl-CoAs is one of the best
recognized functions of ACBP (Rasmussen et al., 1990; Rosendal et al., 1993). Although there are a
plethora of reported effects, the precise function of ACBP in the physiology of mammalians remains
unclear. Previous studies have been conducted mainly with cells, or they have utilized exogenous
administration of the protein to investigate the short term effects of ACBP. Huang et. al. (2005) utilized
transgenic mice overexpressing ACBP focusing only on changes in the liver fatty acid composition of
these mice. Importantly ACBP cDNA expression was controlled by a phosphoglycerate kinase promoter,
which does not allow endogenous regulation of ACBP (Huang et al., 2005). Therefore we were
interested to investigate the role of ACBP in rodent physiology and regulation gene expression. We
utilized a construct containing the entire mouse ACBP gene under the gene’s own 1.8 kb promoter
region to allow endogenous expression of the transgene.
We isolated the mouse ACBP/DBI gene from a genomic library of mouse strain 129/SvJ and utilized the
isolated gene to create mouse and rat lines with constant overexpression of ACBP. The isolated mouse
ACBP gene (AF220221) consisted of a 1.8 kb promoter, 4 exon regions including the recently found
alternative exon 1 (Nitz et al., 2005) and a 1.9 kb flanking region. No differences to the published cDNA
sequences could be detected. Furthermore, the isolated gene contained all of the so far published
regulatory regions of the mouse ACBP gene. The isolated mouse ACBP gene allowed us to create a
mouse line expressing high levels of native ACBP. The mouse ACBP gene was additionally utilized to
create a rat line with high levels of ACBP. The mouse and rat ACBP protein sequences are 98.8% similar
and reports on the regulation of ACBP gene transcription regulation have found no major differences
(Helledie et al., 2002a). The basic characterization of both mouse and rats lines demonstrated that the
transgene was overexpressed in all tissues studied. In the central nervous system of mice, the transgene
was found to be expressed in the same locations as previously reported for the endogenous protein (Costa
and Guidotti, 1991; Yanase et al., 2001) The mouse ACBP gene was also functional in rats, since
elevated levels of mouse ACBP increased the acyl-CoA pool of tg rats. Both transgenic mouse and rat
lines were viable and fertile. We utilized a rat line overexpressing ACBP as rats are more easily
subjected to surgical manipulation and tissue preparation. In addition, the genetic background of the
59
mouse line utilized (F1 cross of Balb/c x DBA/2) was unsuitable for the intended metabolic studies,
resulting most likely from the fact that high metabolic rate of DBA/2 strain (Pennycuik, 1967) was
randomly mixed within the metabolic background of Balb/c strain.
6.2 ACBP in central nervous system
Our results from a mouse line overexpressing the mouse ACBP gene clearly demonstrate that long-term
elevation of ACBP levels does not cause anxiety or any pro-conflict behaviour, in contrast to published
data (Guidotti, 1991). Previous studies have investigated mainly the short term effects of ACBP and its
processing products (Kavaliers and Hirst, 1986), while in our animals, the expression levels were
chronically elevated. Since acute administration of ACBP has been suggested to have a modulatory
effect on the GABAA receptors and PBRs, it is logical that the long term endogenous expression of
ACBP would recruit adoptive processes. GABAA receptor signalling is important for neural signalling
and therefore its function is under tight regulation. Results from the experiments on benzodiazepine
stimulation of peripheral benzodiazepine receptors (PBR) provide further evidence for compensation of
the long-term effects. These studies indicate that the acute and chronic effects of PBR ligands are quite
different. Acute administration of PBR ligands evoked increased steroid levels in both rats and humans,
whereas chronic treatment with PBR ligands did not affect circulating steroid levels of female rats
(Lacapere and Papadopoulos, 2003). One possible mechanism to adapt to the chronic effects of ACBP is
down-regulation of SREBP-1. SREBP-1 up-regulates the expression of steroidogenic acute regulatory
protein (StAR), a protein involved in cholesterol transport to PBR (Lacapere and Papadopoulos, 2003).
This indicates that although increased ACBP levels activated PBR it also caused a down-regulation of
StAR levels, resulting in reduced cholesterol transport to PBR. In agreement, in our transgenic animals
there were no changes in the plasma levels of cholesterol. Interestingly, we detected a reduction only in
the liver and adipose tissue SREBP-1 mRNA levels, but not in the hypothalamus, yet this does not rule
out the possibility that SREBP-1 could be affected in other brain regions. To further investigate the role
of ACBP in neural signalling, we performed seizure threshold experiments with KA and PTZ. There was
no difference in the KA induced seizures between tg and sg controls in the number, severity or duration
of the seizures and the administration of KA did not evoke any changes between tg and sg mice in the
histology preparations performed after the seizures. In the CNS, KA activates kainate receptors, which
have been shown to down-regulate GABAergic inhibition (Clarke et al., 1997; Michaelis, 1998). Due to
the similarities in the seizure behaviour and pathology evoked by KA and epilepsy, this compound has
been utilized as a model of temporal lobe epilepsy. Our results indicate that either ACBP does not
influence the mechanism by which KA induces seizures or the continually elevated levels can activate
compensatory mechanisms that abolish the effects of ACBP. Elevated plasma ACBP levels have been
detected from a subgroup of patients suffering from epilepsy (Ferrarese et al., 1998). Chronic
overexpression of ACBP by itself or with KA did not evoke any differences in the seizure activity,
indicating that ACBP has a modulatory role. Furthermore, i.c.v injections of PTZ is another well-
60
established seizure model. The actions of PTZ are mediated by its antagonistic action on the GABAA
receptors. Similar results were obtained with the PTZ injections as seen in the KA studies, i.e.
overexpression of ACBP did not affect the seizures. In contrast to the KA results, there was a difference
in the PTZ induced mortality, sg animals had even a higher mortality (37%) than the tg mice (0%).
Similar results have been reported by Garcia de Mateos-Verchere et al. (1999), i.c.v administration of
ODN (100 ng for mice) prior to PTZ (100 mg/kg, i.p.) injections reduced the mortality by 30%. These
results suggest that ODN/ACBP influence the function of GABAA receptors in a way that reduces the
ability of PTZ to block Ca2+
channels, but do not prevent it completely. The mechanism by which ACBP
reduces mortality requires further investigation on the role of ACBP in GABAA receptor and PBR
regulation.
Behavioural and learning aspects of ACBP overexpressing mouse were studied in behaviour tests and
long-term potentiation (LTP). Our results from LTP experiments show that elevated levels of ACBP
could affect the development of long-term synaptic plasticity in the CA1 area of hippocampus. The tg
mouse exhibited decreased plasticity in the excitatory synapses without any changes in the inhibitory or
excitatory synaptic transmission. ACBP has been reported to have an inhibitory effect on the GABAA
receptors (Costa and Guidotti, 1991), therefore overexpression of ACBP should increase rather than
decrease the excitatory response. The molecular reasons for these unexpected findings are unclear and
require further investigations. The observed decrease in LTP might be due a reduction in NMDA
receptor activity. The excitatory response in LTP is known to be dependent on the activation of NMDA
receptors (Larson and Lynch, 1988) and NMDA receptor activation can increase the ACBP mRNA
expression in cerebral cortical neurons (Katsura et al., 2001). Behaviour tests confirmed that high
expression levels of ACBP did not affect the basic behavioural pattern of the animals. Nevertheless,
changes in the LTP were projected on the animals, tg mice had reduced freezing in the conditioning
context. These results indicated that ACBP overexpression influences the hippocampus-dependent
learning and memory.
In addition, we detected that the overexpression of ACBP lead to enlargement of the lateral ventricles.
This phenomenon was evident at birth and in both transgenic mice and rats, indicating that it is specific
effect of ACBP overexpression. One possible explanation might be perivascular astrocytosis. This
process has been shown to be the cause of hydrocephalus in other models (Crews et al., 2004) and in
addition Alzheimer type II astrocytosis has been associated with increased levels of ACBP (Butterworth
et al., 1991). The precise influences and the development method of these enlarged lateral ventricles will
require further investigation, as well as the possible role of ACBP in the pathology of Alzheimer’s
disease.
61
6.3 ACBP and hypothalamic regulation of food intake
Hypothalamus and particularly the arcuate nucleus in the hypothalamus are considered to be one of the
main sites for regulation of energy homeostasis and food intake. The involvement of nutrients and
especially the role of fatty acids in the hypothalamic regulation of food intake have attracted considerable
attention. Recent studies have shown that fatty acids or more specifically their esters, acyl-CoAs are
involved in appetite regulation (Lam et al., 2005a; Obici et al., 2002). The hypothalamic pool of acyl-
CoA can be formed either from fatty acid entering the cells or by endogenous synthesis. Peripheral
administration of long chain fatty acids elevated the hypothalamic long chain acyl-CoA pool size (Lam
et al., 2005a). In addition, all of the components required for the intracellular synthesis and oxidation of
acyl-CoAs are expressed in neurons at a relatively high level. Some of the main components of the acyl-
CoA synthesis or oxidation, including FAS, CPT-1 and AMPK have been associated with regulation of
food intake in the hypothalamus (Lam et al., 2005b). Interestingly, the functions of all three enzymes are
closely link to each other, they all are involved in acyl-CoA pool size regulation. Although fatty acids,
especially acyl-CoAs, are associated with hypothalamic regulation of food intake, little is known about
the role of proteins that bind acyl-CoAs, namely fatty acid binding proteins (FABPs) and ACBP. The
hypothalamic levels of ACBP have been found to be among the highest in central nervous system, and
ACBP expression in hypothalamus is concentrated in the nerve terminals of the arcuate nucleus and
median eminence (Alho et al., 1985; Alho et al., 1988). In addition, previous studies utilizing the
processing product ODN have indicated that it is involved in the regulation of food intake in a receptor
mediated manner. Furthermore, i.c.v injection of ODN has been shown to reduce food intake in rodents.
The action of ODN was found to be mediated through metabotropic receptors positively coupled to
phospholipase C via a pertussis toxin-sensitive G protein (de Mateos-Verchere et al., 2001; do Rego et
al., 2007). Furthermore, Compere et al. (2006) has suggested that ACBP might be involved in appetite
control caused by androgens. This study demonstrated that androgens and glugocorticoids up-regulated
the ACBP mRNA expression in hypothalamus of male mice.
Although these previous results indicate that ACBP might play a role in the regulation of food intake our
results from ACBP transgenic rats demonstrated that there was no difference in the daily food intake or
in the weight of the tg and sg animals. In addition, there was no difference in the weight of old rats (1
year old) indicating that there are no differences during the life span of the animals that could become
manifested as an accumulatory difference in weight. These results suggest that long term overexpression
of ACBP does not influence the food intake, but do not exclude the possibility that ACBP can function
as a short term modulator. It is likely that the hypothalamic acyl-CoA pool is under tight regulation that
does not allow drastic changes. In accordance, further investigation of our ACBP overexpressing rat line
demonstrated that there were only slight changes in the brain acyl-CoA pool. Fed tg animals had
increased levels of C20:4 and the fasted tg rats had decreased levels of C20:0. Huang et. al. (2005)
reported that in liver, ACBP can influence the acyl-CoA pool size in terms of chain length and saturation
62
dependent manner. This was suggested to be caused by variation in ACBPs ability to bind different acyl-
CoAs forms and changes in the activity of acyl-CoA utilizing enzymes. Our transgenic rats had
significant changes in the hypothalamic gene expression pattern: The mRNA levels of two known
regulators food intake and acyl-CoA pool were differentially expressed in tg and sg rats. The expression
of FAS was reduced and the levels of CPT-1c were elevated in the fed tg animals. The reduction of FAS
results into decreased acyl-CoA production and increased accumulation of malonyl-CoA, an important
inhibitor of CPT-1. Decrease in function and expression levels of FAS are associated with a reduction in
food intake (Lopez et al., 2006; Shimokawa et al., 2002). On the contrary, increased CPT-1c levels have
been associated with increased food intake (Obici et al., 2003; Wolfgang et al., 2006). Elevated CPT-1c
levels do not influence the acyl-CoA pool considerably, since the protein is unable to transport the acyl-
CoAs into mitochondria (Wolfgang et al., 2006). Nevertheless, CPT-1c is able to bind malonyl-CoA and
affects the food intake and weight control. Wolfgang et al. (2008) have shown that mouse line with
knock-out of CTP-1c exhibit decreased food intake and lower body weight, without any changes in the
gene expression or in the malonyl-CoA and acyl-CoA levels. The exact role of CPT-1c in the appetite
control remains unclear. Wolfgang et al. (2008) suggest that CPT-1c has rather a regulatory than a
metabolic role, as the malonyl-CoA and acyl-CoA levels remained constant, yet a metabolic role cannot
be excluded since acyl-CoA levels were measured from hippocampus, not hypothalamus (Wolfgang et
al., 2008). Therefore, in hypothalamus CPT-1c might be able to release the other hypothalamic forms of
CPT-1 (namely CPT-1a) from inhibition caused by malonyl-CoA. The decrease in FAS expression and
increase of CPT-1c expression might provide a possible mechanism for the unchanged food intake of the
tg animals. To further investigate these changes we measured the mRNA levels of transcription factors
are involved as well as the protein levels of AMPK. Our fed tg animals had reduced levels of PPAR and
SIRT-1 mRNA in the hypothalamus. There was no previous data on the actions of these transcription
factors in the food intake regulation. In peripheral tissues, it seems that PPAR is involved in the
regulation of FAS in liver and the liver and muscle isoforms of CPT-1 in muscle tissue (Barish et al.,
2006; Lee et al., 2006). These previous data combined with our results suggest that PPAR is involved in
FAS regulation also in hypothalamus. PPAR up-regulates FAS (Lee et al., 2006), hence a reduction
PPAR levels may contribute to the observed reduction in hypothalamic FAS levels. The increased CPT-
1c levels cannot be explained by the reduced PPAR levels, but one possible mechanism might be the
reduced levels of SIRT-1, a transcription factor involved in glucose metabolism. SIRT-1 has been shown
to regulate peripheral forkhead box O1 (FOXO1) transcription factor, which in turn increases food intake
in rodents (Nakae et al., 2008; Yang et al., 2006). Our results from the ACBP overexpressing rats
demonstrate that constantly high levels of ACBP do not affect the food intake. The tight regulation of
hypothalamic acyl-CoA pool size evoked changes in the gene expression profile that may provide a
possible preventive mechanism. Based on our results, we cannot rule out a short term modulatory effect
of ACBP. The results on the actions of ODN injections point to this possibility, acute administration
63
reduced food intake of mice and rats but over the long term, the effects were diminished (de Mateos-
Verchere et al., 2001).
6.4 ACBP and physiology of rats
We utilized our rat line overexpressing mouse ACBP to study the physiological effects of constantly
high levels of ACBP. In accordance with previous results from yeast, cell lines and mouse liver (Huang
et al., 2005; Knudsen et al., 1994; Yang et al., 2001) we observed increased acyl-CoA levels in liver and
in addition in adipose tissue of our tg rats. Our results clearly demonstrate that the increased levels of
ACBP influenced the acyl-CoA pool in a specific manner. The variation in ACBPs binding affinity
toward different acyl-CoA forms and the ability to enhance further utilization of different acyl-CoA
forms can, in part, explain the selective nature of the acyl-CoA increase (Faergeman et al., 1996; Huang
et al., 2005; Jolly et al., 2000). In addition, our results show that the effects of ACBP on the acyl-CoA
pool were dependent on the nutritional state (fed/fasted) of the animals and on the tissue studied.
Previous studies have shown that fasting can influence the intracellular acyl-CoA pool (Woldegiorgis et
al., 1985) and the differential metabolic usage of fatty acids and acyl-CoAs in different tissues may be
another explanation for our results. On the contrary to the acyl-CoAs, we did not observe any changes in
the serum free fatty acid levels or in the plasma triglyceride or cholesterol levels. Huang et al. (2005)
reported that mice overexpressing ACBP under the control of a phosphoglycerate kinase promoter had
increased liver triglycerides and phospholipids while the cholesterol levels were unchanged, but these
tissue levels are not comparable with circulating levels. Furthermore, high ACBP levels in combination
with either MC or LC diets did not induce any changes in the serum free fatty acid levels between tg and
sg rats.
Acyl-CoAs and ACBP have been claimed to be involved in insulin secretion, ACBP is believed to inhibit
glucose stimulated insulin release and acyl-CoAs can influence several key players of signal transduction
in β-cells (Corkey et al., 2000; Ostenson et al., 1990). Nonetheless, we did not detect any differences in
the GTT or in the insulin levels during the test between normally fed sg and tg rats. In accordance, it has
been shown that ACBP mainly affected the acute phase of glucose stimulated insulin release and that in
long term experiments, it had only limited effects (Ostenson et al., 1994; Sjoholm et al., 1991). On the
contrary, when the tg rats were challenged with a MC diet we found that high levels of ACBP improved
the glucose tolerance, tg rats displayed lower blood glucose in combination with reduced insulin levels.
When the animals were challenged with a LC diet, no differences between tg rats and the controls were
observed. Our results indicate that in animals fed with standard rodent diet or LC diet overexpression of
ACBP either did not influence the glucose tolerance or its actions were prevented. On the other hand, our
results also indicated that ACBP might play a role in the improved insulin sensitivity observed in the
medium chain high fat diet versus long chain high fat diet fed animals (Han et al., 2003; Takeuchi et al.,
2006), i.e. high levels of ACBP appears to have a beneficial role in the MC diet fed rats. The MC and LC
64
high fat diets utilized in our study were specially designed to have low energy content allowing the
investigation chain length specific effects of fatty acids, therefore our results and results obtained by Han
et al. (2003) and Takeuchi et al. are not directly comparable. The mechanisms preventing changes in
GTT of standard diet and LC diet fed tg rats and the ACBP induced changes that might improve glucose
tolerance in the MC diet fed animals were further characterized by determining the effects of ACBP on
gene expression regulation.
6.5 ACBP and regulation of gene expression
The effect of constant ACBP overexpression on the mRNA levels of transcription factors regulating lipid
and glucose metabolism were measured from liver and adipose tissue of rats. In addition, the effects of
nutrition state (fed/fasted) and diets (MC and LC high fat diets) were investigated. Furthermore, a protein
levels of AMPK, a well-known regulator of cellular metabolism, was determined from the livers of the
animals fed with either standard diet or high fat diets with either MC or LC fatty acids.
6.5.1 PPARs
ACBP had the least effect on PPAR . Only in the LC diet fed animals there was a difference between tg
and sg animals in the expression levels of PPAR , with tg rats having significantly elevated levels
compared to sg littermates. In contrast to PPAR , ACBP seems to affect the mRNA expression of the
other isoforms of the PPAR transcription factor family. Accordingly, previous studies have shown that
ACBP is able to inhibit the trans-activation of PPARs at the protein level (Helledie et al., 2000; Helledie
et al., 2002b). In the fed state, the tg rats displayed reduced levels of PPAR and PPAR in both liver and
adipose tissue. The reduction of the fed state expression of PPAR and PPAR points to increased
accumulation of fatty acids, as PPAR is known to stimulate lipid storage in adipose tissue and PPAR is
involved in fatty acid oxidation. Accordingly, our tg animals exhibited increased acyl-CoA levels.
Fasting influenced the animal’s response to ACBP, it abolished the differences in PPAR and PPAR
expression levels in the liver and in adipose tissue it evoked increased expression in tg rats. It seems that
the regulatory elements activated by fasting are a stronger stimulus for PPAR and PPAR transcription
than ACBP, or the consequences of increased levels of ACBP are prevented in such a manner that it is
active only in the fasted state. The fact that the acyl-CoA pool of the animals was also affected in a
fed/fasted state dependent manner suggests that acyl-CoAs might underlie the influence of ACBP on
PPARs. It has been shown that acyl-CoAs can affect the activity of PPARs in a chain length specific
manner (Faergeman and Knudsen, 1997; Schroeder et al., 2008). Furthermore, the involvement of other
regulatory factors like AMPK cannot be ruled out. In addition to fasting, both MC and LC diets affected
the ACBP induced regulation of PPAR and PPAR . The LC diet fed tg animals had increased liver
PPAR and PPAR levels, while the MC diet evoked reduced PPAR expression in the liver and
increased expression in adipose tissue of tg rats. Previous studies have indicated that medium and long
65
chain high fat diets can control the expression of PPARs and other transcription factors in different ways
(Han et al., 2003; Takeuchi et al., 2006), although there have been discrepancies in the results obtained.
Han et. al. (2003) reported that medium chain high fat diet fed rats had reduced adipose tissue PPAR
levels compared to long chain high fat diet, while Takeuchi et. al. (2006) detected an increased
expression of PPAR . Our results demonstrate that there were no difference in adipose tissue PPAR
expression between MC and LC diet fed sg animals, while the tg rats had reduced PPAR levels
compared to sg littermates. In addition to chain length specific effects of the fatty acids used (Faergeman
et al., 1996; Huang et al., 2005; Jolly et al., 2000), the fact that our diets energy content is not
comparable with the diets used by Takeuchi et al. (2006) and Han et al. (2003) might explain the
differences in dietary responses. We utilized high fat diets with low energy content (Table 1) to be able
to focus on the effect of fatty acid chain lengt. Our results from LC diet suggest that tg animals exhibited
increased lipid metabolism, as the expression levels of the transcription factors and ACBP were elevated.
Results from the MC diet fed animals demonstrate that the effect of ACBP on the PPAR mRNA levels
might be responsible for the improved glucose tolerance of MC diet fed tg rats. The down-regulation of
liver PPAR levels leads to decreased liver lipid accumulation, which is accompanied by elevated lipid
storage in adipose tissue resulting from increased PPAR expression.
6.5.2 SREBP-1
SREBP-1 is another transcription factor known to be involved in the regulation of both ACBP and
PPARs (Fajas et al., 1999; Neess et al., 2006; Swinnen et al., 1998). In fed animals, overexpression of
ACBP resulted in decreased levels of liver and adipose tissue SREBP-1 mRNA. Fasting abolished the
difference between tg and sg animals in both of the tissues studied. These results are in accordance with
the results obtained from PPAR and PPAR . Changes in the intracellular acyl-CoA contents might be
responsible for the decreased SREBP-1 levels as unsaturated fatty acids can reduce SREBP-1 mRNA
levels (Jump et al., 2005). The involvement of additional regulatory factors cannot be ruled out, for
example liver X receptor (LXR) , a known regulator of SREBP-1, which has been reported to act in a
nutritional state dependent manner (Eberle et al., 2004). SREBP-1 expression was elevated in the LC diet
fed and decreased in the liver of MC diet fed tg rats. In contrast to the effect of the diets on PPAR
expression, also the adipose tissues expression of SREBP-1 was increased in the tg rats fed with the LC
diet.
6.5.3 AMPK
The protein levels of the catalytic subunit of AMPK were determined to further investigate how ACBP
can influence the regulation of transcription factors. AMPK is known to be involved in the
phosphorylation mediated regulation of both PPARs and SREBP-1 (Leff, 2003; Zhou et al., 2001). The
fed tg rats had elevated levels of both total AMPK and the active, Thr 172 phophorylated, form in their
66
livers. In addition, we detected that in the liver of LC diet fed rats, overexpression of ACBP decreased
the levels of total AMPK . These changes in the AMPK levels are in accordance with the observed
changes in the expression levels of PPARs and SREBP-1, indicating that the regulatory effects of ACBP
might be mediated through AMPK. To further investigate this possibility, we utilized intraperitoneal
injections of a specific inhibitor of AMPK (compound C). The results demonstrated that injections of
compound C significantly elevated the mRNA levels of SREBP-1 in fed tg animals, while there was no
change in the expression levels of PPARs. This indicates that regulation of SREBP-1 is mediated through
AMPK, while the effects of ACBP on PPARs are independent of the AMPK activity. Further support for
a role for AMPK in the effects of ACBP on SREBP-1 expression was obtained in hypothalamus where
there were no differences in the AMPK levels between tg and sg animals. In accordance, also SREBP-1
mRNA expression remained unchanged. Our results also reveal that the acyl-CoA form of palmitate
(C16:0) was elevated in both liver and adipose tissue of tg animals, increased levels of palmitate have
been shown to activate AMPK (Wang et al., 2007; Watt et al., 2006). In addition, the C16:0 levels are
normally elevated by fasting, providing a possible explanation for the nutritional state specific effects. In
the brain tissue, there were no changes in the AMPK levels and the overexpression of ACBP did not
influence the C16:0 pool size. This suggests that the elevated acyl-CoA levels of ACBP overexpressing
animals affect SREBP-1 expression through an increased activity of AMPK.
67
7. SUMMARY
The principal aim of this study was to investigate the physiological role of acyl-CoA binding protein
(ACBP) / diazepam binding protein (DBI) in two rodent models. ACBP has been associated with various
functions, some of which are proposed to be mediated mainly through processing products of the native
protein. Therefore, we have utilized a construct that allows endogenous regulation of the gene and
natural processing of the ACBP protein. The following results were obtained.
I The mouse ACBP gene was isolated and characterized. There were no observed differences in the
coding sequence of the construct and it contained all the regulatory regions published so far. The
continually elevated levels of ACBP resulted in enlargement of the lateral ventricles both in mice and
rats. In addition, in mice, ACBP overexpression resulted in decreased plasticity of excitatory synapses
and impairment of the hippocampus-dependent form of learning and memory. In contrast to previous
results, our animals did not show any signs of anxiety or pro-conflict behaviour nor did we find any
influence on the kainate or pentylenetetrazole induced seizure activity in the transgenic mice.
II In metabolic phenotyping, our rat line overexpressing the mouse ACBP gene under the genes own
promoter region was utilized. The transgenic rats had a significantly increased acyl-CoA pool both in
liver and adipose tissue. Changes in the acyl-CoA pool were found to be tissue and acyl-CoA form
specific. In addition, the ACBP induced changes were dependent on the nutritional state of the animals.
On the contrary, there were no changes in the serum free fatty acid or plasma triglyceride and cholesterol
levels and also the glucose tolerance of the transgenic animals remained unchanged. Although the
physiological effects of ACBP were limited, the overexpression caused marked changes in the regulation
of gene expression. Peroxisome proliferator activated receptors (PPARγ, PPARδ) and sterol regulatory
element-binding protein-1 (SREBP-1) mRNA levels were significantly reduced (by 23–82%) in liver and
adipose tissue of fed transgenic rats. In addition, adenosine monophosphate-activated protein kinase
(AMPK) protein levels were increased (by 60%). These changes were dependent on the nutritional state
of the animals, fasting abolished the reduction of PPARs and SREBP-1 in the liver, while evoking up-
regulation of PPARs in adipose tissue. Our results indicate that the reduction of SREBP-1 seems to be
mediated through AMPK, whereas the regulation of PPARs is AMPK independent. These results
demonstrate an important feedback loop; ACBP expression is regulated by both PPARs and SREBP-1.
III To investigate further the role of ACBP in the physiology and regulation of gene expression, we
challenged our ACBP overexpressing rat line with two high fat diets enriched with either medium or
long chain fatty acids for four weeks. Transgenic animals fed with the medium chain diet had improved
glucose tolerance and lower serum insulin levels compared to controls. In addition, their liver PPAR (by
43%) and SREBP-1 (by 35%) mRNA levels were reduced, while the adipose tissue PPAR levels were
68
increased by 37%, pointing to a possible mechanism by which ACBP may improve glucose tolerance.
The LC diet fed transgenic rats exhibited no differences in the glucose or insulin levels compared to
controls, but they had increased levels of liver PPARs and SREBP-1 (1.5-3.5 times higher) and
decreased protein levels of AMPK (by 48%). This can suggest that the LC diet increased the overall
lipid metabolism of the transgenic rats.
IV It has been shown that the hypothalamic regulation of food intake is influenced by fatty acids,
especially their intracellular active forms, acyl-CoAs. Since there was no previous data on the effects of
fatty acid / acyl-CoA binding proteins on these processes, we examined whether constant overexpression
of ACBP could influence the hypothalamic regulation of food intake and gene expression. Our results
indicated that ACBP did not influence the food intake or the weight of the animals. Further
investigations revealed that fed tg rats had significant changes in their gene expression profile: mRNA
levels of FAS were reduced while the levels of CPT-1c were increased. Both of these proteins have been
previously shown to play important roles in the regulation of food intake. In addition, mRNA levels of
transcription factors and protein levels of AMPK were measured. Fed transgenic rats displayed no
differences in the AMPK protein levels or SREBP-1 mRNA expression, but had reduced levels of
PPAR and SIRT-1, indicative of a possible regulatory mechanism behind the observed changes in the
FAS and CPT-1c expression and revealing possible further regulatory targets of ACBP induced gene
expression in hypothalamus.
69
8. REFERENCES
Abo-Hashema, K.A., Cake, M.H., Lukas, M.A. and Knudsen, J. (2001) The interaction of acyl-CoA with
acyl-CoA binding protein and carnitine palmitoyltransferase I. Int J Biochem Cell Biol 33, 807-815.
Ahmed, W., Ziouzenkova, O., Brown, J., Devchand, P., Francis, S., Kadakia, M., Kanda, T., Orasanu,
G., Sharlach, M., Zandbergen, F., et al. (2007) PPARs and their metabolic modulation: New mechanisms
for transcriptional regulation? J Intern Med 262, 184-198.
Alho, H., Kolmer, M., Harjuntausta, T. and Helen, P. (1995) Increased expression of diazepam binding
inhibitor in human brain tumors. Cell Growth Differ 6, 309-314.
Alho, H., Fremeau, R.T., Tiedge, H., Wilcox, J., Bovolin, P., Brosius, J., Roberts, J.L. and Costa, E.
(1988) Diazepam binding inhibitor gene expression: Location in brain and peripheral tissues of rat. Proc
Natl Acad Sci U S A 85, 7018-7022.
Alho, H., Costa, E., Ferrero, P., Fujimoto, M., Cosenza-Murphy, D. and Guidotti, A. (1985) Diazepam-
binding inhibitor: A neuropeptide located in selected neuronal populations of rat brain. Science 229, 179-
182.
Andersen, K.V., Ludvigsen, S., Mandrup, S., Knudsen, J. and Poulsen, F.M. (1991) The secondary
structure in solution of acyl-coenzyme A binding protein from bovine liver using 1H nuclear magnetic
resonance spectroscopy. Biochemistry 30, 10654-10663.
Ball, J.A., Ghatei, M.A., Sekiya, K., Krausz, T. and Bloom, S.R. (1989) Diazepam binding inhibitor-like
immunoreactivity (51-70): Distribution in human brain, spinal cord and peripheral tissues. Brain Res
479, 300-305.
Barbaccia, M.L., Berkovich, A., Guarneri, P. and Slobodyansky, E. (1990) DBI (diazepam binding
inhibitor): The precursor of a family of endogenous modulators of GABAA receptor function. History,
perspectives, and clinical implications. Neurochem Research 15, 161-168.
Barbaccia, M.L., Costa, E. and Guidotti, A. (1988) Endogenous ligands for high-affinity recognition sites
of psychotropic drugs. Annu Rev Pharmacol Toxicol 28, 451-476.
Barbaccia, M.L., Costa, E., Ferrero, P., Guidotti, A., Roy, A., Sunderland, T., Pickar, D., Paul, S.M. and
Goodwin, F.K. (1986) Diazepam-binding inhibitor. A brain neuropeptide present in human spinal fluid:
Studies in depression, Schizophrenia, and Alzheimer's disease. Arch Gen Psychiatry 43, 1143-1147.
Barish, G.D., Narkar, V.A. and Evans, R.M. (2006) PPAR delta: A dagger in the heart of the metabolic
syndrome. J Clin Invest 116, 590-597.
Bengoechea-Alonso, M.T. and Ericsson, J. (2007) SREBP in signal transduction: Cholesterol
metabolism and beyond. Curr Opin Cell Biol 19, 215-222.
Berkovich, A., McPhie, P., Campagnone, M., Guidotti, A. and Hensley, P. (1990) A natural processing
product of rat diazepam binding inhibitor, triakontatetraneuropeptide (diazepam binding inhibitor 17-50)
contains an alpha-helix, which allows discrimination between benzodiazepine binding site subtypes. Mol
Pharmacol 37, 164-172.
Besman, M.J., Yanagibashi, K., Lee, T.D., Kawamura, M., Hall, P.F. and Shively, J.E. (1989)
Identification of des-(gly-ile)-endozepine as an effector of corticotropin-dependent adrenal
steroidogenesis: Stimulation of cholesterol delivery is mediated by the peripheral benzodiazepine
receptor. Proc Natl Acad Sci U S A 86, 4897-4901.
Bhuiyan, J., Pritchard, P.H., Pande, S.V. and Seccombe, D.W. (1995) Effects of high-fat diet and fasting
on levels of acyl-coenzyme A binding protein in liver, kidney, and heart of rat. Metabolism 44, 1185-
1189.
Black, P.N., Faergeman, N.J. and DiRusso, C.C. (2000) Long-chain acyl-CoA-dependent regulation of
gene expression in bacteria, yeast and mammals. J Nutr 130, 305S-309S.
70
Borboni, P., Condorelli, L., De Stefanis, P., Sesti, G. and Lauro, R. (1991) Modulation of insulin
secretion by diazepam binding inhibitor and its processing products. Neuropharmacology 30, 1399-1403.
Bormann, J. (1988) Electrophysiology of GABAA and GABAB receptor subtypes. Trends Neurosci 11,
112-116.
Bormann, J., Ferrero, P., Guidotti, A. and Costa, E. (1985) Neuropeptide modulation of GABA receptor
C1- channels. Regul Pept Suppl 4, 33-38.
Boujrad, N., Hudson, J.R.,Jr and Papadopoulos, V. (1993) Inhibition of hormone-stimulated
steroidogenesis in cultured leydig tumor cells by a cholesterol-linked phosphorothioate
oligodeoxynucleotide antisense to diazepam-binding inhibitor. Proc Natl Acad Sci U S A 90, 5728-5731.
Bovolin, P., Schlichting, J., Miyata, M., Ferrarese, C., Guidotti, A. and Alho, H. (1990) Distribution and
characterization of diazepam binding inhibitor (DBI) in peripheral tissues of rat. Regul Pept 29, 267-281.
Brown, A.S. and Hall, P.F. (1991) Stimulation by endozepine of the side-chain cleavage of cholesterol in
a reconstituted enzyme system. Biochem Biophys Res Commun 180, 609-614.
Burns, K.A. and Vanden Heuvel, J.P. (2007) Modulation of PPAR activity via phosphorylation. Biochim
Biophys Acta 1771, 952-960.
Burton, M., Rose, T.M., Faergeman, N.J. and Knudsen, J. (2005) Evolution of the acyl-CoA binding
protein (ACBP). Biochem J 392, 299-307.
Butterworth, R.F., Tonon, M.C., Desy, L., Giguere, J.F., Vaudry, H. and Pelletier, G. (1991) Increased
brain content of the endogenous benzodiazepine receptor ligand, octadecaneuropeptide (ODN),
following portacaval anastomosis in the rat. Peptides 12, 119-125.
Casellas, P., Galiegue, S. and Basile, A.S. (2002) Peripheral benzodiazepine receptors and mitochondrial
function. Neurochem Int 40, 475-486.
Cervia, D. and Bagnoli, P. (2007) An update on somatostatin receptor signaling in native systems and
new insights on their pathophysiology. Pharmacol Ther 116, 322-341.
Chao, H., Zhou, M., McIntosh, A., Schroeder, F. and Kier, A.B. (2003) ACBP and cholesterol
differentially alter fatty acyl CoA utilization by microsomal ACAT. J Lipid Res 44, 72-83.
Chen, Z.W., Agerberth, B., Gell, K., Andersson, M., Mutt, V., Ostenson, C.G., Efendic, S., Barros-
Soderling, J., Persson, B. and Jornvall, H. (1988) Isolation and characterization of porcine diazepam-
binding inhibitor, a polypeptide not only of cerebral occurrence but also common in intestinal tissues and
with effects on regulation of insulin release. Eur J Biochem 174, 239-245.
Clarke, V.R., Ballyk, B.A., Hoo, K.H., Mandelzys, A., Pellizzari, A., Bath, C.P., Thomas, J., Sharpe,
E.F., Davies, C.H., Ornstein, P.L., et al. (1997) A hippocampal GluR5 kainate receptor regulating
inhibitory synaptic transmission. Nature 389, 599-603.
Compere, V., Quallet, J., Luu-The, V., Dureuil, B., Tonon, M.C., Vaudry, H., Labrie, F. and Pelletier, G.
(2006) Role of androgens and glucocorticoids in the regulation of diazepam-binding inhibitor mRNA
levels in male mouse hypothalamus. Brain Research 1119, 50-57.
Compere, V., Li, S., Leprince, J., Tonon, M.C., Vaudry, H. and Pelletier, G. (2005) In vivo action of a
new octadecaneuropeptide antagonist on neuropeptide Y and corticotropin-releasing hormone mRNA
levels in rat. Brain Res Mol Brain Res 141, 156-160.
Cooper, S.J. (1989) Benzodiazepine receptor-mediated enhancement and inhibition of taste reactivity,
food choice, and intake. Ann N Y Acad Sci 575, 321-36.
Corkey, B.E., Deeney, J.T., Yaney, G.C., Tornheim, K. and Prentki, M. (2000) The role of long-chain
fatty acyl-CoA esters in beta-cell signal transduction. J Nutr 130, 299S-304S.
Costa, E. and Guidotti, A. (1991) Diazepam binding inhibitor (DBI): A peptide with multiple biological
actions. Life Sci 49, 325-344.
71
Crews, L., Wyss-Coray, T. and Masliah, E. (2004) Insights into the pathogenesis of hydrocephalus from
transgenic and experimental animal models. Brain Pathol 14, 312-316.
de Mateos-Verchere, J.G., Leprince, J., Tonon, M.C., Vaudry, H. and Costentin, J. (2001) The
octadecaneuropeptide [diazepam-binding inhibitor (33-50)] exerts potent anorexigenic effects in rodents.
Eur J Pharmacol 414, 225-231.
De Mateos-Verchere, J.G., Leprince, J., Tonon, M.C., Vaudry, H. and Costentin, J. (1998) The
octadecaneuropeptide ODN induces anxiety in rodents: Possible involvement of a shorter biologically
active fragment. Peptides 19, 841-848.
De Stefanis, P., Impagnatiello, F., Berkovich, A. and Guidotti, A. (1995) Inhibitory effect of ODN, a
naturally occurring processing product of diazepam binding inhibitor, on secretagogues-induced insulin
secretion. Regul Pept 56, 153-165.
do Rego, J.C., Orta, M.H., Leprince, J., Tonon, M.C., Vaudry, H. and Costentin, J. (2007)
Pharmacological characterization of the receptor mediating the anorexigenic action of the
octadecaneuropeptide: Evidence for an endozepinergic tone regulating food intake.
Neuropsychopharmacology 32, 1641-1648.
Eberle, D., Hegarty, B., Bossard, P., Ferre, P. and Foufelle, F. (2004) SREBP transcription factors:
Master regulators of lipid homeostasis. Biochimie 86, 839-848.
Elholm, M., Garras, A., Neve, S., Tornehave, D., Lund, T.B., Skorve, J., Flatmark, T., Kristiansen, K.
and Berge, R.K. (2000) Long-chain acyl-CoA esters and acyl-CoA binding protein are present in the
nucleus of rat liver cells. J Lipid Res 41, 538-545.
Espenshade, P.J. (2006) SREBPs: Sterol-regulated transcription factors. J Cell Sci 119, 973-976.
Faergeman, N.J. and Knudsen, J. (2002) Acyl-CoA binding protein is an essential protein in mammalian
cell lines. Biochem J 368, 679-682.
Faergeman, N.J. and Knudsen, J. (1997) Role of long-chain fatty acyl-CoA esters in the regulation of
metabolism and in cell signalling. Biochem J 323, 1-12.
Faergeman, N.J., Sigurskjold, B.W., Kragelund, B.B., Andersen, K.V. and Knudsen, J. (1996)
Thermodynamics of ligand binding to acyl-coenzyme, a binding protein studied by titration calorimetry.
Biochemistry 35, 14118-14126.
Fajas, L., Schoonjans, K., Gelman, L., Kim, J.B., Najib, J., Martin, G., Fruchart, J.C., Briggs, M.,
Spiegelman, B.M. and Auwerx, J. (1999) Regulation of peroxisome proliferator-activated receptor
gamma expression by adipocyte differentiation and determination factor 1/sterol regulatory element
binding protein 1: Implications for adipocyte differentiation and metabolism. Mol Cell Biol 19, 5495-
5503.
Ferrarese, C., Cogliati, T., Tortorella, R., Zucca, C., Bogliun, G., Beghi, E., Passoni, D., Zoia, C., Begni,
B., Airoldi, L., et al. (1998) Diazepam binding inhibitor (DBI) in the plasma of pediatric and adult
epileptic patients. Epilepsy Res 29, 129-134.
Ferrarese, C., Mennini, T., Pecora, N., Pierpaoli, C., Frigo, M., Marzorati, C., Gobbi, M., Bizzi, A.,
Codegoni, A. and Garattini, S. (1991) Diazepam binding inhibitor (DBI) increases after acute stress in
rat. Neuropharmacology 30, 1445-1452.
Ferrarese, C., Appollonio, I., Frigo, M., Meregalli, S., Piolti, R., Tamma, F. and Frattola, L. (1990)
Cerebrospinal fluid levels of diazepam-binding inhibitor in neurodegenerative disorders with dementia.
Neurology 40, 632-635.
Ferrarese, C., Appollonio, I., Frigo, M., Piolti, R., Tamma, F. and Frattola, L. (1989) Distribution of a
putative endogenous modulator of the GABAergic system in human brain. Neurology 39, 443-445.
Ferrero, P., Benna, P., Costa, P., Tarenzi, L., Baggio, G., Bergamasco, B. and Bergamini, L. (1988)
Diazepam binding inhibitor-like immunoreactivity (DBI-LI) in human CSF. Correlations with
neurological disorders. J Neurol Sci 87, 327-349.
72
Ferrero, P., Costa, E., Conti-Tronconi, B. and Guidotti, A. (1986a) A diazepam binding inhibitor (DBI)-
like neuropeptide is detected in human brain. Brain Res 399, 136-142.
Ferrero, P., Santi, M.R., Conti-Tronconi, B., Costa, E. and Guidotti, A. (1986b) Study of an
octadecaneuropeptide derived from diazepam binding inhibitor (DBI): Biological activity and presence
in rat brain. Proc Natl Acad Sci U S A 83, 827-831.
Fisher, E., Nitz, I., Gieger, C., Grallert, H., Gohlke, H., Lindner, I., Dahm, S., Boeing, H., Burwinkel, B.,
Rathmann, W., et al. (2007) Association of acyl-CoA-binding protein (ACBP) single nucleotide
polymorphisms and type 2 diabetes in two German study populations. Mol Nutr Food Res 51, 178-184.
Franch, J., Knudsen, J., Ellis, B.A., Pedersen, P.K., Cooney, G.J. and Jensen, J. (2002) Acyl-CoA
binding protein expression is fiber type- specific and elevated in muscles from the obese insulin-resistant
zucker rat. Diabetes 51, 449-454.
Frolov, A. and Schroeder, F. (1998) Acyl coenzyme A binding protein. Conformational sensitivity to
long chain fatty acyl-CoA. J Biol Chem 273, 11049-11055.
Fulceri, R., Knudsen, J., Giunti, R., Volpe, P., Nori, A. and Benedetti, A. (1997) Fatty acyl-CoA-acyl-
CoA-binding protein complexes activate the Ca2+
release channel of skeletal muscle sarcoplasmic
reticulum. Biochem J 325, 423-428.
Fyrst, H., Knudsen, J., Schott, M.A., Lubin, B.H. and Kuypers, F.A. (1995) Detection of acyl-CoA-
binding protein in human red blood cells and investigation of its role in membrane phospholipid renewal.
Biochem J 306, 793-799.
Gaigg, B., Neergaard, T.B., Schneiter, R., Hansen, J.K., Faergeman, N.J., Jensen, N.A., Andersen, J.R.,
Friis, J., Sandhoff, R., Schroder, H.D., et al. (2001) Depletion of acyl-coenzyme A-binding protein
affects sphingolipid synthesis and causes vesicle accumulation and membrane defects in saccharomyces
cerevisiae. Mol Biol Cell 12, 1147-1160.
Garcia de Mateos-Verchere, J., Leprince, J., Tonon, M.C., Vaudry, H. and Costentin, J. (1999) Reduction
of pentylenetetrazol-induced convulsions by the octadecaneuropeptide ODN. Peptides 20, 1431-1436.
Garnier, M., Boujrad, N., Ogwuegbu, S.O., Hudson, J.R.,Jr and Papadopoulos, V. (1994) The
polypeptide diazepam-binding inhibitor and a higher affinity mitochondrial peripheral-type
benzodiazepine receptor sustain constitutive steroidogenesis in the R2C Leydig tumor cell line. J Biol
Chem 269, 22105-22112.
Garnier, M., Boujrad, N., Oke, B.O., Brown, A.S., Riond, J., Ferrara, P., Shoyab, M., Suarez-Quian,
C.A. and Papadopoulos, V. (1993) Diazepam binding inhibitor is a paracrine/autocrine regulator of
Leydig cell proliferation and steroidogenesis: Action via peripheral-type benzodiazepine receptor and
independent mechanisms. Endocrinology 132, 444-458.
Gilde, A.J. and Van Bilsen, M. (2003) Peroxisome proliferator-activated receptors (PPARS): Regulators
of gene expression in heart and skeletal muscle. Acta Physiol Scand 178, 425-434.
Guidotti, A. (1991) Role of DBI in brain and its posttranslational processing products in normal and
abnormal behavior. Neuropharmacology 30, 1425-1433.
Guidotti, A., Forchetti, C.M., Corda, M.G., Konkel, D., Bennett, C.D. and Costa, E. (1983) Isolation,
characterization, and purification to homogeneity of an endogenous polypeptide with agonistic action on
benzodiazepine receptors. Proc Natl Acad Sci U S A 80, 3531-3535.
Han, J., Hamilton, J.A., Kirkland, J.L., Corkey, B.E. and Guo, W. (2003) Medium-chain oil reduces fat
mass and down-regulates expression of adipogenic genes in rats. Obes Res 11, 734-744.
Hansen, H.O., Andreasen, P.H., Mandrup, S., Kristiansen, K. and Knudsen, J. (1991) Induction of acyl-
CoA-binding protein and its mRNA in 3T3-L1 cells by insulin during preadipocyte-to-adipocyte
differentiation. Biochem J 277, 341-344.
73
Hansen, J.S., Faergeman, N.J., Kagelund, B.B. and Knudsen, J. (2007) Acyl-CoA binding protein
(ACBP) localizes to ER and golgi in a ligand dependent manner in mammalian cells. Biochem J 410,
463-472.
Hardie, D.G. (2008) Role of AMP-activated protein kinase in the metabolic syndrome and in heart
disease. FEBS Lett 582, 81-89.
Harwood, S.M., Yaqoob, M.M. and Allen, D.A. (2005) Caspase and calpain function in cell death:
Bridging the gap between apoptosis and necrosis. Ann Clin Biochem 42, 415-431.
Helakorpi, S., Prattala, R. and Uutela, A. (2008) Health behaviour and health among the Finnish adult
population, Spring 2007. Publications of the National Public Health Institute. B. No 6.
Helledie, T., Grontved, L., Jensen, S.S., Kiilerich, P., Rietveld, L., Albrektsen, T., Boysen, M.S., Nohr,
J., Larsen, L.K., Fleckner, J., et al. (2002a) The gene encoding the acyl-CoA-binding protein is activated
by peroxisome proliferator-activated receptor gamma through an intronic response element functionally
conserved between humans and rodents. J Biol Chem 277, 26821-26830.
Helledie, T., Jorgensen, C., Antonius, M., Krogsdam, A.M., Kratchmarova, I., Kristiansen, K. and
Mandrup, S. (2002b) Role of adipocyte lipid-binding protein (ALBP) and acyl-coA binding protein
(ACBP) in PPAR-mediated transactivation. Mol Cell Biochem 239, 157-164.
Helledie, T., Antonius, M., Sorensen, R.V., Hertzel, A.V., Bernlohr, D.A., Kolvraa, S., Kristiansen, K.
and Mandrup, S. (2000) Lipid-binding proteins modulate ligand-dependent trans-activation by
peroxisome proliferator-activated receptors and localize to the nucleus as well as the cytoplasm. J Lipid
Res 41, 1740-1751.
Hertz, R., Magenheim, J., Berman, I. and Bar-Tana, J. (1998) Fatty acyl-CoA thioesters are ligands of
hepatic nuclear factor-4alpha. Nature 392, 512-516.
Herzig, K.H., Schon, I., Tatemoto, K., Ohe, Y., Li, Y., Folsch, U.R. and Owyang, C. (1996) Diazepam
binding inhibitor is a potent cholecystokinin-releasing peptide in the intestine. Proc Natl Acad Sci U S A
93, 7927-7932.
Hoekstra, M., Kruijt, J.K., Van Eck, M. and Van Berkel, T.J. (2003) Specific gene expression of ATP-
binding cassette transporters and nuclear hormone receptors in rat liver parenchymal, endothelial, and
Kupffer cells. J Biol Chem 278, 25448-25453.
Huang, H., Atshaves, B.P., Frolov, A., Kier, A.B. and Schroeder, F. (2005) Acyl-coenzyme binding
protein expression alters liver fatty acyl-coenzyme metabolism. Biochemistry 44, 10282-10297.
Israel, D.I. (1993) A PCR-based method for high stringency screening of DNA libraries. Nucleic Acids
Res 21, 2627-2631.
Issemann, I. and Green, S. (1990) Activation of a member of the steroid hormone receptor superfamily
by peroxisome proliferators. Nature 347, 645-650.
Jolly, C.A., Wilton, D.C. and Schroeder, F. (2000) Microsomal fatty acyl-CoA transacylation and
hydrolysis: Fatty acyl-CoA species dependent modulation by liver fatty acyl-CoA binding proteins.
Biochim Biophys Acta 1483, 185-197.
Jump, D.B., Botolin, D., Wang, Y., Xu, J., Christian, B. and Demeure, O. (2005) Fatty acid regulation of
hepatic gene transcription. J Nutr 135, 2503-2506.
Katsura, M., Mohri, Y., Shuto, K., Tsujimura, A., Ukai, M. and Ohkuma, S. (2002) Psychological stress,
but not physical stress, causes increase in diazepam binding inhibitor (DBI) mRNA expression in mouse
brains. Brain Res Mol Brain Res 104, 103-109.
Katsura, M., Takesue, M., Shuto, K., Mohri, Y., Tarumi, C., Tsujimura, A., Shirotani, K. and Ohkuma,
S. (2001) NMDA receptor activation enhances diazepam binding inhibitor and its mRNA expressions in
mouse cerebral cortical neurons. Brain Res Mol Brain Res 88, 161-165.
74
Katsura, M., Ohkuma, S., Tsujimura, A., Xu, J., Hibino, Y., Ishikawa, E. and Kuriyama, K. (1998a)
Functional involvement of benzodiazepine receptors in ethanol-induced increases of diazepam binding
inhibitor (DBI) and its mRNA in the mouse brain. Brain Res Mol Brain Res 54, 124-132.
Katsura, M., Ohkuma, S., Xu, J., Hibino, Y., Tsujimura, A. and Kuriyama, K. (1998b) Continuous
treatment with nicotine increases diazepam binding inhibitor (DBI) and its mRNA in the mouse brain.
Brain Res Mol Brain Res 55, 345-349.
Katsura, M., Ohkuma, S., Tsujimura, A. and Kuriyama, K. (1995) Increase of diazepam binding inhibitor
mRNA levels in the brains of chronically ethanol-treated and -withdrawn mice. J Pharmacol Exp Ther
273, 1529-1533.
Kavaliers, M. and Hirst, M. (1986) An octadecaneuropeptide (ODN) derived from diazepam binding
inhibitor increases aggressive interactions in mice. Brain Res 383, 343-349.
Kerkhoff, C., Beuck, M., Threige-Rasmussen, J., Spener, F., Knudsen, J. and Schmitz, G. (1997) Acyl-
CoA binding protein (ACBP) regulates acyl-CoA:Cholesterol acyltransferase (ACAT) in human
mononuclear phagocytes. Biochim Biophys Acta 1346, 163-172.
Knudsen, J., Neergaard, T.B., Gaigg, B., Jensen, M.V. and Hansen, J.K. (2000) Role of acyl-CoA
binding protein in acyl-CoA metabolism and acyl-CoA-mediated cell signaling. J Nutr 130, 294S-298S.
Knudsen, J., Faergeman, N.J., Skott, H., Hummel, R., Borsting, C., Rose, T.M., Andersen, J.S., Hojrup,
P., Roepstorff, P. and Kristiansen, K. (1994) Yeast acyl-CoA-binding protein: Acyl-CoA-binding affinity
and effect on intracellular acyl-CoA pool size. Biochem J 302, 479-485.
Knudsen, J., Mandrup, S., Rasmussen, J.T., Andreasen, P.H., Poulsen, F. and Kristiansen, K. (1993) The
function of acyl-CoA-binding protein (ACBP)/diazepam binding inhibitor (DBI). Mol Cell Biochem
123, 129-138.
Knudsen, J., Hojrup, P., Hansen, H.O., Hansen, H.F. and Roepstorff, P. (1989) Acyl-CoA-binding
protein in the rat. Purification, binding characteristics, tissue concentrations and amino acid sequence.
Biochem J 262, 513-519.
Kolmer, M., Rovio, A. and Alho, H. (1995) The characterization of two diazepam binding inhibitor
(DBI) transcripts in humans. Biochem J 306, 327-330.
Kolmer, M., Roos, C., Tirronen, M., Myohanen, S. and Alho, H. (1994) Tissue-specific expression of the
diazepam-binding inhibitor in drosophila melanogaster: Cloning, structure, and localization of the gene.
Mol Cell Biol 14, 6983-6995.
Kragelund, B.B., Poulsen, K., Andersen, K.V., Baldursson, T., Kroll, J.B., Neergard, T.B., Jepsen, J.,
Roepstorff, P., Kristiansen, K., Poulsen, F.M., et al. (1999) Conserved residues and their role in the
structure, function, and stability of acyl-coenzyme A binding protein. Biochemistry 38, 2386-2394.
Kragelund, B.B., Andersen, K.V., Madsen, J.C., Knudsen, J. and Poulsen, F.M. (1993) Three-
dimensional structure of the complex between acyl-coenzyme A binding protein and palmitoyl-
coenzyme A. J Mol Biol 230, 1260-1277.
Lacapere, J.J. and Papadopoulos, V. (2003) Peripheral-type benzodiazepine receptor: Structure and
function of a cholesterol-binding protein in steroid and bile acid biosynthesis. Steroids 68, 569-585.
Lahteinen, S., Pitkanen, A., Koponen, E., Saarelainen, T. and Castren, E. (2003) Exacerbated status
epilepticus and acute cell loss, but no changes in epileptogenesis, in mice with increased brain-derived
neurotrophic factor signaling. Neuroscience 122, 1081-1092.
Lam, T.K., Pocai, A., Gutierrez-Juarez, R., Obici, S., Bryan, J., Aguilar-Bryan, L., Schwartz, G.J. and
Rossetti, L. (2005a) Hypothalamic sensing of circulating fatty acids is required for glucose homeostasis.
Nat Med 11, 320-327.
Lam, T.K., Schwartz, G.J. and Rossetti, L. (2005b) Hypothalamic sensing of fatty acids. Nat Neurosci 8,
579-584.
75
Larson, J. and Lynch, G. (1988) Role of N-methyl-D-aspartate receptors in the induction of synaptic
potentiation by burst stimulation patterned after the hippocampal theta-rhythm. Brain Res 441, 111-118.
Larson, J. and Lynch, G. (1986) Induction of synaptic potentiation in hippocampus by patterned
stimulation involves two events. Science 232, 985-988.
Lee, C.H., Olson, P., Hevener, A., Mehl, I., Chong, L.W., Olefsky, J.M., Gonzalez, F.J., Ham, J., Kang,
H., Peters, J.M., et al. (2006) PPARdelta regulates glucose metabolism and insulin sensitivity. Proc Natl
Acad Sci U S A 103, 3444-3449.
Lee, L., DeBono, C.A., Campagna, D.R., Young, D.C., Moody, D.B. and Fleming, M.D. (2007) Loss of
the acyl-CoA binding protein (ACBP) results in fatty acid metabolism abnormalities in mouse hair and
skin. J Invest Dermatol 127, 16-23.
Leff, T. (2003) AMP-activated protein kinase regulates gene expression by direct phosphorylation of
nuclear proteins. Biochem Soc Trans 31, 224-227.
Leventis, R., Juel, G., Knudsen, J.K. and Silvius, J.R. (1997) Acyl-CoA binding proteins inhibit the
nonenzymic S-acylation of cysteinyl-containing peptide sequences by long-chain acyl-CoAs.
Biochemistry 36, 5546-5553.
Lewis, D.A., Campbell, M.J. and Morrison, J.H. (1986) An immunohistochemical characterization of
somatostatin-28 and somatostatin-281-12 in monkey prefrontal cortex. J Comp Neurol 248, 1-18.
Li, Y., Hao, Y. and Owyang, C. (2000) Diazepam-binding inhibitor mediates feedback regulation of
pancreatic secretion and postprandial release of cholecystokinin. J Clin Invest 105, 351-359.
Lopez, M., Lelliott, C.J. and Vidal-Puig, A. (2007) Hypothalamic fatty acid metabolism: A housekeeping
pathway that regulates food intake. Bioessays 29, 248-261.
Lopez, M., Lelliott, C.J., Tovar, S., Kimber, W., Gallego, R., Virtue, S., Blount, M., Vazquez, M.J.,
Finer, N., Powles, T.J., et al. (2006) Tamoxifen-induced anorexia is associated with fatty acid synthase
inhibition in the ventromedial nucleus of the hypothalamus and accumulation of malonyl-CoA. Diabetes
55, 1327-1336.
Manabe, Y., Toyoda, T., Kuroda, K., Imaizumi, M., Yamamoto, T. and Fushiki, T. (2001) Effect of
diazepam binding inhibitor (DBI) on the fluid intake, preference and the taste reactivity in mice. Behav
Brain Res 126, 197-204.
Mandrup, S., Sorensen, R.V., Helledie, T., Nohr, J., Baldursson, T., Gram, C., Knudsen, J. and
Kristiansen, K. (1998) Inhibition of 3T3-L1 adipocyte differentiation by expression of acyl-CoA-binding
protein antisense RNA. J Biol Chem 273, 23897-23903.
Mandrup, S., Hummel, R., Ravn, S., Jensen, G., Andreasen, P.H., Gregersen, N., Knudsen, J. and
Kristiansen, K. (1992) Acyl-CoA-binding protein/diazepam-binding inhibitor gene and pseudogenes. A
typical housekeeping gene family. J Mol Biol 228, 1011-1022.
Masmoudi, O., Gandolfo, P., Tokay, T., Leprince, J., Ravni, A., Vaudry, H. and Tonon, M.C. (2005)
Somatostatin down-regulates the expression and release of endozepines from cultured rat astrocytes via
distinct receptor subtypes. J Neurochem 94, 561-571.
Matsuda, K., Wada, K., Miura, T., Maruyama, K., Shimakura, S.I., Uchiyama, M., Leprince, J., Tonon,
M.C. and Vaudry, H. (2007) Effect of the diazepam-binding inhibitor-derived peptide,
octadecaneuropeptide, on food intake in goldfish. Neuroscience 150, 425-432.
Mauriala, T., Herzig, K.H., Heinonen, M., Idziak, J. and Auriola, S. (2004) Determination of long-chain
fatty acid acyl-coenzyme compounds using liquid chromatography-electrospray ionization tandem mass
spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 808, 263-268.
McGee, S.L. and Hargreaves, M. (2008) AMPK and transcriptional regulation. Front Biosci 13, 3022-
3033.
Melloni, E., Averna, M., Salamino, F., Sparatore, B., Minafra, R. and Pontremoli, S. (2000) Acyl-CoA-
binding protein is a potent m-calpain activator. J Biol Chem 275, 82-86.
76
Michaelis, E.K. (1998) Molecular biology of glutamate receptors in the central nervous system and their
role in excitotoxicity, oxidative stress and aging. Prog Neurobiol 54, 369-415.
Mikkelsen, J. and Knudsen, J. (1987) Acyl-CoA-binding protein from cow. Binding characteristics and
cellular and tissue distribution. Biochem J 248, 709-714.
Milne, K.G., Guther, M.L. and Ferguson, M.A. (2001) Acyl-CoA binding protein is essential in
bloodstream form trypanosoma brucei. Mol Biochem Parasitol 112, 301-304.
Mocchetti, I., Einstein, R. and Brosius, J. (1986) Putative diazepam binding inhibitor peptide: cDNA
clones from rat. Proc Natl Acad Sci USA 83,7221-7225.
Mogensen, I.B., Schulenberg, H., Hansen, H.O., Spener, F. and Knudsen, J. (1987) A novel acyl-CoA-
binding protein from bovine liver. Effect on fatty acid synthesis. Biochem J 241, 189-192.
Morris, R.G. (1981) Spatial localization does not require the presence of local cues. Learn Motiv 12,
239-239-260.
Nakae, J., Oki, M. and Cao, Y. (2008) The FoxO transcription factors and metabolic regulation. FEBS
Lett 582, 54-67.
Neess, D., Kiilerich, P., Sandberg, M.B., Helledie, T., Nielsen, R. and Mandrup, S. (2006) ACBP-a
PPAR and SREBP modulated housekeeping gene. Mol Cell Biochem 284, 149-157.
Nitz, I., Doring, F., Schrezenmeir, J. and Burwinkel, B. (2005) Identification of new acyl-CoA binding
protein transcripts in human and mouse. Int J Biochem Cell Biol 37, 2395-2405.
Niu, N., Rice, S.R., Heston, L.L. and Sobell, J.L. (2004) Multiple missense mutations in the diazepam
binding inhibitor (DBI) gene identified in schizophrenia but lack of disease association. Am J Med Genet
B Neuropsychiatr Genet 125, 10-19.
Obici, S., Feng, Z., Arduini, A., Conti, R. and Rossetti, L. (2003) Inhibition of hypothalamic carnitine
palmitoyltransferase-1 decreases food intake and glucose production. Nat Med 9, 756-761.
Obici, S., Feng, Z., Morgan, K., Stein, D., Karkanias, G. and Rossetti, L. (2002) Central administration
of oleic acid inhibits glucose production and food intake. Diabetes 51, 271-275.
Ohgami, R.S., Campagna, D.R., Antiochos, B., Wood, E.B., Sharp, J.J., Barker, J.E. and Fleming, M.D.
(2005) Nm1054: A spontaneous, recessive, hypochromic, microcytic anemia mutation in the mouse.
Blood 106, 3625-3631.
Ohkuma, S., Katsura, M. and Tsujimura, A. (2001) Alterations in cerebral diazepam binding inhibitor
expression in drug dependence: A possible biochemical alteration common to drug dependence. Life Sci
68, 1215-1222.
Ostenson, C.G., Ahren, B., Karlsson, S., Knudsen, J. and Efendic, S. (1994) Inhibition by rat diazepam-
binding inhibitor/acyl-CoA-binding protein of glucose-induced insulin secretion in the rat. Eur J
Endocrinol 131, 201-204.
Ostenson, C.G., Ahren, B., Johansson, O., Karlsson, S., Hilliges, M. and Efendic, S. (1991) Diazepam
binding inhibitor and the endocrine pancreas. Neuropharmacology 30, 1391-1398.
Ostenson, C.G., Ahren, B., Karlsson, S., Sandberg, E. and Efendic, S. (1990) Effects of porcine
diazepam-binding inhibitor on insulin and glucagon secretion in vitro from the rat endocrine pancreas.
Regul Pept 29, 143-151.
Papadopoulos, V. and Brown A.S. (1995) Role of peripheral-type benzodiazepine receptor and the
polypeptide diazepam binding inhibitor in steroidogenesis. J Steroid Biochem Molec Biol 53, 103-110.
Papadopoulos, V., Guarneri, P., Kreuger, K.E., Guidotti, A. and Costa, E. (1992) Pregnenolone
biosynthesis in C6-2B glioma cell mitochondria: Regulation by a mitochondrial diazepam binding
inhibitor receptor. Proc Natl Acad Sci U S A 89, 5113-5117.
77
Papadopoulos, V., Berkovich, A. and Krueger, K.E. (1991) The role of diazepam binding inhibitor and
its processing products at mitochondrial benzodiazepine receptors: Regulation of steroid biosynthesis.
Neuropharmacology 30, 1417-1423.
Pennycuik, P.R. (1967) A comparison of the effects of a variety of factors on the metabolic rate of the
mouse. Aust J Exp Biol Med Sci 45, 331-346.
Petrescu, A.D., Payne, H.R., Boedecker, A., Chao, H., Hertz, R., Bar-Tana, J., Schroeder, F. and Kier,
A.B. (2003) Physical and functional interaction of acyl-CoA-binding protein with hepatocyte nuclear
factor-4 alpha. J Biol Chem 278, 51813-51824.
Petrescu, A.D., Hertz, R., Bar-Tana, J., Schroeder, F. and Kier, A.B. (2002) Ligand specificity and
conformational dependence of the hepatic nuclear factor-4alpha (HNF-4alpha ). J Biol Chem 277,
23988-23999.
Pussinen, R. and Sirvio, J. (1998) Minor role for alpha1-adrenoceptors in the facilitation of induction and
early maintenance of long-term potentiation in the CA1 field of the hippocampus. J Neurosci Res 51,
309-315.
Qian, Z., Bilderback, T.R. and Barmack, N.H. (2008) Acyl coenzyme A-binding protein (ACBP) is
phosphorylated and secreted by retinal Muller astrocytes following protein kinase-C activation. J
Neurochem 105, 1287-1299.
Racine, R.J. (1972) Modification of seizure activity by electrical stimulation. II. Motor seizure.
Electroencephalogr Clin Neurophysiol 32, 281-294.
Rasmussen, J.T., Faergeman, N.J., Kristiansen, K. and Knudsen, J. (1994) Acyl-CoA-binding protein
(ACBP) can mediate intermembrane acyl-CoA transport and donate acyl-CoA for beta-oxidation and
glycerolipid synthesis. Biochem J 299, 165-170.
Rasmussen, J.T., Rosendal, J. and Knudsen, J. (1993) Interaction of acyl-CoA binding protein (ACBP)
on processes for which acyl-CoA is a substrate, product or inhibitor. Biochem J 292, 907-913.
Rasmussen, J.T., Borchers, T. and Knudsen, J. (1990) Comparison of the binding affinities of acyl-CoA-
binding protein and fatty-acid-binding protein for long-chain acyl-CoA esters. Biochem J 265, 849-855.
Rodgers, J.T., Lerin, C., Haas, W., Gygi, S.P., Spiegelman, B.M. and Puigserver, P. (2005) Nutrient
control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 434, 113-118.
Rosendal, J., Ertbjerg, P. and Knudsen, J. (1993) Characterization of ligand binding to acyl-CoA-binding
protein. Biochem J 290, 321-326.
Rothstein, J.D., McKhann, G., Guarneri, P., Barbaccia, M.L., Guidotti, A. and Costa, E. (1989)
Cerebrospinal fluid content of diazepam binding inhibitor in chronic hepatic encephalopathy. Ann
Neurol 26, 57-62.
Roy, A., Adinoff, B., Roehrich, L., Lamparski, D., Custer, R., Lorenz, V., Barbaccia, M., Guidotti, A.,
Costa, E. and Linnoila, M. (1988) Pathological gambling. A psychobiological study. Arch Gen
Psychiatry 45, 369-373.
Rudolph, U. and Mohler, H. (2006) GABA-based therapeutic approaches: GABAA receptor subtype
functions. Curr Opin Pharmacol 6, 18-23.
Sandberg, M.B., Bloksgaard, M., Duran-Sandoval, D., Duval, C., Staels, B. and Mandrup, S. (2005) The
gene encoding acyl-CoA-binding protein is subject to metabolic regulation by both sterol regulatory
element-binding protein and peroxisome proliferator-activated receptor alpha in hepatocytes. J Biol
Chem 280, 5258-5266.
Schjerling, C.K., Hummel, R., Hansen, J.K., Borsting, C., Mikkelsen, J.M., Kristiansen, K. and Knudsen,
J. (1996) Disruption of the gene encoding the acyl-CoA-binding protein (ACB1) perturbs acyl-CoA
metabolism in saccharomyces cerevisiae. J Biol Chem 271, 22514-22521.
Schmittgen, T.D. and Zakrajsek, B.A. (2000) Effect of experimental treatment on housekeeping gene
expression: Validation by real-time, quantitative RT-PCR. J Biochem Biophys Methods 46, 69-81.
78
Schroeder, F., Petrescu, A.D., Huang, H., Atshaves, B.P., McIntosh, A.L., Martin, G.G., Hostetler, H.A.,
Vespa, A., Landrock, D., Landrock, K.K., et al. (2008) Role of fatty acid binding proteins and long chain
fatty acids in modulating nuclear receptors and gene transcription. Lipids 43, 1-17.
Schultz, R., Pelto-Huikko, M. and Alho, H. (1992) Expression of diazepam binding inhibitor-like
immunoreactivity in rat testis is dependent on pituitary hormones. Endocrinol 130, 3200-3206.
Seedorf, U. and Aberle, J. (2007) Emerging roles of PPARdelta in metabolism. Biochim Biophys Acta
1771, 1125-1131.
Shibasaki, M., Katsura, M., Torigoe, F., Honda, T., Sumimoto, A., Tsujimura, A. and Ohkuma, S. (2007)
Increase in diazepam binding inhibitor expression by sustained morphine exposure is mediated via mu-
opioid receptors in primary cultures of mouse cerebral cortical neurons. J Neurosci Res 85, 2971-2980.
Shimano, H. (2001) Sterol regulatory element-binding proteins (SREBPs): Transcriptional regulators of
lipid synthetic genes. Prog Lipid Res 40, 439-452.
Shimokawa, T., Kumar, M.V. and Lane, M.D. (2002) Effect of a fatty acid synthase inhibitor on food
intake and expression of hypothalamic neuropeptides. Proc Natl Acad Sci U S A 99, 66-71.
Shulga, N. and Pastorino, J.G. (2006) Acyl coenzyme A-binding protein augments bid-induced
mitochondrial damage and cell death by activating mu-calpain. J Biol Chem 281, 30824-30833.
Sjoholm, A., Funakoshi, A., Efendic, S., Ostenson, C.G. and Hellerstrom, C. (1991) Long term inhibitory
effects of pancreastatin and diazepam binding inhibitor on pancreatic beta-cell deoxyribonucleic acid
replication, polyamine content, and insulin secretion. Endocrinology 128, 3277-3282.
Slobodyansky, E., Guidotti, A., Wambebe, C., Berkovich, A. and Costa, E. (1989) Isolation and
characterization of a rat brain triakontatetraneuropeptide, a posttranslational product of diazepam binding
inhibitor: Specific action at the RO 5-4864 recognition site. J Neurochem 53, 1276-1284.
Swinnen, J.V., Alen, P., Heyns, W. and Verhoeven, G. (1998) Identification of diazepam-binding
Inhibitor/Acyl-CoA-binding protein as a sterol regulatory element-binding protein-responsive gene. J
Biol Chem 273, 19938-19944.
Swinnen, J.V., Esquenet, M., Rosseels, J., Claessens, F., Rombauts, W., Heyns, W. and Verhoeven, G.
(1996) A human gene encoding diazepam-binding inhibitor/acy1-CoA-binding protein: Transcription
and hormonal regulation in the androgen-sensitive human prostatic adenocarcinoma cell line LNCaP.
DNA Cell Biol 15, 197-208.
Takeuchi, H., Noguchi, O., Sekine, S., Kobayashi, A. and Aoyama, T. (2006) Lower weight gain and
higher expression and blood levels of adiponectin in rats fed medium-chain TAG compared with long-
chain TAG. Lipids 41, 207-212.
Taskinen, J.P., van Aalten, D.M., Knudsen, J. and Wierenga, R.K. (2007) High resolution crystal
structures of unliganded and liganded human liver ACBP reveal a new mode of binding for the acyl-CoA
ligand. Proteins 66, 229-238.
Thoeringer, C.K., Binder, E.B., Salyakina, D., Erhardt, A., Ising, M., Unschuld, P.G., Kern, N., Lucae,
S., Brueckl, T.M., Mueller, M.B., et al. (2007) Association of a Met88Val diazepam binding inhibitor
(DBI) gene polymorphism and anxiety disorders with panic attacks. J Psychiatr Res 41, 579-584.
Tokay, T., Masmoudi, O., Gandolfo, P., Leprince, J., Pelletier, G., Vaudry, H. and Tonon, M.C. (2005)
Beta-amyloid peptides stimulate endozepine biosynthesis in cultured rat astrocytes. J Neurochem 94,
607-616.
Tong, Y., Toranzo, D. and Pelletier, G. (1991) Localization of diazepam-binding inhibitor (DBI) mRNA
in the rat brain by high resolution in situ hybridisation. Neuropeptides 20, 33-40.
Tonon, M.C., Desy, L., Nicolas, P., Vaudry, H. and Pelletier, G. (1990) Immunocytochemical
localization of the endogenous benzodiazepine ligand octadecaneuropeptide (ODN) in the rat brain.
Neuropeptides 15, 17-24.
79
Valentin, M., Balvers, M., Pusch, W., Weinbauer, G.F., Knudsen, J. and Ivell, R. (2000) Structure and
expression of the mouse gene encoding the endozepine-like peptide from haploid male germ cells. Eur J
Biochem 267, 5438-5449.
van Aalten, D.M., Milne, K.G., Zou, J.Y., Kleywegt, G.J., Bergfors, T., Ferguson, M.A., Knudsen, J. and
Jones, T.A. (2001) Binding site differences revealed by crystal structures of plasmodium falciparum and
bovine acyl-CoA binding protein. J Mol Biol 309, 181-192.
Vezzani, A., Serafini, R., Stasi, M.A., Samanin, R. and Ferrarese, C. (1991) Epileptogenic activity of two
peptides derived from diazepam binding inhibitor after intrahippocampal injection in rats. Epilepsia 32,
597-603.
Voikar, V., Vasar, E. and Rauvala, H. (2004) Behavioral alterations induced by repeated testing in
C57BL/6J and 129S2/Sv mice: Implications for phenotyping screens. Genes Brain Behav 3, 27-38.
Wang, X., Zhou, L., Li, G., Luo, T., Gu, Y., Qian, L., Fu, X., Li, F., Li, J. and Luo, M. (2007) Palmitate
activates AMP-activated protein kinase and regulates insulin secretion from beta cells. Biochem Biophys
Res Commun 352, 463-468.
Watt, M.J., Steinberg, G.R., Chen, Z.P., Kemp, B.E. and Febbraio, M.A. (2006) Fatty acids stimulate
AMP-activated protein kinase and enhance fatty acid oxidation in L6 myotubes. J Physiol 574, 139-147.
Woldegiorgis, G., Spennetta, T., Corkey, B.E., Williamson, J.R. and Shrago, E. (1985) Extraction of
tissue long-chain acyl-CoA esters and measurement by reverse-phase high-performance liquid
chromatography. Anal Biochem 150, 8-12.
Wolfgang, M.J., Cha, S.H., Millington, D.S., Cline, G., Shulman, G.I., Suwa, A., Asaumi, M., Kurama,
T., Shimokawa, T. and Lane, M.D. (2008) Brain-specific carnitine palmitoyl-transferase-1c: Role in
CNS fatty acid metabolism, food intake and body weight. J Neurochem 105, 1550-1559.
Wolfgang, M.J., Kurama, T., Dai, Y., Suwa, A., Asaumi, M., Matsumoto, S., Cha, S.H., Shimokawa, T.
and Lane, M.D. (2006) The brain-specific carnitine palmitoyltransferase-1c regulates energy
homeostasis. Proc Natl Acad Sci U S A 103, 7282-7287.
Woods, A., Johnstone, S.R., Dickerson, K., Leiper, F.C., Fryer, L.G., Neumann, D., Schlattner, U.,
Wallimann, T., Carlson, M. and Carling, D. (2003) LKB1 is the upstream kinase in the AMP-activated
protein kinase cascade. Curr Biol 13, 2004-2008.
Yanagibashi, K., Ohno, Y., Kawamura, M. and Hall, P.F. (1988) The regulation of intracellular transport
of cholesterol in bovine adrenal cells: Purification of a novel protein. Endocrinology 123, 2075-2082.
Yanase, H., Shimizu, H., Kanda, T., Fujii, H. and Iwanaga, T. (2001) Cellular localization of the
diazepam binding inhibitor (DBI) in the gastrointestinal tract of mice and its coexistence with the fatty
acid binding protein (FABP). Arch Histol Cytol 64, 449-460.
Yang, T., Fu, M., Pestell, R. and Sauve, A.A. (2006) SIRT1 and endocrine signaling. Trends Endocrinol
Metab 17, 186-191.
Yang, Y., Pritchard, P.H., Bhuiyan, J., Seccombe, D.W. and Moghadasian, M.H. (2001) Overexpression
of acyl-coA binding protein and its effects on the flux of free fatty acids in McA-RH 7777 cells. Lipids
36, 595-600.
Yoshida, H., Tsunoda, Y. and Owyang, C. (1999) Diazepam-binding inhibitor 33-50 elicits Ca2+
oscillation and CCK secretion in STC-1 cells via L-type Ca2+
channels. Am J Physiol 276, 694-702.
Zhou, G., Myers, R., Li, Y., Chen, Y., Shen, X., Fenyk-Melody, J., Wu, M., Ventre, J., Doebber, T.,
Fujii, N., et al. (2001) Role of AMP-activated protein kinase in mechanism of metformin action. J Clin
Invest 108, 1167-1174.
Zoete, V., Grosdidier, A. and Michielin, O. (2007) Peroxisome proliferator-activated receptor structures:
Ligand specificity, molecular switch and interactions with regulators. Biochim Biophys Acta 1771, 915-
925.
Kuopio University Publications G. - A.I.Virtanen Institute G 46. Räty, Jani. Baculovirus surface modifications for enhanced gene delivery and biodistribution imaging. 2006. 86 p. Acad. Diss. G 47. Tyynelä, Kristiina. Gene therapy of malignant glioma. Experimental and clinical studies. 2006. 114 p. Acad. Diss. G 48. Malm, Tarja. Glial Cells in Alzheimer's Disease Models. 2006. 118 p. Acad. Diss. G 49. Tuunanen, Pasi. Sensory Processing by Functional MRI. Correlations with MEG and the Role of Oxygen Availability. 2006. 118 p. Acad. Diss. G 50. Liimatainen, Timo. Molecular magnetic resonance imaging of gene therapy-induced apoptosis and gene transfer: a role for 1H spectroscopic imaging and iron oxide labelled viral particles. 2007. 81 p. Acad. Diss. G 51. Keinänen, Riitta et al. (eds.). The first annual post-graduate symposium of the graduate school of molecular medicine: winter school 2007. 2007. 65 p. Abstracts. G 52. Vartiainen, Suvi. Caenorhabditis elegans as a model for human synucleopathies. 2007. 94 p. Acad. Diss. G 53. Määttä, Ann-Marie. Development of gene and virotherapy against non-small cell lung cancer. 2007. 75 p. Acad. Diss. G 54. Rautsi, Outi. Hurdles and Improvements in Therapeutic Gene Transfer for Cancer. 2007. 79 p. Acad. Diss. G 55. Pehkonen, Petri. Methods for mining data from genome wide high-throughput technologies. 2007. 91 p. Acad. Diss. G 56. Hyvönen, Mervi T. Regulation of spermidine/spermine N'-acetyltransferase and its involvement in cellular proliferation and development of acute pancreatitis. 2007. 79 p. Acad. Diss. G 57. Gurevicius, Kestutis. EEG and evoked potentials as indicators of interneuron pathology in mouse models of neurological diseases. 2007. 76 p. Acad. Diss. G 58. Leppänen, Pia. Mouse models of atherosclerosis, vascular endothelial growth factors and gene therapy. 2007. 91 p. Acad. Diss. G 59. Keinänen, Riitta et al. The second annual post-graduate symposium of the graduate school of molecular medicine: winter school 2008. 2008. 57 p. Abstracts. G 60. Koponen, Jonna. Lentiviral vector for gene transfer: a versatile tool for regulated gene expression, gene silencing and progenitor cell therapies. 2008. 71 p. Acad. Diss. G 61. Ahtoniemi, Toni. Mutant Cu,Zn superoxide dismutase in amyotrophic lateral sclerosis: molecular mechanisms of neurotoxicity. 2008. 107 p. Acad. Diss. G 62. Purhonen, Anna-Kaisa. Signals arising from the gastointestinal tract that affect food intake. 2008. 86 p. Acad. Diss.
Top Related