Taye Bekele Ayele
Colonization History, Phylogeography and Conservation Genetics of the Gravely
Endangered Tree Species Hagenia abyssinica (Bruce) J.F. Gmel from Ethiopia
Gottingen 2008
OP
TIM
US
k c & - 223 M 1^.
GrsAlZ - UcVfc^Uo-C2V> £>»A T ^t^-A U
' f \Je^C<2^
C o lo n iz a tio n H isto ry, P liy lo g e o g ra p liy an d C o n se rvatio n G en etics of tllie G ra ve ly E n d a n ge re d T re e Sp ecies Httgenia
abyssinica (B ru ce) J .F . G in el from E th io p ia
Dissertation
submitted for the degree of Doctor of Philosophy (PhD)
Department of Forest Genetics and Forest Tree Breeding
Faculty of Forest Sciences and Forest Ecology
Georg-August University of Gottingen
Taye Bekele Ayele
Born in Kurkura (Harar), Ethiopia
Gottingen, 2008
Bibliographic information published by the Deutsche NationalbibliothekThe Deutsche Nationalbibliothek lists this publication in the Deutsche Nationalbibliografie; detailed bibliographic data are available in the Internet at http://dnb.d-nb.de
Referee: Prof. Dr. Reiner Finkeldey
Co-referee: Prof. Dr. Heiko Becker
Date of disputation: 2 September 2008
Printed with generous support from DAAD/gtz
Taye Bekele Ayele:Colonization History, Phylogeography and Conservation Genetics of the Gravely Endangered Tree Species Hagenia abyssinica (Bruce) J.F. Gmel from Ethiopia ISBN 978-3-941274-07-5
All Rights Reserved1. Edition 2008 © Optimus Mostafa Verlag URL: www.optimus-verlag.de
No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, scanning, or otherwise without the prior written permission o f the Publisher. Request to the Publisher for permission should be addressed to [email protected].
To A tk ilt, Kal & Hamerenoah
with affection
Acknowledgem ents
“How can I repay the LORD for all His goodness to me?” Psalm 116:12. I praise You
Holy Father, for being there for me always and for getting me to the finish line.
It was a challenging but fruitful journey; and there were so many people around me that I
should recognize and thank. All started with an inspiring reply to my e-mail of 2002 that
I received from Prof. Dr. Reiner Finkeldey, expressing his interest to supervise my PhD
project. Prof., 1 admire your patience and support until I step on the open-door of your
office only three years latter. I have enjoyed a freedom of self management, excellent
guidance and encouragement from you in the course of my study. Vielen Dank! 1 am
grateful to Prof. Dr. Heiko Becker for willing to be co-referee for my dissertation and
disputation and Prof Dr. Ursula Kiies for willing to be member of the examination team.
I am indebted to Dr. Oliver Gailing, for excellent guidance in molecular laboratory work
and constructive suggestions throughout the data analysis and writing-up. Your “super”
encouragement and pleasant disposition made my work much easier than I expected. A
special gratitude goes to Prof. Dr. Hans H. Hattemer for scientific and administrative
support all the way through. Many thanks to Dr. Barbara Vomam for the help in aligning
the sequence data and for proof-reading the summaries of the thesis. I am grateful to
Oleksandra Dolyniska, Olga Artes, Thomas Seliger and Gerold Dinkel who are the
champions in the molecular lab and always ready to help. Also, Thomas and Gerold,
thanks for keeping my Laptop running. I appreciate the interactive and friendly environ
ment in the entire department with special mention to Prof. Dr. Martin Ziehe, Prof. Dr.
Hans-Rolf Gregorius, Dr. Elizabeth Gillet, Dr. Ludger Leinemann and Mr. August Ca-
pelle. 1 am grateful to Marita Schwahn for administrative support and for comforting me
during some difficult times. Many thanks to former PhD students: Drs HT Luu, C-P Cao,
AL Curtu, M Mottura, M Pandey, Abayneh D and VM Stefenon, and the current fellow
PhD students: Sylvia, Akindele, Nicolas, Hani, Yanti, Nga, Amaryllis, Marius, Lesya
and Dorte for the stimulating and useful discussions and memorable time we had. I ex
press my gratitude to the former and present coordinators of the “PhD Programme-Wood
Biology and Technology”, Drs E Kuersten & G Buettner, for their commendable work,
and the fellow PhD students thereof for useful interactions. I thank Klaus Richter for
translation of the summary of the thesis into German and Assefa Guchi for the production
of the distribution map of the populations of Hagenia. I commend the encouragement and
support I received from Drs Girma Balcha, Kassahun Embaye, Demel Teketay and
Sileshi Nemomissa. I thank the former and present Ethiopian students of Georg-August
University, Goettingen, for the wonderful moments we shared.
The enduring love and care o f my wife S/r. Atkilt Gizaw and my sweetie daughters Kal
and Hamerenoah has been a mystery o f my strength that kept me moving forward. Ti-
naye, you valiantly shouldered the responsibility o f caring for our kids and managing the
multifaceted social challenges during my long absence from home. Kaliye and Bebitaye,
you are brave and I am proud o f you. My special thanks to my mother Mintwab Wol-
deAregay and my father-in-law Aba WoldeAmanuel for their love and blessing, my
brother Ketema Bekele and his family for their encouragement and prayer through out
my study, and to my brother Daniel Bekele for his great help and charming accompany
during the fieldwork. The moral support from all my relatives and friends is gratefully
appreciated. The prayers o f my spiritual father Aba Gebretsadik, and that of brothers and
sisters from Mahibere Selam MedhaneAlem and Mahibere Kidusan kept me energetic.
The congregation o f the Ethiopian Orthodox Tewahido Church in Germany particularly
the brothers and sisters at the Keraniyo MedhaneAlem Sunday School in Kassel kept me
spiritually warm. There are a number o f wonderful people whom I want to recognize
their thoughtfulness and contribution but the space just isn’t enough. May God bless you
all!
Finally, I would like to acknowledge some institutions key to my achievement: the Ethio
pian Institute of Biodiversity Conservation (IBC) granted me the study leave. My project
was generously funded by the German Federal Ministry o f Economic Cooperation and
Development (BMZ) through the German Technical Cooperation (gtz). The German
Academic Exchange Service (DAAD) executed the grant. The National Meteorological
Service Agency o f Ethiopia provided climatic data free o f charge.
1. General introduction............................................................................................................................ 11.1 Ethiopia in b rief..................................................................................................................................11.2 Conservation genetics of tropical tree species......................................................................... 11.3 Taxonomy and reproductive biology of Hagenia abyssinica................................................ 31.4 Ecology and natural distribution o f Hagenia abyssinica........................................................ 51.5 Economic and ecological significance of Hagenia abyssinica.............................................61.6 Rationale........................................................................................................................................ 71.7 Aims and predictions................................................................................................................... 8
1.7.1 Objectives..........................................................................................................................81.7.2 Hypotheses.........................................................................................................................91.7.3 Major research questions.............................................................................................10
2. Research approaches..........................................................................................................................112.1 Sampling............................................................................................................................................11
2.2 Morphological assessment..............................................................................................................11
2.3 DNA isolation...................................................................................................................................112.4 Chloroplast microsatellites..............................................................................................................12
2.5 DNA Sequencing.............................................................................................................................122.6 AFLP analyses................................................................................................................................. 123 Summary of results.....................................................................................................................133.1 Morphological data.....................................................................................................................133.2 Chloroplast microsatellite d a ta .................................................................................................133.3 Sequence data.............................................................................................................................. 143.4 AFLP data....................................................................................................................................144 General discussion..........................................................................................................................155 Conclusions and outlook.................................................................................................................196 Summary.......................................................................................................................................... 217. Zusammenfassung............................................................................................................................. 248 References........................................................................................................................................289. Papers submitted to journals............................................................................................................33I. Colonization history and phylogeography of Hagenia abyssinica (Bruce) J.F.
Gmel in Ethiopia inferred from chloroplast microsatellite m arkers................................ 33II. Spatial distribution of genetic diversity in Hagenia abyssinica (Bruce) J.F. Gmel
from Ethiopia, assessed by AFLP molecular markers....................................................... 57III. Conservation genetics of African redwood (Hagenia abyssinica (Bruce) J.F.
Gmel): a remarkable but gravely endangered tropical tree species................................. 86
10 Appendices.................................................................................................................................I l l
Table of contents
1. General introduction
1.1 Ethiopia in brief
Within an altitudinal range of 126 meters below sea level at Afar Depression to 4,620
meters above sea level (m asl ) at the spectacular mountaintops of Ras Dejen, Ethiopia’s
varying physiographic features endowed the country with diverse fauna and flora. The
climate of Ethiopia is varying from cool to hot and fundamentally governed by the Inter-
tropical Convergence Zone (ITC). The rainfall pattern is influenced by two wind systems:
monsoon from south Atlantic and the Indian Ocean, and winds from the Arabian Sea. The
country is devided in 2 1 major Tree Seed Zones and 27 sub-Tree Seed Zones that were
delineated based on ecological criteria to facilitate seed transfer within the country
(Aalbask 1993). The vegetation of the Ethiopian mountains belongs to the Afromontane
phytogeographical region (White 1983). Ethiopia is a severely deforested country with
only about 3.5% of its land currently covered by closed forests (WBISPP 2004). The low
living standard of the people coupled with lack of options is the underlying factor causing
severe decline in forest cover. There has been increasing pressure on the forest land for
crop and animal husbandry, and wood for fuel and construction. New settlements in pri
mary forests are becoming commonplace and hence resulted in the conversion of forest
land into agricultural and other land use systems, subsequently causing forest fragmenta
tion. Precious tree species such as Hagenia abyssinica are the prime victims o f such mal
practices.
1.2 Conservation genetics of tropical tree species
Deforestation, forest fragmentation and extraction o f timber in the form of selective log
ging could have serious consequences on the long-term maintenance of genetic diversity
and fitness in plants (Finkeldey and Hattemer 2007; Laikre and Ryman 1996; Young et
al. 1996). The marvelous biodiversity that has captured our planet is being lost at a pace
that is nearly unprecedented in the history of life (Ehrlich and Ehrlich 1991). Biodiversity
is in a serious decline, with, for example, approximately 50% of the vertebrate animal
l
General introduction
species and 12% of all plant species now considered vulnerable to near-term extinction,
mostly as a result of effects o f habitat alteration associated with human population
growth (Franklin et al. 2002).
The analyses of the amount and distribution o f genetic variation within and among popu
lations of a species can increase our understanding of the historical processes underlying
the genetic diversity (Dumolin-Lapegue et al. 1997). The maintenance o f natural tree
populations with sufficient genetic variation to adapt to future changes in the environ
ment is essential. Genetic variation is thought to be positively correlated with popula
tions' ability to adapt to short-term environmental change, and populations with the high
est levels of genetic variation are expected to suffer least from the negative effects of in-
breeding depression or genetic drift (reviewed by Barrett & Kohn 1991, Ellstrand & Elam
1993). Examples o f natural and dynamic evolutionary processes that shape genetic di
versity are mutation, genetic drift, gene flow, natural selection, speciation and hybridiza
tion (Avise 2004). Sound knowledge of the biology and genetics o f a given organism is
therefore instrumental in providing a scientific basis to its conservation and management.
The two major goals of conservation biology are (1) the preservation of genetic diversity
at any and all possible levels in the phylogenetic hierarchy and (2) the promotion of the
continuance of ecological and evolutionary processes that foster and sustain biodiversity
(reviewed by Avise 2004). Conservation genetics is a discipline dealing with the charac
terization o f a given taxon and the development of conservation measures to maintain its
variation in order to adapt to changing environmental conditions. The present study in
vestigates the pattern o f genetic variation in Hagenia abyssinica at morphological and
molecular genetic markers in order to identify populations for conservation and domesti
cation.
2
General introduction
1.3 Taxonomy and reproductive biology of Hagenia abyssinica
The monotypic Hagenia abyssinica,
fonnerly/synonimously known as
Banksia abyssinica Bruce, Brayera
abyssinica Moq.-Tand, Brayera an-
thelmintica Kunth and Hagenia an-
thelmintica Kunth, is a wind-
pollinated (anemogamous) and wind-
dispersed (anemochorous) broad
leaved dioecious tree species belong
ing to the Rosaceae family (Hede-
berg 1989; Legesse 1995). It is
closely related to the monospecific
genus Leucosidea from the same
family in its taxonomic position
(Eriksson et al. 2003). Locally, the
tree is known as Kosso, Heto and
Habbi in Amharic, Oromiffa and Ti-
grigna, respectively (major local lan
guages in Ethiopia). It is also commonly known as
African redwood, Brayera, Cusso, Hagenia, Kousso,
and Rosewood in English; Mdobore and Mlozilozi in
Swahili (http:/www.worldagroforestry.org), and Ko-
sobaum in German (http://de.wikipedia.org/wiki/-
Hagenia ab-yssinica). The specific name abyssinica
refers to the former name o f Ethiopia.
Fig. I Excellent quality timber tree growing in Che-
cheba (Uraga) forest. Photo: Taye B. Ayele
Fig. 2 compound leaf o f Hagenia Photo: Taye B. Ayele
Hagenia grows up to 35 meters in height (Fig.I). Hagenia trees exhibit varying architec
tures from croaked to slender, multi-stems or forked to single stem, and thick to thin
crowns. The bark is brownish and readily peels in strips, sometimes very thick in old
3
General introduction
stems. Branchlets are covered by silky brown hairs and ringed with leaf scars (Azene et
al. 1993). The leaves are compound measuring up to 40 cm in length with 7- 19 narrowly
oblong leaflets (Fig. 2), having inconsistent leaflet
arrangement in opposite, alternate or mixed patterns.
Hagenia has distinct male and female trees that are
easily recognized by the appearance and color of the
flowers (Figs. 3 & 4). The flowers o f the female tree
are small and inconspicuous, forming attractive bright
pinkish-red drooping panicles (inflorescence) of up to
60 cm length and 30 cm width on aggregate (Azene et
al. 1993; Legesse 1995). The female flower heads are
bulkier than the more feathery yellowish male heads.
Flowering takes place between October and March
(Legesse 1995). The attractive and appealing appear
ance o f the flowers o f Hagenia is not typical for wind-
pollinated species, which are usually dull in colour
(Legesse 1995), suggesting that other pollinating vec
tors such as insects (particularly bees) or birds might
be involved. Fichtl and Admasu (1994) reported that
honeybees collect pollen from the male flowers and Fig 4 Typical mature femaleinflorescence. Photo: Taye B. nectar from the female flowers.
Fig 3 Typical mature male inflorescence. Photo: Taye B. Ayele
H. abyssinica has small, hairy and single-seeded fruits,
which have a brown syncarp with a single ovoid carpel
and a fragile pericarp (Fig. 5). It has fairly small and
light seeds (Fig. 5), amounting to 400,000 - 500,000
seeds per kg (Azene et al. 1993). The seeds can germi
nate within 21 days with a germination capacity o f 40 -
60% without any pre-germination treatment (Azene et
al. 1993; Girma 1999). The seeds withstand desiccation
and hence can be stored for a long time (Girma 1999) in
Fig 5 seeds (top) and fruits (bottom) o f Hagenia, ruler graduation is in cm/mm. Photo: Taye B Ayele
4
General introduction
cold chambers and 6 - 1 2 months without any proper storage facilities (Azene et al.
1993). Protocols have been successfully developed for the micropropagation (Tileye et al.
2005a), in vitro regeneration (Tileye et al. 2005b) and genetic transformation (Tileye et
al. 2007b) of H. abyssinica.
1.4 Ecology and natural distribution of Hagenia abyssinica
Hagenia abyssinica is confined to Africa and its eco
logical range stretches from Eritrea in the North to
Zimbabwe in the South, including Burundi, Central
African Republic, Congo, Ethiopia, Kenya, Malawi,
Rwanda, Sudan, Tanzania, Uganda, and Zambia (He-
deberg 1989; http:/www.worldagroforestry.org). Fos
sil pollen records suggested that Hagenia immigrated
into Ethiopia from the south during the late Pleisto
cene (since 16,700 years Before Present (BP)) and
became abundant in the southern regions o f Ethiopia
about 2500 years BP (Paper I). It grows within an al-
titudinal range of 1,850 to 3,700 m asl (Hedeberg
1989; Friis 1992; Azene et al. 1993; Legesse 1995)
inhabiting the montane forests, montane woodlands
and montane grasslands (Fig. 6-9). Tileye et al.
(2007b) reported
Fig 6 closed Hagenia forest at Dod- dola-Dachosa, Photo: Taye B Ayele
Fig 7 Hagenia tree retained on Bonsho farmland (close to Hagere Mariam), Photo: Taye B Ayele
Fig 8 Typical wooded grassland at Deyu (close to Kofele) dominated by Hagenia. This population is suffering from strangling by Ficus spp. P. Photo: Taye B Ayele
that Hagenia is a late successional species; but field
observations during the present work witnessed sap
lings emerging in disturbed areas such as road cuts in
Bale and Bonga and hence did not support such a
designation. It was also reported that Hagenia has a
regeneration cycle associated with heavy forest fires
(http://database.prta.org/PROTA-html/Hagenia-
%20abyssinica En.htm), suggesting that it is a pio-
5
General introduction
neer species. Furthermore, Finkeldey & Hattemer
(2007) argued that pioneer species have a larger
seed shadow (typical for wind-dispersed species
like Hagenia) than species of late successional
stages.
Fig 9 Hagenia retained on grazing- land at Doddola-Serofta homestead. Photo: Taye B Ayele
Fig. 10 Traditional beehives placed on Hagenia trees. Photo: Taye B. Ayele
1.5 Economic and ecological significance of Hagenia abyssinica
Hagenia abyssinica is one of the best timber species in
Ethiopia and its furniture is preferred for its strength, fine
texture and attractive appearance (Fig. 2c). It is also used
for producing veneers, flooring, cabinets and fuel wood
(Azene et al. 1993; Getachew 2006). The tree is used to
place traditional beehives (Fig 2b) and it also attracts
birds. The concoction made from the powder of dried
female inflorescences is used as a purgative and taenicide
against tapeworm in Ethiopia (Pankhurst 1969; Jansen
1981; Hedeberg 1989; Dawit & Ahadu 1993; Berhanu et al. 1999). Despite its dreadful
and unpleasant taste, the infusion of Kosso has been
most extensively used as vermifuge in rural Ethiopia.
Overdose of Kosso may be fatal and may also cause
abortion. Honey obtained from beehives located
near Hagenia abyssinica trees and collected imme
diately after their flowering is also effective in ex
pelling tapeworms (http://database.prota.org/PRO-
TAhtml/Hagenia%-20abvssinicaEn-.htm). The med
ical use o f Kosso was recorded as early as the six
Fig. 11 A part of a wooden stage made from Hagenia lumber. Photo: Taye B. Ayele
General introduction
teenth century by an Ethiopian monk known as Aba Bahrey who described that the inha
bitants of the Northern provinces took the drug to kill and rid their stomachs of certain
little worms (reviewed by Pankhurst 1969). Berhanu et
al. (1999) reported that Merck in Germany produced
the first crystalline substances called kosins from the
female flowers of Hagenia in 1870 and it was then in
corporated in the European pharmacopoeia. With the
advent of modem medicine that have reliable dosage
and action, kosso is no more used as tapeworm expel-
lant internationally; but it is still locally traded and
used in rural parts of Ethiopia. In some areas farmers
retain scattered Hagenia trees on their farms because it
enriches the soil by generously shedding its leaves dur
ing the dry season (personal observation, see Fig. 2d).
The leaves, seeds and bark are used as fodder, condiment or spice, and for dyeing textiles
to yellowish red, respectively (http://database.prota.org/PRQTAhtml/Hagenia%20-
abvssinica En.htm). Hagenia is a graceful and beautiful tree of high aesthetic value, es
pecially when in blossom.
1.6 Rationale
Because of its quality timber, H. abyssinica has been logged heavily and selectively. It is
one of the endangered tree species in Ethiopia (Legesse 1995). The Forestry Proclama
tion No. 94/1994 of Ethiopia prohibits the felling of Hagenia abyssinica, Cordia afri-
cana, Afrocarpus falcatus and Juniperus procera (Anonymous 1994). Despite the proc
lamation, the destruction of the populations of these species is continuing unabated be
cause of the lack of mechanisms to enforce the law. Forest decline has many effects on
the giant gene reservoir that is represented within forest trees (Hattemer and Melchior
1993). Old Hagenia trees are dying without recruiting new generation and this has aggra
vated the level of threat on the species.
Fig. 12 Hagenia generously enriching a farm soil in Bon- sho (close to Hagere Mariam). Photo: Taye B Ayele
7
General introduction
In order to develop appropriate conservation strategies that, inter alia, preserve maximum
genetic diversity, it is imperative to know the extent and distribution of genetic variation
within a species (Bawa & Krugman 1990; Loveless and Hamrick 1984). Investigation of
intraspecific genetic variation may help to assess extinction risks and evolutionary poten
tial (fitness) in a changing world (Bawa & Krugman 1990; Hedrick 2001) and is instru
mental to identify appropriate units for conservation of rare and threatened species (New
ton et al. 1999). The preservation o f germplasm in genebanks and the establishment of in
situ and ex situ conservation stands requires sound knowledge of the genetic structure of
a given species in order to capture the optimum genetic and demographic variations. The
genetic diversity of few populations of H. abyssinica was investigated using anonymous
RAPD (Kumilign 2005) and ISSR (Tileye 2007b) markers. Both studies covered small
spatial scale contrasting to the widespread distribution of the species in Ethiopia and were
also limited by the number of samples per population. The chloroplast DNA (cpDNA) of
Hagenia has never been investigated before. Therefore, considering the superior econom
ic and ecological importance and the alarming depletion of the species, it is crucial to in
vestigate the genetic diversity within and among populations of H. abyssinica at the
chloroplast markers and at the total genome level, covering the species' natural distribu
tion range in Ethiopia.
1.7 A ims and predictions
1.7.1 Objectives
The research is aimed at the following objectives:
• to examine the colonization history of H. abyssinica in Africa
• to analyze the phylogeographic pattern o f the species in Ethiopia using DNA and
fossil pollen data
• to assess genetic variation and the association with morphological and ecological
diversities
• to assess and compare genetic variation levels in both sexes
• to use the results of the study to establish conservation strategies for the species.
General introduction
1.7.2 Hypotheses
The following major hypotheses were tested using two types of molecular markers:
Chloroplast microsatellites (Paper I: Colonization history and phylogeography of Hagenia abyssinica (Bruce) J.F. Gmel in Ethiopia inferred from chloroplast microsatellite markers)
1) Due to limited seed dispersal and possibly rare long-distance seed dispersal, there is a
strong differentiation among populations but low variation within populations
2) Populations show geographic structuring primarily induced by mutation and isolation
by distance
3) Based on the existing fossil pollen records, Hagenia immigrated into Ethiopia from
the south
AFLP (Paper II: Spatial distribution of genetic diversity in Hagenia abyssinica (Bruce) J.F. Gmel in Ethiopia assessed by AFLP molecular markers)
1) There is high variation within-populations due to effective gene flow from different
pollen and seed sources and very low differentiation among-populations due to long
distance pollen and seed dispersal
2) The species does not lose genetic diversity during colonization due to effective gene
flow that counteracts effects of genetic drift. Likewise, the populations representing the
two chloroplast lineages show similar levels of genetic diversity, even though the derived
one originated by a single mutational event (from a single seed)
3) Given the wind-dispersed and wind-pollinated nature of Hagenia abyssinica, there is
no fme-scale spatial genetic structure.
9
General introduction
1.7.3 Major research questions
The following major research questions were addressed:
1) What are the levels and patterns o f genetic variation in Hagenia abyssinica (Papers I,
II & III)?
2) Which factors shaped genetic variation patterns of Hagenia in Ethiopia (Papers I &
II)?
3) Is there congruence between molecular data and palynological evidences to infer the
relationships among genealogical lineages and migration routes of the species (Paper I)?
4) Which conservation strategies are appropriate to save Hagenia from extinction (Paper
III)?
10
2 . Research approaches
2.1 Sampling
Twenty two natural and three planted populations were sampled from forests, woodlands
and farmlands known to have stands of H. abyssinica within the various Tree Seed Zones
of Ethiopia. Three of the populations were sampled from church/monastery forests. The
description of the Tree Seed Zones of Ethiopia in which H. abyssinica is growing is an
nexed (Appendix l). The sampled populations represent most of the extant distribution of
the species in the country ranging from 05°5l'39"N (Hagere Mariam) in the south to
13°lr iO " N (Debark Mariam) in the north, and from 35°4l'59"E (Wonbera) in the west
to 40°l4 '32"E (Dindin) in the east. The distance between populations ranges from 2 1 to
806 km and they are located within an altitudinal range of 2200 m asl at Bonga to 3200 m
asl at Wofwasha. The pairwise geographic distance matrix for the 22 natural populations
of Hagenia is presented in Appendix 3. Temperatures range from an absolute minimum
o f-l°C at Dinsho to a maximum of 33.5 °C at Kosso Ber. Maps showing the spatial dis
tribution o f individual trees in each population are provided in Appendix 4.
2.2 Morphological assessment
Dimensional, counted and visually observed morphological variables were assessed from
26-50 trees from each population. Details on the traits assessed are given in Paper I.
2.3 DNA isolation
Young leaves were collected and partially desiccated in paper bags before drying with
silica gel and stored at room temperature before DNA extraction. Total genomic DNA
was isolated from 20 mg leaves after shipment to Germany following the DNeasy 96 kit
protocol of Qiagen® (Hilden, Germany).
11
Research approaches
2.4 Chloroplast microsatellitesThree polymorphic consensus chloroplast microsatellite primers (CCMP2, CCMP6 &
CCMP10 (nomenclature according to Weising and Gardner 1999)) were used to screen
273 samples (9-12 individuals per population) from 25 populations. Details on the me
thods and data analyses are described in Paper I.
2.5 DNA Sequencing
Comparative sequencing o f 18 fragments of the three chloroplast loci was performed to
confirm the amplified regions and to determine the molecular basis for size variation.
Fragments of CCMP2 (224-235 bp) were sequenced directly while fragments o f CCMP6
(140-142 bp) and CCMP10 (96-97 bp) were cloned due to their small sizes. In addition,
fragments from three out-group species from the same family were sequenced for
comparison. Details on the methods and data analyses are described in Paper I.
2.6 AFLP analyses
A total of 596 samples (23-24 individuals/population) were analysed at the nuclear en
coded AFLP markers using the selective primer combination E41-M67 (nomenclature
according to Keygene N.V. ®). Details on the methods are described in Paper II.
12
3. Summary of results
3.1 Morphological data
The morphological traits observed in Hagenia abyssinica were highly variable among
populations. The ranges o f absolute morphological values are presented in Appendix 2.
The one-way analysis of variance (ANOVA) revealed a strikingly significant differentia
tion (p<0.00l) among the 22 natural populations in all morphological traits. The cluster
analysis based on the average taxonomic distances matrix of leaf traits grouped the popu
lations into two major clusters and separated four outlier populations. In general, no clear
association between geographic regions and taxonomic distances could be observed. The
average taxonomic distances for all morphological traits did not show any correlation
with the average Euclidean distances of climatic variables (r = 0 .17062, p = 0.9281), in
dicating lack of association between quantitative morphological traits and climatic vari
ables.
The total number of the extant individual Hagenia trees throughout the country (includ
ing a rough estimation of scattered trees not included in the present study) is estimated as
7,000, the majority of which are old and dying without recruiting new generations. De
tails on the results of morphological and ecological variables are presented in Paper III.
3.2 Chloroplast microsatellite data
The combination of 8 variants from the three chloroplast loci resulted in six haplotypes
that were phylogenetically grouped into two lineages. The haplotypes demonstrated a
very strong geographic pattern as a result of highly restricted gene flow by seeds. The
two lineages were separated by an indel (insertion/deletion) o f 10 nucleotides in locus
CCMP2. The first lineage encompasses haplotypes H4, H5 & H6, which are distributed
in the south-western and northern regions, while the second lineage contains haplotypes
HI, H2 & H3 in the central and southern regions. A remarkable subdivision o f cpDNA
diversity was found in the species as indicated by a high coefficient o f genetic differentia-
13
Summary o f results
tion ( G st = 0. 899, N st = 0. 926). The analysis of molecular variance (AMOVA) showed
that 92.3% of the total genetic diversity is represented among populations. Details on the
results of the chloroplast microsatellite analyses are described in Paper 1.
3.3 Sequence data
Sequencing confirmed homology of the three chloroplast loci to the expected regions of
the chloroplast genome. The observed variation was due to variable numbers of poly (A)
or poly (T) repeats in the microsatellites o f all loci and a large indel o f 10 bp in the flank
ing region of locus CCMP2. In total, there were 4 variable sites: 3 short indels in the mi
crosatellite motifs and one large indel in the flanking region. More details on the se
quence data is provided in Paper I.
3.4 AFLP data
Moderate to high gene diversities were observed at AFLP loci ranging from 13.9% at
Dodola Serofita to 36.2% at Dinsho. The mean gene diversity in subdivided populations
of Hagenia abyssinica showed high within population variation (19.5%) and moderate
but significant population differentiation (F St = 7.7%). The phylogenetic tree derived
from Nei’s (1978) genetic distances congregated the populations into two major clusters,
but does not reflect the geographic origin of the populations. Despite marked differences
in genetic diversities for some populations, mean genetic diversities for the two sexes are
nearly the same (He = 0.207 ± 0.013 for male, He = 0.201 ± 0.019 for female). A test of
association between geographic and genetic distances based on AFLP markers showed a
very low and non-significant correlation (r = 0.14607, p = 0.9024). The multivariate
taxonomic distances of leaf traits are also not correlated with genetic distances (r= -
0.03484, p = 0.3926), showing that the genetic differentiation at neutral AFLPs is not as
sociated with the leaf-morphological differences among populations. Ten out o f 21 natu
ral populations showed significant spatial genetic structure (SGS). Details on the results
o f AFLPs are provided in Paper II.
14
4. General discussion
The palynological data obtained from the existing fossil pollen records suggested a
northward post-glacial colonization of Hagenia in Africa with the oldest available record
from Burundi (ca. 34,000 calibrated years before present (cal yrs BP)). The signal of
Hagenia in the pollen records from Burundi was quite high around 11,500 cal yrs BP
(Bonnefille et al. 1995), whereas its major expansion in the Bale Mountains (southern
Ethiopia) was after 2500 cal yr BP (Mohammed et al. 2004; Mohammed & Bonnefille
1998), suggesting a recent colonization of Ethiopia.
The morphological traits showed a significant differentiation among the 22 natural popu
lations of H. abyssinica. However, the amount and distribution of morphological trait
variation across different habitats, geographic regions and climatic conditions did not
show any pattern. The maximum height of Hagenia has been reported to be 20 meter in
the existing literature (Hedeberg 1989; Azene et al. 1993; Legesse 1995; Tileye 2007a).
However, the present inventory recorded trees growing up to 35 m (mean maximum
height = 21.2 meters, n=l 109). Similarly, the number o f leaflets was reported to be be
tween 5 and 8 on each side (i.e., between 10 and 16 on both sides) whereas the present
inventory provided a wider range of 7 to 19 leaflets on both sides, but always in odd num
bers because of the presence of an apical leaflet. The lack of correlation between the Euc
lidean distances of morphological and climatic data suggests that the observed morpho
logical traits are not involved in the adaptation to different climatic conditions.
The chloroplast DNA analysis revealed a strong differentiation among populations, but
low variation within populations. The very high level of genetic variation among popula
tions o f Hagenia at cpDNA suggested a restricted migration o f seeds among regions,
which is also reflected in the observed geographic structuring of haplotypes (Fig. 3 of
paper I). The coefficient of population differentiation (G st) in Hagenia is higher than or
comparable to Gst values recorded for other species with heterogeneous mode of seed
dispersal, including wind dispersal, investigated by chloroplast markers (Newton et al.
1999, Petit et al. 2003). The geographic distribution of chloroplast haplotypes and their
15
General discussion
genealogical relationships observed in Hagenia demonstrated a highly significant asso
ciation. The nested clade phylogeographic analysis (NCPA) inferred that restricted gene
flow associated with contiguous range expansion and rare long-distance seed dispersal
shaped the genetic structure in the chloroplast DNA of Hagenia. The chloroplast data
suggests that Hagenia colonized Ethiopia first through the southwest mountains (popula
tion Bonga, BG).
The moderately high genetic diversity at AFLPs of Hagenia reflects effective gene flow
within populations from different pollen and seed sources, resulting in a very low popula
tion differentiation, which in turn reflects effective long-distance pollen dispersal. Inter
estingly, the maximum genetic diversity was recorded for a well-protected Park Forest
(Dinsho) whereas the lowest gene diversities were recorded for the two farmland popula
tions (Doddola Serofta and Hagere Mariam), pointing to negative human impact on ge
netic diversity. Nybom (2004) reported a slightly higher mean within-population diver
sity (Hpop) of 0.22 at RAPD, 0.23 at AFLP and 0.22 at ISSR markers. The overall mean
gene diversity o f Hagenia at AFLPs (He = 0.195) is comparable to some other plant spe
cies such as the insect-pollinated Hibiscus tiliaceus (Malvaceae, He = 0.198, Tang et al.,
2003) and the wind-pollinated Acanthopanax sessiliflorus (Araliaceae, He = 0.187, Huh
et al., 2005) but lower than the insect-pollinated Malus sylvestris (Rosaceae, He = 0.225,
Coart et al., 2003). H. abyssinica exhibited higher mean gene diversity than some other
tropical and subtropical tree species such as the bird-pollinated Lobelia giberroa (Apocy-
naceae, He = 0.066, Mulugeta, et al. 2007) the insect-pollinated Shorea leprosula (Dip-
terocarpaceae, He = 0.161, Cao et al. 2006), the insect-pollinated Shorea parvifolia (Dip-
terocarpaceae, He = 0.138, Cao et al. 2006), the insect and wind-pollinated Acer skutchii
(Sapindaceae, He = 0.15, Lara-Gomez et al., 2005) and the bird-pollinated Pelliciera
rhizophorae (Pellicieraceae, Ht = 0.117, Castillo-Cardenas et al. 2005) at AFLP loci.
Tileye et al. (2007) reported higher mean gene diversity (0.30) in 12 populations o f
Hagenia from central and southern regions of Ethiopia at ISSR markers. But Qian et al.
(2001) and Nybom (2004) argued that ISSR markers generally over-estimate gene diver
sity as compared to other markers. Hagenia also showed lower mean gene diversity than
some other tree species growing in Ethiopia investigated with AFLP markers, notably,
16
General discussion
the insect-pollinated Cordia africana (Boraginaceae, He = 0.287, Abayneh 2007) and the
wind-pollinated Juniperusprocera (Cupressaceae He = 0.269, Demissew 2007).
No trend of decreasing genetic diversity during colonization was detected, reflecting ef
fective gene flow. In contrast, Lobelia giberroa, which entered Ethiopia also from the
south (Mulugeta, et al. 2007), Carpinus betulus (Betulaceae) in Europe (Coart et al.
2005) and Ptercarpus officinalis (Fabaceae) in the Caribbean (Rivera-Ocasio et al. 2002)
demonstrated decreasing diversity during recolonization (all based on AFLP analyses).
Comparable levels of population differentiation were found at AFLPs of Cordia africana
(Abayneh 2007), Acer skutchii (Lara-Gomez et al. 2005), Acanthopanax sessilijlorus
(Huh et al. 2005) and Carpinus spp (Coart et al. 2005). Tileye et al. (2007b) found a
higher coefficient of differentiation among 12 populations of Hagenia at ISSR markers.
Higher coefficients o f population differentiation than Hagenia were also reported for
Shorea species (Cao et al. 2006), Hibiscus tiliaceus (Tang et al. 2003) and Pelliciera
rhizophorae (Castillo-Cardenas et al. 2005). On the other hand, FSt values lower than that
of Hagenia were reported for wild Malus sylvestris (Coart et al. 2003).
The population differentiation is much higher in the chloroplast genome than in the nu
clear genome of Hagenia abyssinica, as revealed by ISSR (Gst = 0.25; Tileye et al.
2007a) and AFLP markers (F st = 0.077, Paper II). Likewise, Rendell and Ennos (2002)
found a population differentiation that was 10-fold higher in the chloroplast genome of
Calluna vulgaris (L.) Hull (Ericaceae), than in the nuclear genome. In general, maternally
inherited genomes experienced considerably more subdivision (mean G st value of -0.64)
than biparentally inherited genomes (mean G st value o f -0.18) of angiosperm species
(reviewed by Petit et al. 2005). Due to its maternal inheritance, cpDNA in angiosperms is
transmitted only through seeds and therefore show a higher differentiation among popula
tions than nuclear genes that are biparentally inherited. Consequently, genetic variation in
the chloroplast genome often shows a strong geographical structure than the nuclear ge
nome (e.g., Cavers et al. 2003).
17
General discussion
A weighted-score population prioritization matrix (WS-PPM) that combines genetic,
morphological and demographic criteria is developed and used for the first time to pri
oritize populations of Hagenia for conservation and domestication. Paper III describes
the prioritization process and also provides separate priority lists for in situ conservation,
ex situ conservation, and for tree improvement and domestication programs.
5. Conclusions and outlook
The present study at both morphological and molecular markers contributed valuable re
sults that increased our understanding on the patterns of genetic diversity in Hagenia
abyssinica and provided useful information for planning conservation, tree improvement
and domestication programs. It was possible to infer the phylogeography, colonization
history and the factors shaping the genetic variation of the species from chloroplast mi
crosatellite and AFLP markers.
The chloroplast haplotypes of Hagenia abyssinica demonstrated a pattern of isolation by
distance. Due to the recent colonization of the country by the species, it was possible to
identify rare long-distance dispersal and mutation events that contributed in shaping the
genetic structure of the species at chloroplast (cp) DNA. A remarkable subdivision of
cpDNA diversity was found as indicated by a high coefficient o f genetic differentiation.
The study demonstrated that restricted gene flow, contiguous range expansion and rare
long-distance seed dispersal events shaped the genetic structure in the chloroplast ge
nome of Hagenia in Ethiopia. Unlike most of the wind-dispersed tree species, the chlo
roplast haplotypes found in Hagenia showed a clear pattern of congruence between their
geographical distribution and genealogical relationships.
Despite the relatively recent immigration of Hagenia abyssinica into Ethiopia, popula
tions showed moderate to high gene diversities (//e = 0.139-0.362), and moderate but sig
nificant genetic differentiation (Fst = 0.077), reflecting high levels of post-colonization
gene flow among populations. The moderate to high intraspecific variation and a wide
vertical distribution of the populations (2200 to 3200 m asl) may suggest that Hagenia
might have occupied wider areas in the past than at present. The sizes of the extant popu
lations were reduced to very small patches due to human impact, apparently affecting
their genetic structure.
The populations o f Hagenia abyssinica are severely decreasing without recruiting young
trees except for Bonga, the only viable population in southwest Ethiopia. Hagenia
19
Conclusions and outlook
should, therefore, be recognised as a critically endangered tree species and urgent action
is needed to save it from extinction.
Analysis of cpDNA types, intraspecific genetic variation and palynological inventories,
including all countries where the species is known to grow, 1) would fully resolve the
genealogical relationships within the natural distribution range of the species, 2) help to
identify the glacial refugia, and 3) is indispensable to fully understand the colonization
history of Hagenia in Africa. The screening of a large number of AFLP markers in segre
gating populations may help to identify markers for sex determination in Hagenia. The
pollination mechanism o f Hagenia that has been reported elsewhere (wind) should be re
examined in view o f the tree’s investment o f energy to produce alluring flowers.
20
6. Summary
Deforestation and forest fragmentation in general, and extraction of timber in the form of
selective logging in particular have serious consequences on the long-term maintenance
of genetic diversity and fitness in plants. It is imperative to know the extent and distribu
tion of genetic variation within a given species in order to develop appropriate conserva
tion strategies that inter alia preserve “optimum” genetic diversity. The genetic variation
of Hagenia abyssinica (Bruce) J.F. Gmel has been investigated at morphological and mo
lecular markers in order to identify populations for conservation, tree improvement and
domestication programs.
The monotypic species Hagenia abyssinica (Rosaceae) is an anemogamous and anemo-
chorous broad-leaved dioecious tree species that is native to Africa. The major aims of
this study are to 1) examine the colonization history of Hagenia abyssinica in Africa, 2)
analyze the phylogeographic pattern of the species using DNA and pollen data, 3) assess
genetic variation and the association with morphological and ecological diversities, 4)
assess genetic variation levels in both sexes, and 5) use the results to establish conserva
tion strategies for the species.
The colonization history of Hagenia abyssinica is inferred from the existing fossil pollen
records. The fossil pollen evidences suggested that postglacial colonization of Hagenia
followed a northward route in Africa and that it immigrated into Ethiopia from the south
during the late Pleistocene (since 16,700 years Before Present). Morphological and mole
cular genetic analyses were performed in 22 natural and 3 planted populations sampled
from the natural distribution range of the species within the Ethiopian highlands. Dimen
sional, counted and visually observed morphological variables were assessed for a total
of 1109 trees (26-50 individuals per population). Two molecular marker techniques,
namely, chloroplast microsatellites and nuclear encoded AFLP markers were employed
to investigate genetic diversity and to infer the factors shaping the genetic variation, phy-
logeography, and colonization history of the species. The genetic variation of 273 indi
viduals from 25 populations was analysed at three polymorphic chloroplast microsatellite
21
Summary
markers (CCMP2, CCMP6 & CCMP10). Homology of the three loci to the respective
regions of the chloroplast genome was confirmed by comparative sequencing of 21 frag
ments. The intraspecific genetic variation o f 596 individuals from 25 populations was
analysed at the AFLP markers using the selective primer combination E41-M67 (nomen
clature according to Keygene N.V.®).
The analysis o f variance (ANOVA) revealed a significant differentiation among the 22
natural populations of Hagenia abyssinica in all quantitative morphological traits
(p<0.001). However, the global multivariate analyses o f the entire morphological data set
did not clearly separate the individuals among the populations. The average taxonomic
distances for all morphological traits did not show any correlation with the average
Euclidean distances o f climatic variables (r = 0.17062, p = 0.9281), indicating a lack of
association between quantitative morphological traits and climatic variables. The cluster
analysis based on the average taxonomic distances of leaf characters showed a geograph
ical pattern with few exceptions and assembled the populations into two major clusters
and separated four outlier populations from the rest.
The analysis o f cpDNA using microsatellite markers revealed a total of six haplotypes
that were phylogenetically grouped into two lineages. The chloroplast haplotypes identi
fied in Hagenia demonstrated a strong pattern o f congruence between their geographical
distribution and genealogical relationships. Eighty percent of the populations were fixed
on one type. A very low haplotype diversity within populations (hs = 0.079, vs = 0.058)
and a remarkable subdivision of cpDNA diversity (G St = 0. 899, NSt = 0. 926) was ob
served. The study demonstrated that restricted gene flow through seeds, contiguous range
expansion and mutation shaped the genetic structure in the chloroplast genome o f
Hagenia. Due to the recent colonization o f the country by the species, it was also possible
to identify rare long-distance dispersal events that contributed in shaping the genetic
structure of the species in Ethiopia.
Out of 106 unequivocally scored AFLP markers, 91.5% were polymorphic. Despite the
relatively recent immigration of Hagenia abyssinica into Ethiopia, populations showed
22
Summary
moderate to high gene diversities (Hs = 0.139-0.362), and moderate but significant ge
netic differentiation (Fst = 0.077), reflecting high levels of post-colonization gene flow
particularly by pollen among populations. There were no significant differences in gene
diversity between sexes, even though single populations exhibited marked differences.
AFLP profiles did not show any diagnostic markers for neither of the two sexes. No trend
of decreasing genetic diversity was detected during colonization, confirming effective
gene flow among populations. Despite the dispersal o f seed and pollen o f Hagenia by
wind, a significant non-random fine-scale spatial genetic structure (SGS) is observed up
to 80 m in some populations.
The multivariate taxonomic distances of leaf traits is not correlated with Nei’s genetic
distances (r= -0.03484, p = 0.3926), showing that the genetic differentiation at anony
mous AFLPs is not associated with the leaf-morphological differences among popula
tions. As expected, the coefficient of population differentiation is found to be much lower
for the biparentally inherited nuclear genome (represented by AFLPs) of Hagenia abys
sinica than in the maternally inherited chloroplast genome. Comparative analyses of the
amount and distribution of the genetic diversity of Hagenia abyssinica with other tree
species are provided. In conclusion, population history can be reconstructed by chlorop
last microsatellite data reflecting seed dispersal while AFLPs identify geographic regions
and populations of high genetic diversity. A weighted-score population prioritization ma
trix (WS-PPM) that combines genetic, morphological and demographic criteria was de
veloped and used for the first time to prioritize populations for in situ conservation, ex
situ conservation, and for tree improvement and domestication programs. Extremely ur
gent decision is needed to launch conservation and massive plantation programs of the
African redwood to ensure the long-term survival o f the species and to boost its economic
and ecological values.
23
7. Zusammenfassung
Besiedlungsgeschichte, Phylogeografie und Erhaltungsgenetik der vom Aussterben
bedrohten Baumart Hagenia abyssinica (Bruce) J. F. Gmel in Athiopien
Abholzung und Fragmentierung von Waldem im Allgemeinen, und im Besonderen die
Entnahme von Holz bei der selektiven Abholzung, haben emste Auswirkungen auf die
Langzeiterhaltung genetischer Diversitat und auf die biologische Fitness von Pflanzen. Es
ist zwingend notwendig das AusmaB und die Verteilung von genetischer Variation in ei-
ner Art zu bestimmen, um angemessene Schutzstrategien zu entwickeln, die unter ande-
rem eine hohe genetische Diversitat erhalten. Die genetische Variation von Hagenia
abyssinica (Bruce) J. F. Gmel wurde mit Hilfe von morphologischen und molekularen
Markem untersucht, um Populationen fur Artenschutz und Zuchtung zu identifizieren.
Die monotypische Art Hagenia abyssinica (Rosaceae) ist eine anemogame und anemo-
chore diozische Laubbaumart, die in Afrika heimisch ist. Die Hauptziele dieser Studie
sind 1) ihre Besiedlungsgeschichte in Afrika zu untersuchen, 2) ihre phylogeografischen
Muster mit Hilfe von DNA- und Pollendaten zu analysieren, 3) die genetische Variation
und ihre Beziehung zur morphologischen und okologischen Diversitat zu berechnen, 4)
das AusmaB an genetischer Variation in beiden Geschlechtem abzuschatzen, und 5) die
Ergebnisse zu nutzen, um ErhaltungsmaBnahmen einzuleiten.
Die Besiedlungsgeschichte von Hagenia abyssinica wurde von anderen Autoren mit Hil
fe von fossilen Pollenvorkommen rekonstruiert. Die fossilen Pollen deuten auf eine
nordwarts gerichtete postglaziale Kolonisierungsroute von Hagenia in Afrika hin. Die
Art ist vermutlich im spaten Pleistozan (ab 16,700 Jahren vor heute) aus dem Siiden nach
Athiopien eingewandert. Morphologische und molekulare Analysen wurden in 22 natur-
lichen und drei angepflanzten Populationen im natiirlichen Verbreitungsgebiet der Art im
Hochland von Athiopien durchgefuhrt. Morphologische Eigenschaften wurden bei insge-
samt 1109 Baumen (26 bis 50 Baume pro Population) untersucht. Zwei molekulare Mar
ker, Chloroplastenmikrosatelliten und kemkodierte AFLP-Marker, wurden angewandt,
24
Zusammenfassung
um die genetische Diversitat zu untersuchen und um die Faktoren zu bestimmen, die ge
netische Variation, Phylogeographie und Besiedlungsgeschichte der Art gepragt haben.
Die genetische Variation von 273 Baumen wurde mit drei Chloroplastenmikrosatelliten
(CCMP2, CCMP6 & CCMP10) analysiert. Die Homologie der drei Genorte zu den zuge-
horigen Regionen des Chloroplastengenoms wurde durch vergleichende Sequenzierungen
von 21 Fragmenten bestatigt. Die intraspezifische genetische Variation von 596 Genoty-
pen aus 25 Populationen wurde mit AFLPs untersucht, wobei die Primerkombination
E41-M67 verwendet wurde (Nomenklatur entsprechend Keygene N.V.®).
Durch Varianzanalysen (ANOVAs) wurde eine signifikante Differenzierung zwischen
den 22 natiirlichen Populationen von Hagenia abyssinica in alien quantitativen morpho
logischen Merkmalen festgestellt (p<0.001). Allerdings konnten durch umfassende mul
tivariate Analysen des gesamten morphologischen Datensatzes nicht alle Individuen den
Populationen zugeordnet werden. Die durchschnittliche taxonomische Distanz aller mor
phologischen Merkmale war nicht mit den durchschnittlichen euklidischen Distanzen
klimatischer Variablen korreliert (r=0.17062, p=0.9281. Clusteranalysen, basierend auf
einer Matrix aus durchschnittlichen taxonomischen Distanzen von Blattmerkmalen, wie-
sen ein geographisches Muster mit wenigen Ausnahmen auf. Es konnten zwei „Haupt-
cluster“ und 4 davon getrennte „Nebencluster“ unterschieden werden.
Die Analyse von cpDNA-Mikrosatelliten ergab sechs Haplotypen, die phylogenetisch in
zwei Linien eingruppiert werden konnten. Die in Hagenia identifizierten Haplotypen
zeigten eine starke Ubereinstimmung zwischen ihrer geographischen Verteilung und ihrer
Abstammung. Achtzig Prozent der Populationen waren auf einen Haplotyp fixiert. Es
wurde eine sehr geringe Diversitat an Haplotypen innerhalb der Populationen (hs=0.079,
vs=0.058) und eine deutliche Untergliederung der cpDNA Diversitat zwischen den Popu
lationen (Gst=0.899, NSt=0.926) festgestellt. Die vorliegende Studie zeigte, dass einge-
schrankter GenfluB durch Samen, ein gleichmaBige Ausbreitung und Mutationen die ge
netische Struktur im Chloroplastengenom von Hagenia beeinfluBt haben. Aufgrund der
rezenten Besiedlung des Landes durch die Art war es zusatzlich moglich, seltene Verbrei-
25
tungsereignisse tiber weite Strecken zu identifizieren, die an der Ausbildung der geneti-
schen Struktur der Art in Athiopien beteiligt waren.
Von 106 AFLP Markem waren 91.5% polymorph. Die Populationen wiesen eine mittlere
bis hohe genetische Diversitat (He=0.139-0.362) und eine niedrige aber signifikante gene
tische Differenzierung auf (Fst=0.077). Diese Ergebnisse spiegeln einen hohen GenfluB
nach der Besiedlung besonders durch Pollenflug zwischen den Populationen wider. Es
zeigten sich keine signifikanten Unterschiede zwischen mannlichen und weiblichen Indi-
viduen hinsichtlich ihrer mittleren genetischen Diversitat, obgleich in den einzelnen Po
pulationen deutliche Unterschiede auftreten konnten. Die AFLP- Profile zeigten keine
diagnostischen Marker fur die beiden Geschlechter. Anders als in viele anderen Baumar-
ten erhohte sich die genetische Diversitat wahrend der Besiedlung. Daraus kann ge-
schlossen werden, dass GenfluB und Mutationen in Verbindung mit der Besiedlungsge
schichte einen starken Einfluss auf die intraspezifische Variation von Hagenia hatten.
Die multivariate taxonomische Distanzmatrix der Blattmerkmale ist nicht mit Nei's gene
tischer Distanzmatrix korreliert (r=-0.03484, p=0.3926), da genetische Differenzierung
an neutralen AFLPs nicht mit blattmorphologischen Unterschieden zwischen Populatio
nen assoziiert ist. Wie erwartet, ist der Koeffizient der Populations-differenzierung im
biparental vererbten Kemgenom (reprasentiert durch AFLPs) sehr viel kleiner als im ma
ternal vererbten Chloroplastengenom. Es werden vergleichende Analysen der genetischen
Diversitat und der Differenzierung von Hagenia abyssinica mit anderen Baumarten dar-
gestellt. Zusammenfassend lasst sich feststellen, dass die Populationsgeschichte mit
Chloroplastenmikrosatelliten, welche die Verbreitung der Samen widerspiegeln, rekons-
truiert werden kann, wahrend die AFLP-Daten geografische Regionen und Populationen
mit hoher genetischer Diversitat identifizieren konnen. Eine Weighted-Score Population
Prioritization Matrix (WS-PPM), die genetische und demografische Kriterien vereint,
wurde entwickelt und genutzt, um Schwerpunktpopulationen fur in ,v//«-Erhaltung, ex si-
/w-Erhaltung, und fur Zucht- und Ertragsprogramme zu finden. Sehr schnelle Entschei-
dungen sind notig, um Programme zur Arterhaltung und groBangelegte Plantageprojekte
Zusammenfassung
26
von afrikanischem Rotholz zu starten, die ein Uberleben der Art iiber lange Zeitraume
und ihren okonomischen und okologischen Nutzen sichem konnen.
Zusammenfassung
27
8. References
Abayneh D (2007) Genetic variation in Cordia africana Lam. in Ethiopia. PhD thesis, Georg-August University of Gottingen.
Aalbaek A (1993) Tree seed zones for Ethiopia. National Tree Seed Project, Addis Ababa
Anonymous (1994) Forest Conservation, Development and Utilization Proclamation. Proclamation No. 94/1994. Negarit Gazeta. The Transitional Government of Ethiopia. Addis Abeba, Ethiopia.
Avise JC (2004) Molecular Markers, Natural History and Evolution, 2nd edn. Sinauer Associates Inc, Sunderland, MA.
Azene BT, Bimie A, Tegnas B (1993) Useful Trees and Shrubs fo r Ethiopia: Identification, Propagation and Management fo r Agricultural and Pastoral Communities. Technical Handbook No. 5, Regional Conservation Unit, Swedish International Development Authority (SIDA).
Barrett SCH, Kohn JR (1991) Genetic and evolutionary consequences of small population size in plants: implications for conservation. In: Falk DA & Holsinger KE (eds) Genetics and conservation o f rare plants. Oxford University Press, New York.
Bawa KS, Krugman SL (1990) Reproductive biology and genetics of tropical trees in relation to conservation and management. In: Rain Forest Regeneration and Management (eds Gomez-Pampa A, Whitmore TC, Hadley M), pp. 119-136. The Parthenon Publishing Group.
Berhanu M. Abegaz, Ngadjui BT, Merhatibeb Bezabih, Mdee LK (1999) Novel natural products from marketed plants of eastern and southern Africa. Pure and Applied Chemistry 71:919-926.
Bonnefille R, Riollet G, Buchet G, Icole M, Lafont R, Arnold M, Jolly D (1995) Glacial/interglacial record from intertropical Africa, high resolution pollen and carbo data at Rusaka, Burundi. Quaternary Science Reviews 14: 917-936.
Cao, C-P., Finkeldey, R., Siregar, I.Z., Siregar, U.J., Gailing, O. (2006). Genetic diversity within and among-populations o f Shorea leprosula Miq. and Shorea parvifolia Dyer (Dipterocarpaceae) in Indonesia detected by AFLPs. Tree Genetics and Genomes 2: 225-239.
Castillo-Cardenas MF, Toro-Perea N, and Cardenas-Henao H (2005) Population genetic structure of neotropical Mangrove species on the Colombian Pacific Coast: Pelliciera rhizophorae(Pellicieraceae). Biotropica 37: 266-273.
Cavers S, Navarro C, Lowe AJ (2003) Chloroplast DNA phylogeography reveals colonization history of a Neotropical tree, Cedrela odorata L., in Mesoamerica. Molecular Ecology 12: 1451-1460.
References
Coart, E., Van Glabeke, S., Petit, R.J., Van Bockstaele, E. and Roldan-Ruiz, 1. 2005). Range wide versus local patterns of genetic diversity in hornbeam (Carpinus betulus L.). Conservation Genetics 6: 259-273.
Coart E, Vekemans X, Smulders MJM, Wagner I, Huylenbroeck JV, Bockstaele EV and Roldan-Ruiz I (2003) Genetic variation in the endangered wild apple (Mains sylve- stris (L.) Mill.) in Belgium as revealed by amplified fragment length polymorphism and microsatellite markers. Molecular Ecology 12: 845-857.
Comps, B., Gomory, D., Letouzey, J., Thiebaut, B. and Petit, R.J. (2001) Diverging trends between heterozygosity and allelic richness during post glacial colonization in the European beech. Genetics 157: 389-397.
Dawit Abebe, Ahadu Ayehu (1993) Medicinal Plants and Enigmatic Health Practices o f Northern Ethiopia. BSPE, Addis Ababa, Ethiopia.
Demissew SD (2007) Genetic variation of Juniperus procera Hochst. Ex Endl. populations in Ethiopia assessed by using microsatellite (SSR) and AFLP markers. MSc. Thesis. Georg-August University of Gottingen.
Dumolin-Lapegue S, Demesure B, Fineschi S, Le Corre V, Petit RJ. (1997) Phylogeo- graphic structure of white oaks throughout the European continent. Genetics 146:
1475-1487.
Ehrlich PR, Ehrlich AH (1991) Healing the planet. Addison-Wesly, Reading, MA.
Ellstrand NC, Elam DR (1993) Population genetic consequences of small population size: implications for plant conservation. Annual Review o f Ecology and Systematics 24 :
217-241.
Eriksson T, Hibbs MS, Yoder AD, Delwiche CF, Donoghue MJ (2003) The phytogeny of Rosoideae (Rosaceae) based on sequences of the internal transcribed spacers (ITS) of nuclear ribosomal DNA and the trnl/f region of chloroplast DNA. International Journal o f Plant Sciences 164: 197-211.
Fichtl R, Admasu A (1994). Honeybee flora o f Ethiopia. DED - Margraf Verlag, Wei- kersheim.
Finkeldey R, Hattemer HH (2007) Tropical Forest Genetics. Springer-Verlag, Berlin.
Friis I (1992) Forests and Forest Trees o f Northeast Tropical Africa: Their Natural Habitats and Distribution Patterns in Ethiopia, Djibouti and Somalia. Kew Bulletin ,
Additional Series XV. Her Majesty's Stationery Office, London.
Getachew Desalegn (2006) Some Basic Physical And Mechanical Properties O f The Valuable Hagenia abyssinica Timber And Their Interactions: Imlpication For Its Rational Utilization, Ethiopian Journal o f Biological Sciences 5 ( 2): 117-135.
29
References
Girma Balcha (1999) Status of forest seed research in Ethiopia: Consequences for development of forest genetic resources conservation strategy. In: Abebe, et al. (eds). Forest Genetic Resources Conservation: Principles, Strategies and Actions. Proceedings of the National Forest Genetic Resources Conservation Strategy Development Workshop, June 21-22, Addis Abeba.
Hattemer HH & Melchior GH (1993) Genetics and its application to tropical forestry. In Pancel L (Ed). Tropical Forestry Handbook Vol 1, Springer-Verlag, Berlin.
Hedeberg O (1989) Rosaceae. In: Inga Hedeberg and Sue Edwards, eds. Flora o f Ethiopia, Vol. 3, Pittosporaceae to Arralaceae. Addis Abeba and Asmara, Ethiopia; Uppsala, Sweden.
Hedrick PW (2001) Conservation genetics: where are we now? Trends in Ecology and Evolution 16: 629-636.
Heuertz M, Fineschi S, Anzidei MA et al. (2004) Chloroplast DNA variation and postglacial recolonization o f common ash (Fraxinus excelsior L.) in Europe. Molecular Ecology 13: 3437-3452.
Huh M.K, Huh H.W. and Back K. (2005) Genetic diversity and population structure of Acanthopanax sessiliflorus (Araliaceae) using AFLP. Korean Journal o f Genetics 27: 71-79.
Jansen P.C.M. (1981) Spices, condiments and medicinal plants in Ethiopia, their taxonomy and agricultural significance. Wageningen.
Jump AS, Penuelas P (2007) Extensive spatial genetic structure revealed by AFLP but not SSR molecular markers in the wind-pollinated tree, Fagus svlvatica. Molecular Ecology 16: 925-936.
King RA, Ferris C (1998) Chloroplast DNA phylogeography o f Alnus glutinosa (L.) Gaertn. Molecular Ecology 7: 1151-1163.
Kumilign A (2005) Estimation of sex-related genetic diversity of Hagenia abyssinica (Bruce) J.F. Gmel. M.Sc. thesis, Addis Ababa University.
Laikre L, Ryman N (1996) Effects on intraspecific biodiversity from harvesting and enhancing natural populations. Ambio 25: 504-509.
Lara-Gomez G., Gailing O., and Finkeldey R. (2005) Genetic variation in isolated Mexican populations of the endemic maple Acer skutchii Rehd. Allg Forst- u J-Ztg 176: 97-103.
Legesse N (1995) Indigenous trees o f Ethiopia: Biology, uses and propagation techniques. SLU, Reprocentralen, Umea.
Loveless MD, Hamrick JL (1984) Ecological determinants of genetic structure in plant populations. Annual Review o f Ecology andSystematics 15: 65-95.
Luu H.T. (2005) Genetic variation and the reproductive system of Dipterocarpus cf.
30
References
condorensis Pierre in V ietnam . PhD Thesis, G eorg-A ugust University o f Gottingen.
Meister J, Hubaishan MA, Killian N, Oberprieler C (2005) Chloroplast DNA variation in the shrub Justicia areysiana (Acanthaceae) endemic to the monsoon affected coastal mountains of the southern Arabian Peninsula. Botanical Journal o f the Linean Society 148: 437-444.
Mohammed MU, Bonnefille R (1998) A Late Glacial to Late Holocene pollen record from a high land peat at Tamasaa, Bale mountains, South Ethiopia. Global and Planetary change 16-17: 121-129.
Mohammed U, Dagnachew Legesse, Gasse F, Bonnefille R, Lamb HF, Leng MJ (2004) Late quaternary climate changes in the Horn o f Africa. In: Past climate variability through Europe and Africa (eds Battarbee RW, Gasse F, Stickly CE. Kluwer Academic Publishers, Dordrecht, the Netherlands.
Mulugeta K, Ehrich D, Taberlet P, Sileshi N and Brochmann C (2007) Phylogeography and conservation genetics o f a giant lobelia (Lobelia giberroa) in Ethiopian and Tropical East African mountains. Molecular Ecology 16: 1233-1243.
Nei. M. (1978) Estimation o f average heterozygosity and genetic distance from a small number o f individuals. Genetics 89 : 583-590.
Newton AC, Allnutt TR, Gillies ACM, Lowe AJ, Ennos RA (1999) Molecular phylogeography, intraspecific variation and the conservation of tree species. Trends in Ecology and Evolution 14: 140-145.
Nybom H (2004) Comparison of different nuclear DNA markers for estimating intraspecific genetic diversity in plants. Molecular Ecology 13: 1143-1155.
Pankhurst R (1969) The Traditional Taenicides of Ethiopia. Journal o f the History o f Medicine and Allied Sciences (XXIV): 323-334.
Petit RJ, Aguinagalde I, de Beaulieu J-L, et al. (2003) Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300 : 1563-1565.
Petit RJ, Duminil J, Fineschi S, Hampe A, Salvini D, Vendramin GG (2005) Comparative organization o f chloroplast, mitochondrial and nuclear diversity in plant populations. Molecular Ecology' 14: 689-701.
Qian J, Luscombe NM, Gerstein M (2001) Protein family and fold occurrence in genomes: power-law behaviour and evolutionary model. Journal o f Molecular Biology 313: 673-681.
Rendell S, Ennos RA (2002) Chloroplast DNA diversity in Calluna vulgaris (heather) populations in Europe. Molecular Ecology 11: 69-78.
Rivera-Ocasio E, Aide TM, McMillan WO (2002) Patterns o f genetic diversity and bio- geographical history of the tropical wetland tree, Pterocarpus officinalis (Jacq.), in the Caribbean basin. Molecular Ecology 11: 675-683.
31
References
Tang T, Zhong Y, Jian SG, Shi SH (2003) Genetic diversity of Hibiscus tiliaceus (Malvaceae) in China assessed using AFLP markers. Annals o f Botany 92: 409-414.
Tileye F, Welander M, Legesse N (2005a) Microporopagation of Hagenia abyssinica: a multipurpose tree. Plant Cell, Tissue and Organ Culture 80: 119-127.
Tileye F, Welander M, Legesse N (2005b) In vitro regeneration o f Hagenia abyssinica (Bruce) J.F. Gmel.(Rosaceae) from leaf explants. Plant Cell Reports 24: 392-400.
Tileye F, Nybom H, Bartish IV, Welander M (2007a) Analysis of genetic diversity in the endangered tropical tree species Hagenia abyssinica using ISSR markers. Genetic Resources and Crop Evolution 54: 947-958.
Tileye F, Zhu L-H, Legesse N, Welander M (2007b) Regeneration and genetic transformation of Hagenia abyssinica (Bruce) J.F. Gmel.(Rosaceae) with rolB gene. Plant Cell, Tissue and Organ Culture 88 : 277-288.
Vos P, Hogers R, Bleeker M, Reijans M, Lee Th van der, Homes M, Frijters A, Pot J, Peleman J, Kuiper M and Zabeau M (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research 23(21): 4407-4414.
WBISPP (2004) Forest resources o f Ethiopia. Woody Biomass Inventory and Strategic Planning project. Addis Ababa.
White F (1983) The vegetation o f Africa: A descriptive memoire to accompany the UNESCO/AETFAT/UNESCO vegetation maps o f Africa. UNESCO, Paris.
Young A, Boshier D, Boyle T (ed.) (2000) Forest Conservation Genetics: Principles and Practice. CABI Publishing.
Young A, Boyle T, Brown T (1996) The population genetic consequences o f habitatfragmentation for plants. Trends in Ecology and Evolution 11: 413—41
32
9. Papers submitted to journals
I. Colonization history and phylogeography of Hagenia abyssinica (Bruce) J.F. Gmel in Ethiopia inferred from chloroplast microsatellite markers
Taye Bekele Ayele,*1 Oliver Gailing,* Mohammed Umer* and Reiner Finkeldey*
Forest Genetics and Forest Tree Breeding, Georg-August University, Biisgenweg 2,
37077 Gottingen, Germany
^Department of Earth Sciences, Addis Ababa University, P.O.Box 1176, Addis Ababa,
Ethiopia
A bstract We investigated genetic variation o f 273 individuals from 25 populations
of the monotypic species Hagenia abyssinica (Rosaceae) from the highlands of Ethiopia
at three chloroplast microsatellite markers. The objectives were to infer the factors that
shaped the genetic structure and to reconstruct the colonization history of the species. Six
haplotypes that were phylogenetically grouped into two lineages were identified. Homol
ogy of the three loci to the respective regions of the chloroplast genome was confirmed
by sequencing. The chloroplast haplotypes found in Hagenia showed a clear pattern of
congruence between their geographical distribution and genealogical relationships. A
very low haplotype diversity within populations (hs = 0.079, vs = 0.058) and a very high
population differentiation (G st = 0.899, N st = 0.926) was observed. Restricted gene flow
through seeds, rare long-distance dispersal, contiguous range expansion and mutation
shaped the genetic structure of Hagenia. Fossil pollen records suggested that Hagenia
immigrated into Ethiopia from the south.
Key words: chloroplast microsatellite, colonization history, genealogical relation
ships, geographical structure, Hagenia abyssinica, haplotype diversity, phylogeo
graphy.
33
Paper I: Colonization history and phylogeography
Introduction
Genetic variation is structured not only by the contemporary forces of genetic exchange
but also by historical patterns of relationship (e.g., Schaal et al. 1998) Phylogeographic
analyses can provide insights into the historical processes responsible for restricted dis
tributions of populations (Cruzan and Templeton 2000). Phylogeography characterizes
population subdivision by recognizing geographical patterns of genealogical structure
across the range of a species (Avise 1994), synthesizing the influence of both history and
current genetic exchange (Schaal et al. 1998). Cladistic gene genealogies can form the
basis of historical approaches to the study of intraspecific processes (Schaal et al. 1998,
Templeton et al. 1987, Templeton 2004). Rare long-distance gene flow events potentially
have great evolutionary significance (Le Corre et al. 1997, Schaal et al. 1998, Cain et al.
2000) and great biological relevance by shaping genetic variation (Ouborg et al 1999).
Rare dispersal events produce fragmented advancing fronts establishing new populations
as a result of dispersal from pioneer populations, as well as from populations that are part
o f the continuous distribution (Cruzan and Templeton 2000). Cain and co-workers (2000)
argued that rare events can control the rate o f population spread and that only dispersal
via seed directly affects colonization of new populations. For plant populations that have
passed through recent episodes of range expansion, long-distance dispersal events are
probably the most important factors o f spatial genetic structuring at maternally inherited
genes at small or medium geographic scales (Le Corre et al. 1997). In the simulation-
based study on colonization dynamics o f maternally inherited loci in oak, Le Corre and
co-workers (1997) demonstrated that stratified dispersal was far more rapid than pure dif
fusion, even if long-distance dispersals were very rare events. They also argued that long
distance dispersal events influenced the genetic differentiation o f populations, leaving a
genetic signature that is likely to persist for long periods. This paper demonstrates the
significance o f such rare events, among others, in shaping the genetic structure of the
monotypic species Hagenia abyssinica.
34
Paper I: Colonization history andphylogeography
The chloroplast DNA has been widely used in the investigations of genetic structure (e.g.
Meister et al. 2005; Parducci et al. 2001), phylogeography (e.g., Butaud et al. 2005;
Meister et al. 2005; King and Ferris 1998; Rendel and Ennos 2002) and colonization his
tory (e.g., Cavers et al. 2003, Petit et al. 2002, 2003; Heuertz et al. 2004) of tree species.
We employed chloroplast microsatellite markers (Weising and Gardner 1999) to investi
gate genetic structure, phylogeography and colonization routes of Hagenia abyssinica
within its natural range in Ethiopia. The mode of inheritance of the chloroplast genome of
Hagenia abyssinica has not been determined, but it is most likely maternally inherited as
in the majority of angiosperms (Harris and Ingram 1991; Birky 1995; Finkeldey and Hat-
temer 2007). We also examined the available fossil pollen records in order to determine
the colonization history o f Hagenia in Africa. Analysis of fossil pollen helps to recon
struct past vegetation history, demographic history and dynamics of ecosystems (Darby-
shire et al. 2003; Lamb 2001; Mohammed et al. 2004; Olago et al. 1999).
Hagenia is a wind-pollinated and wind-dispersed broad-leaved dioecious tree species that
belongs to a monotypic genus in the Rosaceae family (Hedeberg 1989; Legesse 1995). It
is confined to Africa and its ecological range stretches from Ethiopia in the North to
Zimbabwe in the South (Hedeberg, 1989, http:Avww.worldagroforestry.org). Fossil pol
len records indicated that Hagenia immigrated into Ethiopia from the south during the
late Pleistocene and became abundant in the southern regions o f Ethiopia about 2500
years Before Present (BP). At present, the extant Hagenia populations throughout the
country are situated at higher altitudes, often in wetter depressions
The tree has remarkably diversified economic and ecological values (Azene et al. 1993;
Berhanu et al. 1999; Dawit and Ahadu 1993; Jansen 1981; Hedeberg 1989). Hagenia has
been logged heavily and selectively and it is one of the endangered tree species in Ethi
opia (Legesse 1995).
Genetic inventories of Hagenia abyssinica are rare and restricted only to some parts of
the species’ distribution range. Kumilign (2005) and Tileye (2007) investigated the ge
netic diversity of a few populations of H. abyssinica using anonymous RAPD and ISSR
35
r
markers, respectively. The present investigation using cpDNA covered the whole range
of the species in Ethiopia and is the first o f its kind. We predicted that 1) due to limited
seed dispersal and possibly rare long-distance seed dispersal, there is a strong differentia
tion among populations but low variation within populations, 2) populations show geo
graphic structuring primarily induced by mutation and isolation by distance, 3) based on
the existing fossil pollen records, Hagenia immigrated into Ethiopia from the south.
Two main questions are addressed: 1) which factors shaped the maternally inherited ge
netic variation of Hagenia in Ethiopia? 2) Is there a congruence between molecular data
and palynological evidences to infer the relationships among genealogical lineages and
migration routes of the species?
Materials and methods
Sampling and DNA Extraction
Twenty two natural and three planted populations were sampled from all regions where
Hagenia is known to grow in Ethiopia. These populations represent most of the extant
distribution o f the species in the country. The distribution of the populations stretches
from 05°51'N (Hagere Mariam) in the south to 13°11 N (Debark Mariam) in the north,
and from 35°42'E (Wonbera) in the west to 40°14'E (Dindin) in the east (Table 1; Fig.
3). The distances between populations range from 21 to 806 km. The populations are lo
cated within an altitudinal range o f 2200 m a.s.l. at Bonga to 3200 m a.s.l. at Wofwasha,
and temperatures range from an absolute minimum of -1°C at Dinsho to a maximum of
33.5 °C at Kosso Ber populations. The nearest meteorological stations are situated at
lower altitudes than Hagenia populations in most o f the cases, and therefore, higher rain
fall and lower temperatures are expected than those shown in Table 1.
Young leaves were collected and partially desiccated in paper bags before drying with
silica gel and stored at room temperature before DNA extraction. Genomic DNA was iso-
Paper I: Colonization history and phylogeography
36
Paper I: Colonization history andphylogeography
lated from leaves following the DNeasy 96 kit protocol of QiagerT (Hilden, Germany).
In an initial test, DNA was isolated from dried leaves of different sizes. A size of 1cm2
(about 20 mg) gave the best results with regard to DNA quantity and quality and was
used for all samples.
PCR amplification and genotyping
The ten pairs of consensus chloroplast microsatellite primers (CCMPs) (Weising and
Gardner 1999) were tested on 3 samples from 3 geographically separated populations that
are far from each other. Seven of them gave amplification products, three of which
(CCMP2, CCMP6 and CCMP10) were found to be polymorphic, and were used to screen
273 samples (9-12 individuals from each population). Additional 144 samples were ana
lysed to study spatial genetic structure in four polymorphic natural populations. DNA
was diluted (1:10) prior to PCR amplification. PCR reactions were performed in a Peltier
Thermal Cycler PTC-200 (MJ Research' ), with a volume of 16 pi reaction mixture con
taining 2 pi HPLC H2O, 8 pi hot star master mix (containing lOmM Tris-HCL (pH 9.0),
1.5 mM MgCh, 50mM KC1, 0.2 mM each of dNTPs, 0.8U Taq DNA polymerase)
(Qiagen*, Hilden, Germany), 2 pi of each forward and reverse primer (5pmol/pl) and 2 pi
DNA (about 10 ng). The forward primer was labelled with the fluorescent dyes 6-FAM
or HEX. The PCR profile for CCMP2 and CCMP10 was 15 min. initial denaturation at
95 °C, followed by 35 cycles of 1 min. denaturation at 94 °C, 1 min. annealing at 50 °C
and 1 min. extension at 72 °C, with a final extension of 10 min. at 72 “’C. The PCR profile
for CCMP6 differed in the annealing temperature (52.5 °C). Aliquots o f the amplification
products were diluted prior to clcctrophoretic separation on the ABI 3100 Genetic Ana
lyser (Applied BiosystemsR) depending on the intensity of the bands observed after aga
rose gel electrophoresis. Two pi diluted (multiplexed in most cases) PCR product were
denaturated for 2 minutes at 90°C with 12 pi HiDi formamide (Applied Biosystems®)
containing -0.02 pi internal size standard (GS ROX 500, Applied Biosystems®) before
loading on the ABI Genetic Analyser 3100 (Applied Biosystems8) for separation.
37
Paper I: Colonization history and phylogeography
Sequencing
Comparative sequencing of 18 fragments from the three chloroplast loci was performed
to confirm the amplified regions and to determine the molecular basis for size variation.
The amplification products were purified using the QIAquick Gel Extraction kit
(Qiagen®, Germany) following the manufacturer’s specifications. We employed direct
sequencing for a locus having relatively larger fragment sizes, CCMP2 (224-235 bp).
Cloning was performed for the two loci with smaller fragment sizes, CCMP6 (140-142
bp) and CCMP10 (96-97 bp), using the pBSKS vector and X Bluel competitive cells with
the TA cloning method (Invitrogen*). Sequencing followed the dideoxy-chain termina
tion method (Sanger et al., 1977) Sequencing reaction of 10 pi total volume containing 1
pi Big Dye (BD vers. 3.1), 1.5 pi sequencing buffer (SB 3.1), 4.8 pi HPLC H20 , 0.7 pi
forward or reverse primer (5pmol/pl), 2 pi purified DNA (about 10 ng) was used. Since
no sequences o f CCMP2 from other species of the family Rosaceae were available in ex
isting databases, three out-group species from the Rosaceae family that were available in
the Botanic Garden of the Georg-August University Goettingen, Germany, were also se
quenced for comparison. The sequence data have been stored in the EMBL Nucleotide
Sequence Database (http://www.ebi.ac.uk/embl/) with the accession numbers FM174367-
75 and FM 174387 for locus CCMP2 (10 sequences), FM174376-80 for locus CCMP6
(5 sequences), FM174381-83 for locus CCMP10 (3 sequences), and FM1743784-86 for
the locus ccmp2 of the out-group species (3 sequences).
38
Paper I: Colonization history and phylogeography
Table I Site characteristics of 22 natural and 3 planted populations of Hagenia sampled from Ethiopia. The planted populations are labelled as plantation.
Popula tion Code Latitude L ongitude altitude (m asl)
ARF(m l)
M in T M ax T M axHt(m )
M ax n DBH(cm)
D ebark-M ariam DKm r 37 °5 7 ' 3013 1270 8.8 19.7 15 144 11
D ebark- D KP 13°12' 38°01 ' 3005 1270 8.8 19.7 na na 11PlantationK im ir-D ingay KDP 1 1°48' 3 8°14 ' 1350 9.2 21.9 na na 11
p lantation W oldiya S e’at W D 1 1°55' 39°24 ' 3112 908 na na 15 125 11M ichael K osso B er K.B 10°59' 36°54 ' 2702 2381 12.9 27.4 17 45 11
D enkoro DR 10°52' 3 8°47 ' 3061 896 10.9 2 1 .8 2 0 196 11
W onbera W B 10°34' 35°42 ' 2428 1622 na na 18 112.5 11
W o f w asha W W 09 °4 5 ' 3 9 0 4 4 - 3159 941 6.1 19.9 15 122 11
C hilim o CM 09 °0 5 ' 38°10 ' 2805 1114 11.5 25.8 35 118 12
D indin DN 0 8 °3 6 ’ 40°14 ' 2410 989 12.7 28,0 26 156 11
Z equa la A bo ZQ 08°32 ' 38 °5 0 ’ 2856 1215 na na 23 234 10
B oterbecho BB 08°24 ' 3 7°15 ' 2772 1666 5.7 23.6 28 126 9
C hila lo CL 07 °5 6 ' 3 9 ° i r 2815 796 9.8 23,0 15 140 11
Sigm o p lantation SM P 07 °5 5 ' 36°10 ' 2300 1837 11.4 2 1 .6 na na 11
Sigm o SM 07 °4 6 ' 36°05 ' 2651 1837 11.4 2 1 .6 25 152 11
M unesa M S 0 7 °2 5 ’ 38°53 ' 2459 1028 10.1 24.3 20 84.5 11
B onga BG 07°17 ' 36°22 ' 2238 2217 11.9 26.6 18 93 11
Kofele K.L 0 7 ° i r 3 8°52 ' 2757 1305 7.7 20.1 26 214 11
D insho DO 07 °0 5 ' 3 9 0 4 7 - 3117 1213 3.4 2 0 .8 19 153 11
D oddola-Serofta DS 06 °5 2 ' 3 9°02 ' 2700 1074 6.7 24.3 23 242 11
D oddola- DD 06 °5 2 ' 39°14 ' 3039 1074 6.7 24.3 25 2 1 0 11D achosaRira RR 06 °4 5 ' 39 °4 3 ’ 2725 736 na na 23 150 11
Bore BR 06 °1 7 ' 3 3 0 3 9 - 2631 1526 8.3 18.8 24 107 12
U raga UR 06°08 ' 38°33 ' 2508 1228 8.3 18.8 19 96 11
H agereM ariam HM 0 5 °5 1 ' 38°17 ' 2443 1228 12.3 23,0 18 114 10
m asl= m eters above sea level; A R F = M ean A nnual R ainfall; m l = m illilitres; M in T = M ean M inim um tem perature; M ax T = M ean M axim um tem perature; M ax H t (m ) = M axim um height in m eters; M ax D B H (cm ) = M axim um d iam eter at b reast height in centim eters; n = no. o f sam ples; na = not availab le. Source o f clim atic data; N ational M eteo ro log ical A gency S erv ice (E thiopia)
39
Paper I: Colonization history and phylogeography
Data analysis
Amplification products were aligned with the internal size standard using GENESCAN
3.7, and fragments were scored with GENOTYPER 3.7 (Applied Biosystems®). Poly
morphisms in fragment size were identified as different length variants that were com
bined to define haplotypes. Genetic diversity (hs, hT. vs, vT) and differentiation among
populations ( G s t , N st ) was computed by PermutcpSSR (available at
http://www.pierroton.inra.fr/genetics/labo/Software/PermutCpSSR/index.htmn as de
scribed by Pons and Petit (1995; 1996). Distribution of genetic diversity within and
among populations was estimated by an analysis of molecular variance (AMOVA) using
ARLEQUIN Version 3.0 (Excoffier et al. 2005; available at
http: //cmpg. unibe. ch/software/arlequin3).
Sequences were analysed with the sequence analysing software 3.7 (Applied Biosys
tems®), edited by the program BIOEDIT (Hall 1999) and aligned with Clustal W applica
tion (Thompson, et al. 1994; available at http://www.ebi.ac.uk/clustalw/).
A statistical parsimony network o f haplotypes was constructed with the help o f a program
TCS Version 1.21 (Clement et al. 2000) from DNA sequence data. Large gaps in a se
quence due to an indel (insertion/deletion) are coded as a single mutation to avoid theo
retical intermediate haplotypes that are created by the program, which interprets each gap
as independent mutation event. The sequence data also confirmed that the larger indel
was the result o f a single mutation event. The TCS program was also used to compute the
out-group weights of haplotypes. A nested clade phylogeographic analysis (NCPA) of the
spatial distribution o f the genetic variation was performed by the program GEODIS (Po
sada et al. 2000). Nested clades were plotted manually on the haplotype network based on
the algorithms defined by Templeton et al. (1987). The interpretation of statistically sig
nificant patterns o f distribution was made following the inference key described in Tem
pleton (2004).
40
Paper I: Colonization history and phylogeography
Results
Genetic diversity and differentiation
We found 3 alleles in locus CCMP2, 3 alleles in locus CCMP6 and 2 alleles in locus
CCMP10 (Tables 2 and 3). The analyses o f within population diversity (hs), total diver
sity (ht) and differentiation ( G s t ) yielded 0.079, 0.787 and 0.899, respectively, under the
assumption of unordered haplotypes (Pons and Petit 1996). The corresponding values for
within population diversity (vs), total diversity (vT) and differentiation ( N s t ) with ordered
haplotypes (Pons and Petit 1996), taking genetic distances among haplotypes into ac
count, were 0.058, 0.787 and 0.926, respectively. An analysis of molecular variance
(AMOVA) showed that 92.3% of the total genetic diversity is represented among popula
tions. A test of spatial genetic structure in the four polymorphic natural populations did
not show any family or spatial genetic structure, indicating effective seed dispersal by
wind at the local level. This is not unexpected for species with very light wind-dispersed
seeds. The additional 144 individuals analysed for spatial genetic structure showed simi
lar haplotype composition and frequencies, as the sample that was analysed to study ge
netic diversity (Table 4). No additional haplotypes were found due to increased sample
size.
Table 2 Description of chloroplast microsatellites in Hagenia
Repeat m otif Fragment size (bp)
Genelocus
Forward and reverse primer sequences (5' - 3')* Hagenia
otherplants*
other Hagenia plants*
location in genome*
source of variation
CCMP2
CCMP6
GATCCCGGAGGTAATCCTGATCGTACCGAGGGTTCGAAT
CGATGCAT ATGT AGAAAGCC CATTACGTGCGACTATCTCC
(A)9
(T)v
(A),,
(T)5C(T)17
224,234, 158-234 235
140,141,142 93- 103
5' to trnS
ORF 77- ORF 82, intergenic
Indel,microsatellite
microsatellite
CCMP10TTTTTTTTTAGTGAACGTGTCATTCGTCGDCGTAGTAAATAG (A),2 (T),4
91->30096, 97
rpl2-rpsl9,intergenic
microsatellite
*Weising and Gardner, 1999, indel = Insertion/deletion (in the flanking region)
41
Paper I: Colonization history and phylogeography
Table 3 Description o f Hagenia haplotypes detected by fragment analysis in three chloroplast DNA loci
Haplotype CCMP2 CCMP6 CCMP10 Relativefrequency
np nfp
Hi 224 140 97 0.34 10 7H2 224 141 97 0.25 8 5H3 224 142 97 0.05 3 0H4 234 140 97 0.21 6 5H5 234 140 96 0.04 1 1H6 235 140 97 0.11 3 2
np= No. of populations possessing the haplotypes: nfp = No. of populations fixed on one type
Table 4 Number of observations per haplotype from different sample sizes of polymorphic populations
Populations Chilimo (CM) Kofele (KL) Bore (BR) Uraga (UR)Sample size 12 47 11 46 12 47 11 50
Haplotypes HI 10 39 6 19 1 3H2 4 26 9 38 1 2H3 1 1 2 6 10 48H4 2 8
Results o f sequencing
Multiple sequence alignments o f loci CCMP2, CCMP6 and CCMP10 are shown in Fig.
1. Sequencing confirmed homology of the three loci to the respective regions of the
chloroplast genome. The observed variations were due to variable numbers o f poly (A) or
poly (T) repeats and a large indel of 10 bp at position 100 bp in the flanking region of the
locus CCMP2. In total, there were 4 variable sites (3 short indels in the microsatellites
and a large indel in the flanking region). A 10-bp segment is preceded by an identical
sequence in the flanking region of the four genotypes in locus CCMP2 (underlined in Fig.
1). The duplication can be explained by a strand slippage during cpDNA replication in a
Paper I: Colonization history andphylogeography
single mutational event (e.g., Wolfson et al., 1991). The sequences of the three out-group
species (Rubus fruticosus, Rubus idaeus and Rosa canina) also showed duplication
events of different segment in similar region (Fig. 1).
Phylogeography
Six haplotypes (H1-H6) were identified from the combination of the three loci as de
tected by fragment analysis (Table 3). A fully resolved statistical parsimony network of
the chloroplast haplotypes of Hagenia, which is reconstructed from DNA sequences (Fig.
2), demonstrates the relationship among the different haplotypes and the minimum num
ber of evolutionary events separating them. The third frequent haplotype, H4 (represented
in 21% of the individuals), has a larger out-group weight (0.35) than the most frequent
haplotype HI (represented in 34% of the individuals) with an out-group weight of 0.26.
Out-group weight is a relative weight of haplotypes based on mutational steps and is
strongly correlated with actual age (of a haplotype) and thus is a much better indicator of
haplotype age than is the haplotype frequency (Castelloe and Templeton 1994). All of the
haplotypes are separated by a single mutation step. HI is separated from H4 by a deletion
of 10 nucleotides in locus CCMP2.
The observed N St value is significantly higher than the G st value at p<0.01 (none of the
pennutated G st values was higher than the observed N st value), indicating geographical
clustering of related haplotypes. Three nested clades were evident from the haplotype
network (Fig. 2) and the chi-square (x2) statistic revealed a significant association
(p<0.0001) between genealogical and geographic distributions in all of the clades (Table
5). Restricted gene flow was inferred for the haplotypes nested in clade 1-1 (but with
some long distance dispersal events over intermediate areas) and in clade 1-2 (with isola
tion by distance), while contiguous range expansion was deduced from the total clado-
gram (Table 5).
43
Paper I: Colonization history and phylogeography
Table 5 Interpretation of the results of the nested clade phylogeographic analysis (NCPA)
Clade X2 P Chain of inference* Inferred demographic events§
1-1(HI, H2, H3)
276.5762 0.0000 1 -2-3-5-6-7-8-YES restricted gene flow/dispersal but with some long distance dispersal over intermediate areas
1-2(H4, H5, H6)
136.0000 0.0000 1-2-3-4-N0 restricted gene flow with isolation by distance
Total cladog- ram
231.7921 0.0000 1-2-11-12-NOcontiguous range expansion
*Refers to inference key numbers (YES/NO refers to the answers to the respective last keys), §Interpreted by inference key (Templeton 2004)
Haplotype HI is widely distributed in central Ethiopia, while H2 is common in southern
regions (Fig. 3). Haplotype H4 has the longest geographic distribution in south-north di
rection stretching from the southwest to the northern regions. The northern population
DK was established most likely by single long-distance dispersal event. A recent muta
tion at locus CCMP10 resulted in the rarest haplotype (H5) that is restricted to only one
population (Wonbera) in the west (fixed on one type), distinguishing it from other popu
lations. Haplotype H6 is restricted to the central-northern region, while H3 has only a rare
occurrence in the southern region, and is always in association with H2 and/or HI. The
domination of the population Uraga (UR) by haplotype H3 as contrasting to the neighbor
ing populations (H2) in the south was caused by a single mutational event in locus
CCMP6.
The three loci exhibited different impacts on haplotypic variation in the different regions
of the country. Locus CCMP6 accounted for the variation in central and southern Ethi
opia, while CCMP2 was responsible for the variation in southwestern and northern re
gions. Locus CCMP10 caused the variation in west Ethiopia due to the prevalence o f a
private allele. Eighty percent of the populations are fixed on one haplotype, while the re
maining populations share two to three haplotypes. Two populations (KL and BR) con
tained three similar haplotypes at different frequencies while three populations (UR, CM
44
Paper I: Colonization history and phylogeography
and KDP) possessed two different haplotypes each. Two of the planted populations in
cluded in this study (DKP and SMP) showed identical haplotypes as their respective par
ent populations (DK and SM) based on the record obtained from the District Office of
Agriculture (unpublished data). The source population of a third plantation, (KDP) was
not confirmed, but it exhibited a combination of haplotypes from two neighboring popu
lations (HI and H6), suggesting that seeds were obtained from the adjacent populations
or alternatively, they were procured from the national seed center.
45
DK5 2 3 4 SM7 2 3 4 WB5 2 3 4 DR7 2 3 5KB5 2 2 4 CM30 2 2 4 DN7 2 2 4 DD7 2 2 4 KB7 2 2 4 UR5 2 2 4 R u f R u i R oc
(b)
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
30 90 1 00 11 0 12 0 130 1
TTTTTTTTATTTATTTA TTTAGTTAATTTTAGTTAATTAAAAAAAAA TATTAATAA TTTTTTTTATTTATTTA TTTAGTIAATTTTAGTTAATTAAAAAAAAA TATTAATAA TTTTTTTTATTTATTTA TTTAGTTAATTTTAGTTAATTAAAAAAAAA TATTAATAA TTTTTTTTATTTATTTA TTTAGTTAATTTTAGTTAATTAAAAAAAAAATATTAATAA TTTTTTTTATTTATTTATTTTTTTTATTTATTTATTTTTTTTATTTATTTATTTTTTTTATTTATTTATTTTTTTTATTTATTTATTTTTTTTATTTATTTA
1 50
TTTAAAGAAGTGGt t t a a a g a a g t g g
TTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGG
GAGCTCTTTTTTTTATTTAATTA TTTAATTAA GAGCTTTTTTTTT ATTTAATTAA GAGCTCTTTTTT ATTATATTATTTTTATTATA
TTAGTTAATTAAAAAAAAA TATTAATAA TTAGTTAATTAAAAAAAAA TATTAATAA TTAGTTAATTAAAAAAAAA TATTAAAAA TTAGTTAATTAAAAAAAAA TATTAAAAA TTAGTTAATTAAAAAAAAA TATTAATAA TTAGTTAATTAAAAAAAAA TATTAAAAA
TAGTT AAAAATGAA TAGTTAAAGAAGTTTAAGGATGNGGTAGTT AAAAATGA ATAGTTAAAGAAGTTTAAGGATGTGTTAGTT AAAAATTATATAGTTAAAATAGTT AAAGAAGTGG
8 0
UR5 1 4 2 CTACCTTTTAGTTTTATATAATATATATAGTATTTTTTTTTCTATGGATTATGGATATAGTATTTATTAACGTATTTCTT UR16 1 4 1 CTACCTTTTAGTTTTATATAATATATATAGTATTTTTTTT CTATGGATTATGGATATAGTATTTATTAACGTATTTCTT DO5 1 4 1 CTACCTTTTAGTTTTATATAATATATATAGTATTTTTTTT c t a t g g a t t a t g g a t a t a g t a t t t a t t a a c g t a t t t c t t
KB7 1 4 0 c t a c c t t t t a g t t t t a t a t a a t a t a t a t a g t a t t t t t t t c t a t g g a t t a t g g a t a t a g t a t t t a t t a a c g t a t t t c t t
KB5 14 0 c t a c c t t t t a g t t t t a t a t a a t a t a t a t a g t a t t t t t t t c t a t g g a t t a t g g a t a t a g t a t t t a t t a a c g t a t t t c t t
20 30 40 50 60 70 80 90
WB4 96 g t a g t a a a t a g g c g a g a a a a t a g a a t t t g t t t c t t c c t c t t a a a a a a a a a a a t a g g a g t a a t t a a t t g t g a c a c g t t c a
WB6 9 6 g t a g t a a a t a g g c g a g a a a a t a g a a t t t g t t t c t t c c t c t t a a a a a a a a a a a t a g g a g t a a t t a a t t g t g a c a c g t t c a
KB 5 9 7 g t a g t a a a t a g g c g a g a a a a t a g a a t t t g t t t c t t c c t c t t a a a a a a a a a a a a t a g g a g t a a t t a a t t g t g a c a c g t t c a
Fig. 1 Sections o f sequences o f three Hagenia chloroplast microsatellite loci (a= CCMP2 aligned with Rubus fruticosus, Rubus idaeus and Rosa canina, b= CCMP6, c= CCMP10). Duplications in locus CCMP2 are underlined. Microsatellite repeats are shown in bold. Gaps indicate deletions o f nucleotides, g = genotype; f = fragment size.
Paper I: Colonization
history and
phylogeography
Paper I: Colonization history and phylogeography
Fig. 2 Statistical parsimony network showing nested clades and relatedness among haplotypes (H1-H6) o f Hagenia
abyssinica at three chloroplast loci. Sizes o f circles are proportional to their respective out-group weights. Thick
bar indicates indel o f 10 bp in a single mutation event; thin bar indicates indel o f 1 bp.
47
Paper I; Colonization history and phylogeography
Discussion
Genetic diversity and differentiation
A very low genetic and haplotype diversity within populations (hs = 0.079, vs = 0.058, respec
tively) and a very high population differentiation ( G St = 0. 899, N St = 0. 926) proved a marked
genetic separation of the populations. This result supports our first prediction that there is a
strong differentiation among populations, but low variation within populations due to limited
seed dispersal and possibly rare long-distance seed dispersal events. The population differentia
tion is much higher in the chloroplast genome than in the nuclear genome of Hagenia abyssinica,
as revealed by ISSR ( G st = 0.25; Tileye et al. 2007) and AFLP markers ( G s t = 0.15, Taye et al.
submitted).
Likewise, Rendell and Ennos (2002) found a population differentiation that was 10-fold higher in
the chloroplast genome o f Calluna vulgaris (L.) Hull (Ericaceae), than in the nuclear genome. In
general, maternally inherited genomes experienced considerably more subdivision (mean Gst
value o f -0.64) than biparentally inherited genomes (mean G s t value o f -0.18) of angiosperm
species (reviewed by Petit et al. 2005). The coefficient of population differentiation ( G st ) in Ha
genia is higher than or comparable to G st values recorded for other species with heterogeneous
mode o f seed dispersal, including wind dispersal, investigated by chloroplast markers (Newton et
al. 1999, Petit et al. 2003).
The high level of genetic variation among populations of Hagenia suggested a restricted migra
tion of seeds among regions, which is also reflected in the observed geographic structuring of
haplotypes. The demographic history of the species and/or existence of natural barriers (moun
tains, valleys and long distances) to seed dispersal might account for the strong phylogeographic
pattern. Young and Boyle (2000) reported that for wind-pollinated and dispersed species, the pat
tern of gene flow and genetic structure is a function o f interfragment distance.
48
Paper I: Colonization history and phylogeography
Fig. 3 Geographic distribution o f Hagenia chloroplast haplotypes in Ethiopia. Dotted enclosure shows lineage I; dashed enclosure shows lineage II. Grey dashed lines indicate approximate position o f the Great Rift Valley. The inset pie chart shows the relative frequency distribution o f the haplotypes. Two letters designate populations as in Table 1; H1-H6 indicates haplotypes as in table 3. The arrows indicate the putative colonization route o f the species. Source map: Assefa G (unpublished).
Though Hagenia is a montane species, its migration is not necessarily along the mountains as
evidenced by haplotype HI that is distributed at both sides of the Great Rift Valley (see Fig 3),
most likely due to long-distance seed dispersal as intermediate populations are missing.
49
Paper I: Colonization history and phylogeography
Phylogeographical andpalynological interpretation
The geographic distribution o f haplotypes (Fig. 3) and their genealogical relationships (Fig. 2)
observed in Hagenia demonstrated a marked phylogeographical structure as a result of highly
restricted gene flow via seeds. Such patterns arise when scattering is reduced because the novel
mutations remain localized within the geographical context of their origins (e.g. Butaud et al.
2005). Both the Gst-N st test and the NCPA detected a very strong association between genea
logical and geographic distributions. The NCPA inferred that restricted gene flow associated
with contiguous range expansion shaped the genetic structure of Hagenia. This result allows us
to accept the second prediction that populations show geographic structuring primarily induced
by isolation by distance, coupled with local mutation events. Two distinct lineages that were
separated by an indel o f 10 nucleotides in locus CCMP2 are evident from the cladogram (see
Fig. 2). The first lineage constitutes haplotype H4 and its derived haplotypes H5 and H6 that are
distributed in the south-western and northern regions (referred hereafter as lineage I), while the
second lineage embodies HI and its derived haplotypes H2 and H3 in central and southern re
gions (lineage II). Such a non-random distribution of haplotypes asserts our prediction on the
existence of phylogeographic pattern in Hagenia.
In light of the palynological records discussed at the end of this section, there are two possible
scenarios for the immigration of Hagenia into Ethiopia. The first scenario suggests that the line
age I of Hagenia colonized Ethiopia first through the southwest mountains (population Bonga,
BG) that is situated to the west o f the Great Rift Valley whereas the second scenario suggests
that lineage II of Hagenia colonized Ethiopia first through the south mountains (population
Hagere Mariam, HM) situated east o f the Great Rift Valley. However, our data supports the first
scenario. The cladogram demonstrated that haplotype H4 is the most probable ancient haplotype
that served as a root for the rest o f the haplotypes because o f its higher out-group weight. Castel-
loe and Templeton (1994) argued that the most ancient haplotype should be located at the center
o f the gene tree and be geographically widespread, whereas the most recent haplotypes should be
at the tips of the gene tree and be localized geographically. This ascertains the postulation that
haplotype H4 is the most ancient haplotype (followed by HI), whereas H2, H3, H5 and H6 are
located at the tips o f the gene tree and are highly localized geographically. This observation sug-
50
Paper I: Colonization history and phylogeography
gests that Hagenia was first introduced most likely to the Mountains of the southwest Ethiopia
(population Bonga, BG) from southern African regions and expanded and diversified in the cen
tral, southern and northern regions of the country. Our results demonstrated that lineage I most
likely gave rise to lineage II due to a deletion of 10 nucleotides in a single mutational event. This
mutational event was quite recent assuming the recent colonization of Ethiopia by Hagenia. All
the southern haplotypes were most likely derived from a single seed parent with haplotype H4
and expanded to the central regions and diversified into the southern regions. In general, our re
sults confirm that colonization took place only from the south. The inferred colonization routes
and putative long-distance dispersal event are shown in Fig. 3.
The long gap observed between the northern and southern populations with the haplotype H4 led
to three postulations: 1) the populations that are situated between these two regions diversified to
other haplotypes due to mutation (e.g., population WB diversified to H5 and population DR di
versified to H6, both based on a single mutation event), 2) some populations containing the same
haplotype might be lost due to anthropogenic activities, 3) natural or human mediated coloniza
tion events in terms of long-distance seed dispersal or purposeful seed transfer account for this
disjunct haplotype distribution. The postulations, however, are not exclusive. Haplotype HI is
also widely distributed, and such a widespread distribution of individual haplotypes indicates
rapid range expansion (Schaal et al. 1998) and the significant role o f rare events, particularly
long-distance seed dispersal and mutation, in shaping the genetic diversity in Hagenia. Further
more, the patchy structure of the haplotypes o f Hagenia, in general, is a result of rare long
distance dispersal o f seeds during colonization, each patch resulting from a founding event
beyond the colonizing front.
Though complete coverage is unavailable from Africa, the palynological data obtained from fos
sil pollen stratigraphy often sites in Africa (Table 5) suggested that the post-glacial colonization
of Hagenia followed a northward route with the oldest available record from Burundi (ca. 34,000
l4C yrs BP). Major expansion of Hagenia took place around 1 1,500 14C yrs BP in Burundi (Bon-
nefille et al. 1995), whereas its major expansion in Bale Mountains (southern Ethiopia) was after
2500 cal yr BP (Mohammed et al. 2004; Mohammed and Bonnefille 1998). Bonnefille and Mo
hammed (1994) also reported that Hagenia expanded after 590 yr BP in Arsi Mountains (central
Ethiopia). In general, the signal of Hagenia in the pollen records in Ethiopia was quite high in
51
Paper I: Colonization history and phylogeography
the late Holocene epoch and the palynological evidences in general suggested a northward mi
gration route also within Ethiopia. The fossil pollen records support our third prediction that
Hagenia immigrated into Ethiopia northward from southern African regions. The examination of
the same pollen diagrams that are described above also indicated a northward colonization of
some other tree species such as Podocarpus falcatus, Juniperus procera and Olea species in Af
rica. The palynological data also showed that the fossil pollen accumulation of Hagenia abys
sinica has been alarmingly declining through time in the African countries other than Ethiopia,
suggesting a sequential reduction in the size of the populations.
Table 5 Late Pleistocene to late Holocene ice ages fossil pollen records of Hagenia from ten sites in Africa
Site, Country, ReferencesAltitude Approximate age o f core at first appearance (m.a.s.l.)
Maximum record o f pollen (%)
Rusaka, Burundi’ 2070 34,000 l4C yrs BP 20Mount Kenya4 2350 >33,350 14C yrs BP 40Lake Albert, U ganda1 619 12,000 14C yrs BP <2.5Lake Turkana, Kenya2 375 2,200 14C yrs BP <1Garba Guracha (Bale Mountains, Ethiopia)5 3950 17,000 cal yrs BP 10Tamsaa (Bale Mountains, Ethiopia)2,6 3000 15,470 cal yrs BP: 45Lake Tilo (Southern Rift Valley, E thiopia)7' 8 1545 8000 l4C yrs BP <2.5Dega Sala (Arsi mountain, E thiopia)9 3600 1850 l4C yrs BP ca.7Lake Langeno, Ethiopia10 1583 2370 l4C yrs BP <5Lake Hardibo (Wello, Ethiopia)11 2150 2500 14C yrs BP <2.5
The sites are arranged from south to north, generally showing a decreasing trend in ages o f fossil pollen. Low pollen grain percentages in some sites may suggest that pollen was transported from other forests. Sources: ‘Beuning et al. (1997), ^Mohammed et al. (1996), Bonnefille et al. (1995), 401ago et al. (1999). 5Umer et al. (in press), 6M ohammed and Bonnefille (1998), 7Lamb (2001), 8Lamb et al. (2004), ’Bonnefille and Mohammed (1994), 10 M ohammed and Bonnefille (1991), "D arbyshire et al. (2003).
It remains uncertain from the pollen data whether there was a forest refugium during the gla
cial/late glacial period at lower altitudes (2000-2500m) in southern Ethiopia. There is a lack of
information from such sites for the early Holocene.
Conclusions
The joint interpretation of genealogical relationships among the chloroplast haplotypes and the
fossil pollen evidences allowed us to accept the hypothesis predicting immigration o f Hagenia
52
Paper I: Colonization history and phylogeography
into Ethiopia from the south. Based on the cpDNA data, the migration of Hagenia into Ethiopia
occurred only once, but the exact dating was not possible. There was no indication of past frag
mentation of Hagenia populations from our results, pointing to the effect of random long
distance seed dispersal. It is most likely that populations were established from few parent seed
trees. Given the mountainous topography of the country that is intermittently dissected by wide
valleys, Hagenia did not have a continuous distribution. The cpDNA assay detected sufficient
variation for a phylogeographic study of Hagenia abyssinica in Ethiopia. A remarkable subdivi
sion o f cpDNA diversity in the species was found, as indicated by a high level o f genetic differ
entiation. The chloroplast haplotypes of Hagenia abyssinica demonstrated a pattern of isolation-
by- distance. Unlike most of the wind-dispersed tree species, the chloroplast haplotypes found in
Hagenia showed a clear pattern of congruence between their geographical distribution and ge
nealogical relationships, allowing us to accept the prediction on geographic structuring. Analysis
of cpDNA types and palynological inventories, including all countries where the species is
known to grow, would fully resolve the genealogical relationships and help to identify the glacial
refugia of Hagenia in Africa. The analysis of pollen records from different sites and altitudes in
Ethiopia where Hagenia is growing would help to fully understand the colonization route of the
species within the country.
Acknowledgements
This work is supported by the German Federal Ministry of Economic Cooperation and Devel
opment (BMZ) through the German Technical Cooperation (gtz) as a component of a project
“Support to the Forest Genetic Resources Conservation Project” of the Ethiopian Institute of
Biodiversity Conservation (IBC). The German Academic Exchange Service (DAAD) executed
the grant as a PhD project of the first author. The National Meteorological Service Agency of
Ethiopia provided climatic data free of charge. We are indebted to Oleksandra Dolynska and
Thomas Seliger for technical assistance in the laboratory.
53
Paper I: Colonization history and phylogeography
References
Avise JC (2004) Molecular Markers, Natural History and Evolution. 2nd edn, Sinauer Associates Inc, Sunderland, USA
Azene BT, Bimie A, Tegnas Bo (1993) Useful Trees and Shrubs for Ethiopia: Identification, Propagation and Management for Agricultural and Pastoral Communities. Technical Handbook No. 5, Regional Conservation Unit, Swedish International Development Authority (SI- DA)
Bawa KS, Krugman SL (1990) Reproductive biology and genetics o f tropical trees in relation to conservation and management. In: Rain Forest Regeneration and Management (eds Gomez- Pampa A, Whitmore TC, Hadley M), pp. 119-136. The Parthenon Publishing Group
Berhanu M Abegaz, Ngadjui BT, Merhatibeb Bezabih, Mdee LK (1999) Novel natural products from marketed plants of eastern and southern Africa. Pure Appl Chem 71: 919-926
Beuning KRM, Talbot MR, Kelts K (1997) A revised 30,000-year paleoclimatic and paleohydro- logic history of Lake Albert, East Africa. Palaeogeogr palaeocl 136: 259-279
Birky CW Jr (1995) Uniparental inheritance of mitochondria and chloroplast genes: mechanisms and evolution. Proc Natl Acad Sci USA 92: 11331-11338Bonnefille R, Mohammed MU (1994) Pollen-inferred climatic fluctuations in Ethiopia during the
last 3000 years. Palaeogeogr palaeocl 109: 331-343 Bonnefille R, Riollet G, Buchet G, Icole M, Lafont R, Arnold M, Jolly D (1995) Gla
cial/interglacial record from intertropical Africa, high resolution pollen and carbon data at Ru- saka, Burundi. Quaternary Sci Rev 14: 917-936
Butaud J-F, Rives F, Verhaegen D, Bouver J-M (2005) Phylogeography o f Eastern Polynesian sandalwood (Santalum insulare), an endangered tree species from the pacific: a study based on chloroplast microsatellites. J Biogeogr 32: 1763-1774
Cain ML, Milligan BG, Strand AE (2000) Long-distance seed dispersal in Plant Populations. Am JB ot 87: 1217-1227
Castelloe J, Templeton AR (1994) Root probabilities for intraspecific gene trees under neutral coalescent theory. Mol Phylogenet Evol 3: 102-113
Clement M, Posada D, Grandall KA (2000) TCS: A computer program to estimate gene genealogies. Mol Ecol 9: 1657-1659
Cavers S, Navarro C, Lowe AJ (2003) Chloroplast DNA phylogeography reveals colonization history o f a Neotropical tree, Cedrela odorata L., in Mesoamerica. Mol Ecol 12: 1451-1460
Cruzan MB, Templeton AR (2000) Paleoecology and coalescence: phylogeographic analysis of hypotheses from the fossil record. Trends Ecol Evol 15: 491-496
Darbyshire I, Lamb H, Mohammed Umer (2003) Forest clearance and regrowth in northernEthiopia during the last 3000 years. Holocene 13: 537-546
Dawit A, Ahadu A (1993) Medicinal Plants and Enigmatic Health Practices of Northern Ethiopia. Addis Ababa
Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol Bioinform 1: 47-50
Finkeldey R, Hattemer HH (2007) Tropical Forest Genetics. Springer-Verlag, Berlin Hall TA (1999) BIOEDIT: a user-friendly biological sequence alignment editor and analysis
program for windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98
54
Paper I: Colonization history and phylogeography
Harris SA, Ingram R (1991) Chloroplast DNA and biosystematics: The effects o f intraspecific diversity and plastid transmission. Taxon 40: 393-412
Hedeberg, O (1989) Rosaceae. In: Inga Hedeberg and Sue Edwards, eds. Flora o f Ethiopia, Vol.3, Pittosporaceae to Arralaceae. Addis Abeba and Asmara, Ethiopia; Uppsala, Sweden
Heuertz M, Fineschi S, Anzidei MA et al. (2004) Chloroplast DNA variation and postglacial recolonization of common ash (Fraxinus excelsior L.) in Europe. Mol Ecol 13: 3437-3452
Jansen PCM (1981) Spices, condiments and medicinal plants in Ethiopia, their taxonomy and agricultural significance. Wageningen
King RA, Ferris C (1998) Chloroplast DNA phylogeography of Alnus glutinosa (L.) Gaertn. Mol E co l7,1151-1163
Kumilign A (2005) Estimation of sex-related genetic diversity of Hagenia abyssinica (Bruce) J.F. Gmel. M.Sc. thesis, Addis Ababa University
Lamb HF (2001) Multi-proxy records of Holocene climate and vegetation change from Ethiopian Crater lakes. Proy Irish Acad B 101: 35-46
Lamb AL, Leng MJ, Mohammed UM, Lamb HF (2004) Holocene climate and vegetation change in the main Ethiopian Rift Valley, inferred from the composition (C/N and Si3C) of lacustrine organic matter. Quaternary Sci Rev 23: 881-891
Le Corre V, Machon N, Petit RJ, Kremer A (1997) Colonization with long-distance seed dispersal and genetic structure of maternally inherited genes in forest trees: a simulation study. Genet Res 69: 117-125
Legesse N (1995) Indigenous trees of Ethiopia: Biology, uses and propagation techniques. SLU, Reprocentralen, Umea
Meister J, Hubaishan MA, Killian N, Oberprieler C (2005) Chloroplast DNA variation in the shrub Justicia areysiana (Acanthaceae) endemic to the monsoon affected coastal mountains of the southern Arabian Peninsula. Bot J Linn Soc 148: 437-444
Mohammed MU, Bonnefille R (1991). The recent history of vegetation and climate around lake Langano (Ethiopia). Paleoecol Afr22: 275-286
Mohammed MU, Bonnefille R (1998) A Late Glacial to Late Holocene pollen record from a high land peat at Tamasaa, Bale mountains, South Ethiopia. Global Planet change 16-17: 121-129
Mohammed MU, Bonnefille R, Johnson T (1996) Pollen and isotopic records of Late Holocene sedim ents from Lake Turkana, N. Kenya. Palaeogeogr palaeocl 1 19: 371-383
Mohammed U, Dagnachew Legesse, Gasse F, Bonnefille R, Lamb HF, Leng MJ (2004) Late quaternary climate changes in the Horn of Africa. In: Past climate variability through Europe and Africa (eds Battarbee RW, Gasse F, Stickly CE), pp. 159-177. Kluwer Academic Publishers, Dordrecht, the Netherlands
Newton AC, Allnutt TR, Gillies ACM, Lowe AJ and Ennos RA (1999) Molecular phylogeography, intraspecific variation and the conservation of tree species. Trends Ecol Evol 14: 140-145
Ouborg NJ, Piquot Y, Van Groenendael JM (1999) Population genetics, molecular markers and the study of dispersal in plants. J Ecol 87: 551-568
Olago DO, Street-Perrott FA, Perrott RA, Ivanovich M, Harkness DD (1999) Late quaternary glacial-interglacial cycle of climatic and environmental change on Mount Kenya. J Afr Earth Sci 29:593-618
Parducci L,- Szmidt AE,- Madaghiele A, Anzidei M, Vendramin GG (2001) Genetic variation at chloroplast microsatellites (cpSSRs) in Abies nebrodensis (Lojac.) Mattei and three neighboring Abies species. Theor Appl Genet 102: 733-740
Petit RJ, Aguinagalde I, de Beaulieu J-L, et al. (2003) Glacial refugia: hotspots but not melting pots o f genetic diversity. Science 300: 1563-1565
55
Paper I: Colonization history and phylogeography
Petit RJ, Brewer S, Bordacs S, et al. (2002) Identification of refugia and post-glacial colonization routes of European white oaks based on chloroplast DNA and fossil pollen evidence. Forest Ecol Manag 156: 49-74
Petit RJ, Duminil J, Fineschi S, Hampe A, Salvini D, Vendramin GG (2005) Comparative organization o f chloroplast, mitochondrial and nuclear diversity in plant populations. Mol Ecol 14: 689-701
Pons O, Petit RJ (1995) Estimation, variance and optimal sampling o f gene diversity. 1. Haploid locus. Theor Appl Genet 90: 462-470
Pons O, Petit RJ (1996) Measuring and testing genetic differentiation with ordered versus unordered alleles. Genetics 144: 1237-1245
Posada D, Crandall KA, Templeton AR (2000) GeoDis: a program for the cladistic nested analysis o f the geographical distribution o f genetic haplotypes. Mol Ecol 9: 487^488
Rendell S, Ennos RA (2002) Chloroplast DNA diversity in Calluna vulgaris (heather) populations in Europe. Mol Ecol 11: 69-78
Ryder AO (1986) Species conservation and systematics, the dilemma of subspecies. Trends Ecol Evol 1: 9-10
Schaal BA, Hayworth DA, Olsen KM, Rauscher JT, Smith WA (1998) Phylogeographic studies in plants: problems and prospects. Mol Ecol 7: 465-474
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors.Proc Natl Acad Sci USA 74: 5463-5467
Templeton AR (2004) Statistical phylogeography: methods of evaluating and minimizing inference errors. Mol Ecol 13: 789-809
Templeton AR, Boerwinkle E, Sing CF (1987) A cladistic analysis o f phenotypic associations with haplotypes inferred from restriction endonuclease mapping. I. Basic theory and an analysis of Alcohol Dehydrogenase activity in Drosophila. Genetics 117: 343-351
Tileye F, Nybom H, Bartish IV, Welander M (2007) Analysis of genetic diversity in the endangered tropical tree species Hagenia abyssinica using ISSR markers. Genet Resour Crop Evol 54: 947-958
Thompson JD, Higgins DG, Gibson TG (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680
Umer M, Lamb HF, Bonnefille R, Lezine A-M, Tiercelin J-J, Gibert E, Gazet J-P, Watrin J (2007). Late Pleistocene and Holocene vegetation history of the Bale Mountains, Ethiopia. Quaternary Sci Rev 26: 2229-2246
Weising K, Gardner RC (1999) A set of conserved PCR primers for the analysis of simple sequence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms. Genome 42: 9-19
Wolfson R, Higgins KG, Sears BB (1991) Evidence for Replication Slippage in the Evolution of Oenotheru Chloroplast DNA. Mol Biol Evol 8: 709-721
Young, Andrew G and Boyle, Timothy J 2000. Forest Fragmentation. In: Young, A, Boshier, D and Boyle, T (ed.) 2000. Forest conservation genetics: principles and practice. CABI Publishing
56
II. Spatial distribution of genetic diversity in Hagenia abyssinica (Bruce) J.F. Gmei from Ethiopia, assessed by AFLP molecular markers
Taye Bekele Ayele*, Oliver Gailing, and Reiner Finkeldey
Forest Genetics and Forest Tree Breeding, Georg-August University of Goettingen,
Buesgenweg 2, 37077 Goettingen, Germany
Abstract
The intraspecific genetic variation of 596 individuals from 25 populations of Hagenia abyssinica
sampled from the montane forests of Ethiopia was investigated at AFLP markers. Hagenia is a
wind-pollinated and wind-dispersed dioecious tree species belonging to a monotypic genus in the
Rosaceae family. We obtained 106 unequivocally scorable AFLP markers out of which 91.5%
were polymorphic. Despite the relatively recent immigration of Hagenia abyssinica into Ethio
pia. populations showed moderate to high gene diversities (He = 0.139-0.362), and moderate but
significant genetic differentiation (Fst = 0.077), reflecting high levels of post-colonization gene
flow among populations. No trend of decreasing genetic diversity was detected during coloniza
tion, confirming effective gene flow among populations. The observed variation at putatively
neutral AFLPs does not reflect clinal variation patterns. As expected, the coefficient of popula
tion differentiation was found to be much lower in the nuclear genome of Hagenia abyssinica
than in the chloroplast genome. Despite the dispersal o f seed and pollen o f Hagenia by wind, a
significant non-random fine-scale spatial genetic structure (SGS) is observed up to 80 m in some
populations. Due to significant genetic differentiation observed among populations, as many
populations as possible should be considered for conservation and tree improvement programs.
Key words: AFLP, Hagenia, gene diversity, kinship coefficient, population differentiation, spatial genetic structure
*Correspondence: Taye B. Ayele; Fax: +49 551 398367; e-mail: [email protected] Permanent address: Institute of Biodiversity Conservation, Fax: +251-11-6613722; P.O.Box: 30726, Addis Abeba, Ethiopia; e-mail: [email protected]
57
Paper II: Genetic diversity at AFLPs
Introduction
The level of genetic diversity in a population is affected by various genetic, life history and eco
logical characteristics that collectively define the population’s genetic structure (Yeh 2000). Tree
species are generally characterized by high levels o f genetic diversity within populations and rel
atively low levels o f differentiation among populations (Loveless & Hamrick 1984; Finkeldey &
Hattemer 2007; White et al. 2007). The geographic variation in genetic diversity has important
implications for the ecological and evolutionary potential o f populations (for example, Hoffmann
& Blows 1994).
The spatial distribution o f genetic diversity in plant populations is mainly determined by life his
tory traits that influence mating patterns and gene dispersal (Hamrick 1989; Hamrick & Loveless
1989; Ouborg et al. 1999) and by the historical patterns o f relationship (e.g., Schaal et al. 1998).
Genetic diversity is rarely distributed homogeneously within populations and genetic similarity
is higher among neighbouring than among distant individuals (Vekemans & Hardy 2004; Jump
& Penuelas 2007). Such fine-scale genetic structure is affected by the mating system (higher in
selfing species), life form (higher in herbs than trees), population density (higher under low den
sity) and population size o f the target species (Vekemans & Hardy 2004, Cavers et al. 2005,
Jump & Penuelas 2007, Hardy et al. 2006).
Some studies on colonization history detected a decreasing genetic diversity with increasing dis
tance from refugial sources based on contemporary patterns of genetic diversity (Rivera-Ocasio
et al. 2002, Coart et al. 2005, Mulugeta, et al. 2007). Such patterns reflect the impact of genetic
drift associated with sequential founder effects (Wright 1969, Nei 1987, Rivera-Ocasio et al.
2002). Contrarily, others reported increasing pattern of gene diversity away from source popula
tions due to gene flow and population admixture effects (e.g., Comps et al. 2001, Petit et al.
2003).
In this study, the AFLP technique was employed to investigate patterns o f genetic diversity,
population differentiation and fine-scale spatial genetic structure o f Hagenia abyssinica from
Ethiopia. AFLP is preferred to other techniques because of its short start-up time and cost-
effective generation of data from a large number o f loci distributed randomly across the whole
58
Paper II: Genetic diversity at AFLPs
genome and the ease to generate anonymous multilocus DNA profiles in most species regardless
of origin or complexity without prior sequence knowledge of the target species (Vos et al. 1995;
Bensch & Akesson 2005, Mueller & Wolfenbarger 1999). Although it has not been possible to
separate heterozygotes (1/0) from homozygotes (1/1), the presence and absence data can be con
verted to expected heterozygosity by assuming Hardy-Weinberg equilibrium, to generate esti
mates directly comparable to codominant markers (Bensch & Akesson 2005). Also, genetic dif
ferentiation ( F s t ) values generated from dominant markers (AFLPs and RAPDs) were in general
similar to estimates obtained from microsatellites and allozymes (reviewed by Nybom 2004).
Hagenia abyssinica is a wind-pollinated and wind-dispersed broad-leaved dioecious tree species
belonging to a monotypic genus in the Rosaceae family (Hedeberg 1989; Legesse 1995). The
bright colourful and appealing appearance of the flowers of Hagenia is not typical for wind-
pollinated species, which are usually dull in colour (Legesse 1995), suggesting that other polli
nating vectors such as insects (particularly bees) or birds might be involved. It was also reported
that honeybees collect pollen from the male flowers and nectar from the female flowers (Fichtl &
Admasu 1994). The species is found in 12 countries in Africa stretching from Ethiopia in the
North to Zimbabwe in the South and inland to Congo (Hedeberg 1989;
http://www.worldagroforestry.org/Sites/TreeDBS/aft.asp). Hagenia is a multipurpose tree spe
cies bestowed with considerable economic and ecological values; but due to over-exploitation,
the species is gravely endangered in its natural range and especially in Ethiopia (Legesse 1995)
with only about 7000 individuals left.
According to fossil pollen records (Beuning et al. 1997; Bonnefille et al. 1995; Olago et al.
1999; Umer et al. 2007), Hagenia immigrated into Ethiopia in the late Pleistocene (since 16,700
years before present) from southern African countries (Taye et al. submitted (a). A recent phy-
logeographic investigation using maternally inherited chloroplast markers supported this coloni
zation history and suggested a single entry point into Ethiopia. Due to the recent colonization of
Ethiopia, it was possible to reconstruct the colonization route of the species and to identify rare
mutation and long distance seed disperal events. For example, six specific haplotypes were iden
tified that were grouped in two lineages, lineage II originated most likely from a single muta
tional event from lineage I (Taye et al. submitted (a)).
59
The genetic diversity of few populations of H. abyssinica was investigated by using anonymous
RAPD (Kumilign 2005) and ISSR (Tileye 2007) markers. Both studies covered a small spatial
scale contrasting to the widespread distribution of the species in Ethiopia and were also limited
to a comparatively small number of individuals per population. An investigation on the genetic
diversity at the nuclear level covering the natural distribution range would enhance further un
derstanding on the phylogeography and the forces shaping genetic variation patterns in Hagenia.
We expect that large-scale and fine-scale genetic variation patterns are affected by the aforemen
tioned historical processes and by the species' life history traits.
Three hypotheses were tested: 1) there is high variation within-populations due to effective gene
flow from different pollen and seed sources and very low differentiation among-populations due
to long-distance pollen and seed dispersal. 2) The species does not lose genetic diversity during
colonization due to effective gene flow that counteracts effects of genetic drift. Likewise, we ex
pect that the populations representing the two chloroplast lineages show similar levels of genetic
diversity, even though the derived one originated by a single mutational event (from a single
seed). 3) Given the wind-dispersed and wind-pollinated nature of Hagenia abyssinica, there is no
fine-scale spatial genetic structure.
Materials and methods
Sampling and DNA isolation
Twenty two natural and three planted populations were surveyed from all regions where Hagenia
is known to grow in Ethiopia. The natural populations are represented in 12 closed forests, 8
woodlands and 2 farmlands. The geographic distribution o f the sampled populations is illustrated
in Fig. 1 and the characteristics of the populations are presented in Table 1. The sizes o f the sam
pled trees range from 3m to 35m in height and from 2.5cm to 245cm in DBH. The distances be
tween trees within the same population range from 0.1m to 730m. The natural populations have
densities ranging from 0.7 to 75.7 individuals/ha (Table 5). Young leaves were collected and par
tially desiccated in paper bags before drying with silica gel and stored at room temperature until
DNA isolation. The sampling o f individuals was nearly exhaustive in most cases due to the small
Paper II: Genetic diversity at AFLPs
60
Paper II: Genetic diversity at AFLPs
number of trees available in the forests, keeping a minimum distance when large numbers of
trees were available. Trees were sampled from one spot in larger populations. The locations of
each tree were mapped. Sexes of trees were identified only for 12 populations that had flowers at
the time of the survey. Genomic DNA was isolated following the DNeasy 96 kit protocol of
Qiagen® (Hilden, Germany). Different leaf sizes were tested for DNA extraction. Finally, a size
of lctrr (ca. 20 mg) gave the best results and was used for DNA isolation.
DNA restriction, PCR amplification and genotyping
The laboratory protocol followed Vos et al. (1995) with some modifications. Genomic DNA was
digested with two different restriction enzymes, a rare-cutter CEcoRI; 5’-G |A ATTC-3’) and a
frequent-cutter (MseI; 5‘-Tj.TAA-3’), and short DNA fragments (adapters) were ligated to cohe
sive ends o f the restriction fragments. Four pi genomic DNA (about 10 ng) was added to 6 f.il
restriction-ligation reaction containing 1 pi T4-Ligase buffer (lOx), 1 pi NaCl (0.5M), 0.5 pi
BSA (1 mg/ml), 3 pi M± Adapter (5 pmol/pl), 0.6 E± Adapter (5 pmol/pl) and to 2 pi restriction-
ligation mix containing 0.2 pi T4-Ligase buffer (lOx), 0.2 pi NaCl (0.5M), 0.1 pi BSA
(1 mg/ml), 0.08 pi M sel (lOU/pl), 0.6 pi EcoRI (lOU/pl) & 0.82 pi T4-Ligase (4U/pl). The resul
tant solution was incubated at room temperature over-night. A pre-amplification PCR was run in
a Peltier Thermal Cycler PTC-200 (MJ Research®), with a total volume of 15 pi containing 7.8
pi HPLC H20 (high performance liquid chromatography water), 1.7 pi PCR buffer (lOx), 1 pi
dNTPs (2.5mM), 0.25 pi of the pre-selective primer M 03 (5 pmol/pl), 0,20 pi of EOl (5
pmol/pl), 0.06 pi Taq polymerase (Qiagen®) (5U/pl) and 4 pi of the restriction-ligation reaction
(diluted ~1:4). The pre-amplification PCR profile was 15 min. at 72 °C, followed by 20 cycles of
10 sec. denaturation at 94 °C, 30 sec. annealing at 56 °C and 2 min. extension at 72 °C, with a
final extension step o f 30 min. at 60 °C. A selective amplification was run with a total volume of
15 pi containing 8.11 pi HPLC H20 , 1.6 pi PCR buffer (lOx), 0.4 pi dNTPs (2.5mM), 0.6 pi M-
Primer (5 pmol/pl ), 0.25 pi E-Primer (5 pmol/pl ), 1.0 pi MgCl2 (25mM), 0.06 pi Taq poly
merase (Qiagen®) (5U/pl), and 3 pi pre-amplification product (diluted 1:10). The selective PCR
profile was 15 min. initial denaturation at 94 °C, followed by 9 cycles of 30 sec. denaturation at
94 °C, 30 sec. annealing at 65 °C (but reduced by 1 °C per cycle) and 2 min. extension at 72 °C,
followed 24 cycles o f 30 sec. denaturation at 94 °C, 30 sec. annealing at 56 °C and 2 min. exten
sion at 72 °C, with a final extension of 10 min at 72 °C. Aliquots of the selective amplification
61
Paper II: Genetic diversity at AFLPs
products were diluted (1:5) before electrophoretic separation. Two pi diluted selective PCR
product was added to 12 pi HiDi formamide dye containing -0.02 pi internal size standard (GS
ROX 500, Applied Biosystems®), denaturated for 2 minutes at 90°C, quickly cooled on ice, and
separated on a capillary sequencer ABI 3100 Genetic Analyser (Applied Biosystems®).
Eighteen primer combinations (4 E & 6 M primers) were tested in different sets (nomenclature
according to Keygene N.V.®). The primer combination E41-M67 (5’-FAM-GAC TGC GTA
CCA ATT CAG G-3’and 5-GAT GAG TCC TGA GTA AGC A -3’, respectively) showed a
well-resolved banding pattern and a high degree o f polymorphism. A total o f 596 individuals
(23-24 per population) were genotyped with this combination. Reproducibility tests were con
ducted on 15 samples randomly selected from each run. Only 100% reproducible loci were
Fig. 1. Distribution of Hagenia populations sampled from Ethiopia, represented by solid circles. Codes o f populations follow Table 1. Broken lines with arrows indicate the putative colonization route o f Hagenia starting from the most likely source population BG as deduced from cpDNA analysis (Taye et al. submitted (a)). Source map: Assefa G (unpublished)
Paper II: Genetic diversity at AFLPs
considered in the final analysis, resulting in 106 putative loci. Furthermore, three standard lanes,
two containing the same individuals and one holding a negative control were run on each plate to
compare the data from different runs and to check for the mobility of fragments.
Table 1 Description of Hagenia populations sampled from the mountains of Ethiopia
Popula tions Code L atitude L ongitude
altitude
(m asl) A R F
M in
T M ax T H n N
D ensity
(ind/ha)
*Sex
index
D ebark-M ariam DK 1 3 ° i r 37 °5 7 ' 3013 1270 8 .8 19.7 4 24 26 16 1
D ebark-P lan ta tion DKP 13°12' 38°01 ' 3005 1270 8 .8 19.7 4 24 - na
K im ir-D ingay
plantation
KDP 11°48' 3 8 °1 4 ’ - 1350 9.2 21.9 1 , 6 24 - na
W oldiya S e ’at
M ichael
W D 11°55" 3 9 °2 4 ’ 3112 908 na na 6 24 120 na
K osso-ber KB 10°59' 36°54 ' 2702 2381 12.9 27.4 1 24 60 52 na
D enkoro DR 10°52’ 38°47 ' 3061 896 10.9 2 1 .8 6 24 60 12.5 0.7
W onbera W B 10°34- 3 5 °4 1 ' 2428 1622 na na 5 24 60 75.7 na
W of-w asha w w 09 °4 5 ' 3 9 0 4 4 - 3159 941 6.1 19.9 1 24 45 5.4 na
C hilim o CM 0 9 °0 5 ' 38°10 ' 2805 1114 11.5 25.8 1 ,4 24 65 17.8 na
D indin DN 0 8 °3 6 ’ 40° 14 ’ 2410 989 12.7 28,0 1 24 55 13.9 na
Z equala A bo ZQ 08 °3 2 ' 38°50 ' 2856 1215 na na 1 23 60 0.7 0.3
B oter-becho BB 08 °2 4 ' 3 7°15 ' 2772 1666 5.7 23.6 1 24 60 27.8 1.2
C hilalo CL 0 7 °5 6 ' 3 9 °1 1 ’ 2815 796 9.8 23,0 1 24 70 7.1 1.8
Sigm o p lan tation SM P 0 7 °5 5 ' 36°10 ' 2300 1837 11.4 2 1 .6 4 24 na
Sigm o SM 0 7 °4 6 ' 3 6 °0 5 ’ 2651 1837 11.4 2 1 .6 4 23 60 23.8 na
M unesa M S 07 °2 5 ' 38°53" 2459 1028 10.1 24.3 1 24 80 10 na
B onga BG 07 °1 7 ' 3 6°22 ' 2238 2217 11.9 26.6 4 24 80 5 0.9
K ofele KL 07 o l l ' 3 8°52 ' 2757 1305 7.7 20.1 1,2,3 24 110 12.5 1.8
D insho DO 07 °0 5 ' 3 9 0 4 7 - 3117 1213 3.4 2 0 .8 2 24 260 16.7 3
D oddola-Serofta DS 0 6 °5 2 ’ 39°02 ' 2700 1074 6.7 24.3 2 23 75 10 2.9
D oddola-D achosa DD 06 °5 2 ' 3 9 0 , 4 - 3039 1074 6.7 24.3 2 24 5000 30.9 na
R ira RR 06 °4 5 ' 3 9 °4 3 ’ 2725 736 11a na 2 23 170 10.5 na
Bore BR 0 6 °1 7 ’ 38°39 ' 2631 1526 8.3 18.8 1,2,3 24 100 9.1 1.1
U raga UR 0 6 °0 8 ' 38°33 ' 2508 1228 8.3 18.8 2,3 24 70 13.9 0.7
H agereM ariam
Total
HM 0 5 ° 5 r 38°17 ' 2443 1228 12.3 23,0 2 24
110
9
55
6741
4.8 0.9
M asl= meters above sea level; ARF = Mean Annual Rainfall; ml = millilitres; Min T = Mean minimum temperature; Max T = Mean maximum temperature; H = chloroplast haplotype (Taye et al. submitted (a)); n= no. o f samples analysed ; N= population size; *sex index is determined from the relative numbers o f male to female individuals for 26-50 individuals from each population; na = not available. Source o f climatic data: National Meteorological Agency Service (Ethiopia)
63
Paper II: Genetic diversity at AFLPs
Data analysis
Data were aligned with the internal size standard using GENESCAN 3.7 and fragments were
scored with GENOTYPER 3.7 (Applied Biosystems®). Fragments with sizes ranging from 50-
500 nucleotides (bp) were scored as present (1) or absent (0) and transformed to a 1/0 matrix.
Each fragment was controlled and edited manually.
Overall and gender-segregated genetic diversity (estimated as total diversity (Ht), within-
population diversity (He) and among-population diversity (//b)), percentage of polymorphic loci
(PPL) at the 5% level, and coefficient of differentiation among-populations (.F s t ) were computed
using AFLP-SURV (Vekemans et al. 2002, available at http://www.ulb.ac.be/sciences/lagevA
following a Bayesian method with non-uniform prior distribution of allele frequencies (Zhivo-
tovsky 1999). The null hypothesis for the Fst test (that there is no genetic differentiation among
the populations) is rejected at p<0.001 if the observed FSt is higher than the value o f FSt lying at
the 1% rightmost part of the distribution (Table 3). This observation leads us to conclude that the
actual populations are genetically more differentiated than random assemblages of individuals.
Gene flow (Nm) was estimated using the formula: Nm = (1-Fst)/4Fst (Slatkin & Barton 1989).
Loci that were found to be monomorphic in all populations were excluded from the final compu
tation in order to obtain Nei's unbiased gene diversity that is comparable to expected heterozy
gosity (e.g., Nybom 2004). As Hagenia is a diocious and hence completely out-crossing species,
Hardy Weinberg equilibrium was assumed in all computations. Partition of genetic diversity and
the significance of the differences within and among-populations and different groups were esti
mated by the analysis of molecular variance (AMOVA) using ARLEQUIN Version 3.0 based on
AFLP phenotypes (Excoffier et al. 2005; http://cmpg.unibe.ch/software/arlequin3). The different
groups o f the sampled populations that are used to examine the partitioning o f genetic diversity
are provided in Supplementary Table 1. The fine-scale spatial autocorrelation analysis for 21
natural populations was performed with SPAGeDi 1.2 (Hardy & Vekemans, 2002) using pair
wise kinship coefficients (Fy) between individuals (Hardy 2003). The inbreeding coefficient is
assumed to be 0 (as for diocious species) following Hardy et al. (2006) and Tero et al. (2005).
The significance of the spatial genetic structure (SGS) was tested by upper and lower bounds of
the 95% confidence interval o f Fy defined after 10 000 random permutations o f individuals
among geographic locations. Eight distance classes were determined for all populations with one
64
Paper II: Genetic diversity at AFLPs
exception (DK) after series of tests in order to obtain a minimum of 30 pairs of individuals that
lie within a given distance interval. The distance classes were set to 4 for population DK. The
program NTSYS-pc 2.0 (Rohlf 1998) was used to draw a phylogenetic tree using the UPGMA
(Unweighted Pair Group Method with Arithmetic mean) clustering method and to examine the
correlation between geographic and genetic distances (Mantel test).
R esu lts
Within population genetic diversity
The AFLP analysis o f 596 samples from 25 populations of H. abyssinica resulted in a total of
106 unambiguously scorable putative markers in the range from 52 to 496 bps of which 97
(91.5%) were polymorphic. The percentage of polymorphic loci (PPL) within-populations ranges
from 29.9% at Dodola Serofta (farmland/homestead population with a size of N = 75) and Uraga
(located in a very small forest, N = 70) to 90.7% at Dinsho (located in a well-protected Park For
est, N = 260). Moderate to high gene diversities were observed at AFLP loci ranging from 0.139
at Dodola-Serofta to 0.362 at Dinsho (Table 2) with a mean genetic diversity of He = 0.195. The
largest remaining population DD (N = 5000) showed only a moderate genetic diversity (Hc =
0.173, PPL = 36.1%). On the other hand, population DK with only 26 remaining individuals
showed comparatively high levels of genetic diversity (He = 0.217, PPL = 45.4%). Even though
there are marked differences in genetic diversity for some populations, mean genetic diversities
for the two sexes are nearly the same ( //e = 0.207 ± 0.013 for male, / / e = 0.201 ± 0.019 for fe
male). The two chloroplast lineages (see introduction) show only minor non-significant differ
ences in mean and in total genetic diversity (Lineage 1: / / e = 0.193 / 0.206, Lineage II: mean He =
0.197/0.214; Table 2).
Based on chloroplast DNA analyses, the putative entry point of Hagenia into Ethiopia was the
southwest mountains of Ethiopia (Taye et al. submitted (a)). The colonization routes o f the spe
cies were reconstructed from southwest to the north, to the east and to the south (Fig. 1). There
was no significant association between migration distance and genetic diversity (//e, PPL) of
65
Paper II: Genetic diversity at AFLPs
populations (Spearman's nonparametric correlation r = -0.205, p= 0.186) and thus no indication
of loss of genetic diversity during colonization.
Partitioning o f genetic diversity among populations
The measures of gene diversity in subdivided populations (Nei 1987) show high mean within-
population variation (Hc = 0.195) and moderate population differentiation (Fsj = 0.077, p<
0.001). The differentiation between populations within the two chloroplast lineages of different
age was similar (Fst = 0.063 p< 0.001, F st =0.083, p < 0.001) (Table 3). The estimate o f gene
flow computed for all populations based on F s ia s the number o f migrants per generation was 3.
Analyses of molecular variance (AMOVA) based on AFLP phenotypes was performed for all
populations and for different groups (ecosystems, geographic regions, types of forest stands, tree
seed zones, chloroplast lineages and sexes, Table 4). The detailed description of the grouping is
provided in Supplementary Table 1. The AMOVA performed for all populations revealed that
10.4% of the total variation was attributed to the differences among populations. Very low pro
portions of the total variation were distributed among groups representing different ecosystems,
geographic regions, forest stands, tree seed zones and the two sexes (Table 4). Only differentia
tion among chloroplast lineages was significant (PV = 0.78%, p < 0.05). Within each category,
the level o f genetic differentiation among-populations is similar ranging from 7.5% to 10.6%
(Table 4). No private fragment or fragment fixed in one population was detected.
66
Paper II: Genetic diversity at AFLPs
Table 2 Summary of wilhin-populations genetic diversity of Hagenia abyssinica for 25 populations. The populations are sorted north to south.
Populations Forest typenAll
PPLAll
HeAll
DK woodland 24 45.4 0.217DKP plantation 24 47.4 0.226KDP plantation 24 39.2 0.183WD woodland 24 43.3 0.194KB Closed forest 24 45.4 0.206DR Closed forest 24 39.2 0.189WB Closed forest 24 43.3 0.211WW woodland 24 41.2 0.189CM Closed forest 24 37.1 0.192DN Closed forest 24 48.5 0.212ZQ Closed forest 23 45.4 0.205BB Closed forest 24 44.3 0.213CL woodland 24 37.1 0.177SMP plantation 24 33.0 0.146SM Closed forest 23 38.1 0.170MS Closed forest 24 49.5 0.200BG Closed forest 24 46.4 0.198KL Wooded grassland 24 42.3 0.195DO Closed forest 24 90.7 0.362DS Farmland 23 29.9 0.139DD Closed forest 24 36.1 0.173RR woodland 23 36.1 0.169BR Wooded grassland 24 38.1 0.187UR Closed forest 24 29.9 0.160HM Farmland 24 35.1 0.168Total/mean 596 100* 0.195
n = sam ple size; PPL = p ercen t o f p o lym orph ic loci; H c= N ei's gene d iversity ; fo r popu la tions code, see T able 1. *The to tal P PL is 100 because the m onom orph ic loci w ere excluded.
67
Paper II: Genetic diversity at AFLPs
Table 3 Summary of the mean gene diversity and population differentiation in subdivided populations o f Hagenia abyssinica for all populations and for the two chlorotype lineages
H, Hw Hb Fst
All LI LII All LI LII All LI LII All LI LII
Mean
Upper 99%
P
0.212
limit
0.206 0.214 0.195 0.193 0.197 0.016 0.013 0.018 0.077
0.013
0.000
0.063
0.013
0.000
0.083
0.018
0.000
H, = total diversity; Hw = within-population diversity; Hb = among-population diversity . F St = population differentiation; lineage I (LI): DK, DKP, KDP, WD, DR, WB, SM. SMP & BG populations; lineage II (LII): BB, BR, CL, CM, DD, DN, DO, DS, HM, KB, KL, MS, RR, UR, WW & ZQ populations; for population codes, see Table 1. Upper 99% limit = value o f FSt lying at the 1% rightmost part o f the distribution under the null hypothesis, p = the probability o f rejecting the null hypothesis
Relationships among populations
The UPGMA dendrogram (Fig. 2) was calculated from Nei’s genetic distances (Nei 1978). The
pair-wise Nei’s genetic distance matrix (Supplementary Table 2) among 25 populations exhibits
genetic differences of less than 7% for each pairs of population. In general, the UPGMA dendro
gram does not reflect the geographic origin of the populations. While populations BR, DD, KL &
HM from the southern region are assembled in the same cluster together with one population
from the northern region, populations DS, MS, RR, UR and DO from the same region are dis
tributed in different parts of the UPGMA tree. Dinsho population is an outlier being the most
dissimilar population with the highest gene diversity (0.362). The planted populations DKP and
SMP were not clustered with their putative parent populations DK and SM, respectively (Fig. 2).
A test of association between geographic and genetic distances (Mantel test) showed a very low
and non-significant correlation (r = 0.14607, p = 0.9024). For example, the highest genetic dis
tance was observed between population RR and DO (0.0669) that are geographically close (37.5
km air distance) but separated by a big mountain embracing the second highest peak in the coun
try. On the other hand, the three pairs o f populations with the lowest genetic distances (from 0 to
0.0005) between them (WD & WW, WD & BB and KL & BR) are widely separated (240 km,
452 km and 103 km, respectively), with some small mountains between them.
68
Paper II: Genetic diversity at AFLPs
Table 4 Partitioning of AFLP variation among Hagenia abyssinica individuals in Ethiopia computed by analysis o f molecular variance (AMOVA).
Source of variation df SS vc pv IsAmong-populations 24 557.42 0.71554 10.4 ***Within-populations 571 3521.63 6.16748 89.6 ***Among ecosystem groups 4 89.92 -0.00874 -0.13 nsAmong-populations 20 467.50 0.72178 10.49 ***Within-populations 571 3521.630 6.16748 89.64 ***Among geographic groups 3 105.427 0.09441 1.4 nsAmong-populations 21 451.993 0.64411 9.3 ***Within-populations 571 3521.63 6.16748 89.3 ***Among stand groups 3 64.062 -0.01630 -0.24 nsAmong-populations 21 493.358 0.72650 10.56 * * *
Within-populations 571 3521.63 6.16748 89.67 ***Among tree seed zones groups 12 311.133 0.18654 2.7 nsAmong-populations 9 168.756 0.52310 7.5 ***Within-populations 502 3132.63 6.24030 89.8 ***Among chloroplast lineage groups 1 37.525 0.05421 0.78 *Among-populations 23 519.895 0.68950 9.98 ***Within-populations 571 3521.630 6.16748 89.24 ***Among sex groups 1 3.702 -0.08835 -1.34 nsAmong-populations 22 270.164 0.70368 10.64 ***Within-populations 193 1157.245 5.99609 90.69 ***
df = degree of freedom, SS = sum of squares, vc = variance components, pv= percent variation, Is = level of significance, *** = highly significant at p<0.001, * = significant at p<0.5, ns = not significant
Fine-scale spatial genetic structure
In general, most populations from farmlands, wooded grasslands and woodlands (6 out of 8)
showed significant spatial genetic structure up to longer distances (36-80 m) whereas only 4 out
o f 13 closed forest populations showed family structure at shorter distance classes (15 - 44 m)
(Table 5, Supplementary Fig. 1). No SGS was observed in the largest remaining Hagenia popu
lation (DD) in Ethiopia (~ 5000 individuals) while significant SGS was observed in the second
largest population DO (N= 260), harboring the highest genetic diversity. In most (7 out of 10) of
the small populations (N = 55-80) of the closed forst type, no SGS was observed (Table 5). Den
sity, population size and distance from the nearest population were not associated with the kin-
69
Paper II: Genetic diversity at AFLPs
ship coefficient averaged over distance classes F(d) o f 21 natural populations (for example,
Spearman's nonparametric correlation coefficient (r) for density = -0.065, p = 0.391).
cuB)i_rWD(A)r
WW(B) —
MS(D)— I
SMPfC) — '
D S ( D ) | _
ITODt
SM(C)-----
KDP(A)-----
RR(D)-----
ZQ(B)-----
BG(C),
CH(B)
DN(B)
DR(A)
B R D )
KUD)DD(D)
WB(A)
HMD)DK(A)
K » A )
DKP(A)
DO(D)
l)T_n -
0.00
Q
0A3N « s genetic
Fig. 2 UPGMA tree drawn from Nei’s (1978) genetic distances computed from AFLPs. Population codes follow Table 1. Letters in parenthesis designate geographic regions: A= northern region, B= central region, C= southwestern region, D= southern region.
70
Table 5 Spatial genetic structure in Hagenia populations
Population
C ode
T ype o f fo rest S tand type S am ple
size
Pop
size
D ensity
Ind./ha
M a
X.
F(d)
M ax
distance
D istance
classes*
Sex
dex
D istance
in- (km ) from
nearest
popu la tion
KB C losed forest H agen ia-dom inated m ixed stand 24 60 52 0.06 15 1-2 na 141.2 (W B)DR C losed forest M ixed, sparse H agenia 24 60 12.5 ns ns 0.7 131.7
(W D )W B C losed forest H agen ia-dom inated m ixed stand 24 60 75.7 ns ns na 141.2 (K B )CM C losed forest M ixed, sparse H agenia 24 65 17.8 0.09 31.6 1-3 na 98.8 (ZQ )DN C losed forest M ixed, sparse H agenia 24 55 13.9 ns ns na 136.3 (CL)ZQ C losed forest M ixed, sparse H agenia 23 60 0.7 ns ns 0.3 78.3 (CL)BB C losed forest M ixed, sparse H agenia 24 60 27.8 0.07 18 1 1.2 122.2 (CM )SM C losed forest M ixed, sparse H agenia 23 60 23.8 ns ns na 69.3 (BG )M S C losed forest M ixed, sparse H agenia 24 80 10 ns ns na 28.5 (K L)BG C losed forest H agenia-dom inated m ixed stand 24 80 5 ns ns 0.9 69.3 (SM )DO C losed forest H agenia-dom inated m ixed stand 24 260 16.7 0.21 44 1 3 37.5 (RR)DD C losed forest H agenia-dom inated m ixed stand 24 5000 30.9 ns ns na 22.3 (D S)U R C losed forest M ixed, sparse H agenia 24 70 13.9 ns ns 0.7 20.6 (BR)DS Farm land Pure H agenia stand 23 75 10 0.12 64 1-2 2.9 22.3 (D D )HM Farm land H agenia-dom inated m ixed stand 24 55 4.8 0.09 58 1 0.9 41.0 (U R)KL W ooded grassland H agen ia-dom inated m ixed stand 24 110 12.5 0.2 56 1 1.8 28.5 (M S)BR W ooded grassland H agenia-dom inated m ixed stand 24 100 9.1 ns ns 1.1 20.6 (U R)DK w oodland Pure H agenia stand 24 26 16 0.19 36 I 1 215.0
(W D )W W w oodland H agenia-dom inated m ixed stand 24 45 5.4 ns ns na 141.7 (D N )CL w oodland H agenia-dom inated m ixed stand 24 70 7.1 0.08 80 1-2 1.8 61.4 (M S)RR w oodland H agenia-dom inated m ixed stand 23 170 10.5 0.06 52 1-2 na 37.5 (D O )* Distance classes for only populations that showed family structures are indicated.
Paper II: Genetic
diversity at A
FLP
s
Paper II: Genetic diversity at AFLPs
Discussion
Genetic diversity and population differentiation
The moderate to high genetic diversity in Hagenia reflects effective gene flow from dif
ferent pollen and seed sources, resulting in low population differentiation, which in turn
reflects effective long-distance pollen and/or seed dispersal among-populations. This ob
servation confirms the first hypothesis that predicted high variation within populations
and low differentiation among populations. The absence of association between genetic
and geographic distances might be explained by a random and long-distance dispersal of
pollen. Accordingly, planted populations were not clustered with their putative parent
populations unlike for chloroplast markers, where plantations showed the same haplo
types as their parent populations (Taye et al. submitted (a)).
Phylogeographic analyses of the same 25 populations at cpDNA revealed two chloroplast
lineages (Taye et al. submitted (a)). Most likely, lineage I originated from Lineage II by a
deletion in a specific chloroplast region. Thus all plants o f lineage I originated from a
single seed during colonization o f Ethiopia. Assuming restricted gene flow by pollen we
would expect a much lower genetic diversity in populations with the derived chloroplast
haplotypes o f lineage I. However, the two chloroplast lineages demonstrated comparable
mean genetic diversities with lineage II exhibiting slightly higher values. Also genetic
differentiation (Fst) between populations of chloroplast lineage II and the derived lineage
I were similar, showing the harmonizing effect o f gene flow.
No trend of decreasing genetic diversity during colonization was detected, reflecting ef
fective gene flow. This observation allows us to accept the hypothesis “Hagenia does not
lose genetic diversity during colonization due to effective gene flow that counteracts ef
fects of genetic drift” . A general trend o f increasing genetic diversity away from refugia
was observed in European beech based on isozymes (Comps et al. 2001), suggesting a
gain in gene diversity during recolonization due to gene flow, population admixture ef
fects and selection. Petit et al. (2003) also reported that the mixing of colonization routes
and increased levels o f seed flow resulted in increased intrapopulation diversity away
Paper II: Genetic diversity at AFLPs
from refugia in some European woody species. In contrast, Lobelia giberroa, which en
tered Ethiopia also from the south (Mulugeta, et al. 2007), Carpinus betulus (Betulaceae)
in Europe (Coart et al. 2005) and Ptercarpus officinalis (Fabaceae) in the Caribbean
(Rivera-Ocasio et al 2002) demonstrated decreasing diversity during recolonization (all
based on AFLP analyses). The level of genetic diversity in a population is affected by an
array of genetic, life history and ecological characteristics that collectively define the
population’s genetic structure (Yeh 2000). Lobelia giberroa has a giant-rosette growth
form, reaching 9m when in flower (Mulugeta, et al. 2007) and it grows in altitudes higher
than Hagenia. As Hagenia is a canopy tree, pollen and seeds can disperse over long dis
tances contributing to the maintenance of comparatively high levels of gene diversity.
In general, closed forest populations harbored more gene diversity (mean He = 0.207)
than woodland (mean He = 0.190) and farmland (mean He = 0.172) populations. The
maximum genetic diversity was recorded for the population Dinsho (DO) that is situated
in a well-protected Park Forest whereas the lowest genetic diversity was recorded for the
farmland populations Doddola Serofta (DS) and Hagere Mariam (HM), suggesting a
negative effect of human-induced selection.
Comparison o f genetic diversity with other species
Most genetic diversity studies of trees were done with isozymes (e.g., Hamrick & Godt
(1996)) and hence the results are not directly comparable with AFLP based diversity es
timates. In a review of the estimation of intraspecific genetic diversity in plant species by
using nuclear DNA markers, Nybom (2004) reported a slightly higher mean within-
population diversity (Hpop) o f 0.22 (RAPD), 0.23 (AFLP) and 0.22 (ISSR) based on the
outcome of 60, 13 & 4 studies, respectively. The overall mean gene diversity of Hagenia
at AFLPs (He = 0.195) is comparable to some other plant species such as the insect-
pollinated Hibiscus tiliaceus (Malvaceae, He = 0.198, Tang et al., 2003) and the wind-
pollinated Acanthopanax sessiliflorus (Araliaceae, He = 0.187, Huh et al., 2005) but
lower than the insect-pollinated Malus sylvestris (Rosaceae, He = 0.225, Coart et al.,
2003). Studies based on AFLP markers are limited to a few tropical tree species and in
73
Paper II: Genetic diversity at AFLPs
formation on the method of estimating He is missing in most of the cases, making com
parisons difficult. Here, we report a comparative analysis from the available literature
applying the same method for the estimation o f allele frequencies. The insect-pollinated
tropical species Dipterocarpus cf. condorensis (Dipterocarpaceae, He = 0.215, Luu 2005)
also showed a slightly higher mean gene diversity than Hagenia at AFLP markers. H.
abyssinica exhibited higher mean gene diversity than some other tropical and subtropical
tree species such as the bird-pollinated Lobelia giberroa (Apocynaceae, He = 0.066, Mu-
lugeta, et al. 2007) the insect-pollinated Shorea leprosula (Dipterocarpaceae, He =
0.161, Cao et al. 2006), the insect-pollinated Shorea parvifolia (Dipterocarpaceae, He =
0.138, Cao et al. 2006), the insect and wind-pollinated Acer skutchii (Sapindaceae, He =
0.15, Lara-Gomez et al., 2005) and the bird-pollinated Pelliciera rhizophorae (Pellici-
eraceae, He = 0.117, Castillo-Cardenas et al. 2005) at AFLP loci. Tileye et al. (2007) re
ported higher mean gene diversity (0.30) in 12 populations of Hagenia from central and
southern regions of Ethiopia at 84 polymorphic ISSR markers. But Qian et al. (2001) and
Nybom (2004) argued that ISSR markers generally over-estimate gene diversity as com
pared to other markers. Hagenia also showed lower mean gene diversity at AFLPs than
some other tree species growing in Ethiopia, notably, the insect-pollinated Cordia afri
cana (Boraginaceae, He = 0.287, Abayneh 2007) and the wind-pollinated Juniperus pro-
cera (Cupressaceae He = 0.269, Demissew 2007). The wider distribution o f both species
and the effective dispersal o f seeds of Cordia by animals explain the higher diversity than
Hagenia. The habitat of Juniperus is closer to Hagenia than Cordia that grows in lower
altitudes and warmer climate.
In the present study, the maximum gene diversity is recorded for population Dinsho (DO)
in the Bale region, conforming to the highest gene diversity found in wild coffee (Coffea
arabica, Rubiaceae; Aga et al. 2005) and Lobelia giberroa (Mulugeta et al. 2007) re
ported from the same region at ISSR and AFLP markers, respectively. But the neighbour
ing population Rira (RR), which is closer to the aforementioned populations o f Coffea
arabica and Lobelia giberroa, showed much lower He than Dinsho. In contrast Tileye et
al. (2007), Abayneh (2007) and Demissew (2007) reported lower gene diversity in
Hagenia abyssinica (ISSR), Cordia africana (AFLP) and Juniperus procera (AFLP), re
74
Paper II: Genetic diversity at AFLPs
spectively from the Bale region as compared to other regions. The disagreement between
the result of Tileye et al. (2007) and that of the present study on the same population
(DO) of H. abyssinica is most likely due to small number of trees sampled by the former.
In accordance with the wind-pollinated and out-crossing mating system of Hagenia, a
moderate population differentiation ( F s t ) was observed, suggesting high levels of gene
flow particularly via pollen. Hamrick and Godt (1996) reported an average Fst value of
0.092 for out-crossing perennials at isozyme loci. High levels of gene flow are not unex
pected for out-crossing tree species (Hamrick & Godt 1989) and it is reinforced in
Hagenia by a recent divergence of populations as confirmed by cpDNA and palynologi
cal evidences (Taye et al. submitted (a)). Tileye et al. (2007) found a higher coefficient of
differentiation (Gst = 0.25) among 12 populations of Hagenia using ISSR markers. They
sampled fewer individuals (10 trees) per population and also included different popula
tions that are smaller in size. This might explain the differences between the two studies.
Comparable levels of population differentiation were found at AFLPs in Cordia africana
( ® st = 0.072, Abayneh 2007), Acer skutchii ( F st = 0.075, Lara-Gomez et al. 2005),
Acanthopanax sessilifloms (Gst = 0.069, Huh et al., 2005) and in two species from the
Betulaceae family that have a similar breeding system as Hagenia - Carpinus betulus
(Fst = 0.074) and C. orientalis (Fst = 0.0863) (Coart et al. 2005). Higher coefficients of
population differentiation were also reported for insect-pollinated Shorea species ( F St =
0.25-0.31, Cao, 2006) and Hibiscus tiliaceus ( F st = 0.152, Tang et al., 2003), and bird-
pollinated Pelliciera rhizophorae ( F st = 0.265, Castillo-Cardenas et al. 2005) based on
AFLP markers. On the other hand, Fst values lower than that of Hagenia were reported
for wild Malus sylvestris (Rosacea, F s t= 0.0464, Coart et al. 2003).
Fine-scale spatial genetic structure
Despite the dispersal o f seed and pollen by wind, significant spatial genetic structure was
observed within nearly half o f the populations of Hagenia abyssinica, reflecting restricted
geneflow within populations and mating of related trees. Positive values of F;j were found
at short distances, indicating higher genetic relatedness among neighbor individuals than
random pairs of individuals, whereas negative values o f Fy occurred at larger distances,
75
Paper II: Genetic diversity at AFLPs
showing isolation-by-distance within a population (Tero et al. 2005). Significant spatial
genetic structure in Hagenia extends up to 80 m from individual trees. This result allows
us to reject the hypothesis that predicts absence o f fine-scale genetic spatial patterning in
Hagenia. While there was no association between tree density, population size or dis
tance from the nearest population and the occurrence o f wide-ranging SGS, significant
SGS was observed more frequently in farmlands and woodlands as compared to closed
forests. The extent o f SGS in the present study is possibly underestimated due to low
sample size and lower number of AFLP loci as compared to other studies. For example,
Jump and Penuelas (2007) observed SGS upto about 30m at 6 SSR loci, while significant
SGS upto 110m was observed at 250 AFLP markers in wind-pollinated Fagits svlvatica.
Conclusions and recommendations
The intrapopulation genetic diversity and interpopulation genetic differentiation o f Hage
nia abyssinica is consistent with earlier predictions based on breeding system, life cycle,
population size, density and geographic range. Despite the relatively recent colonization
of Ethiopia by Hagenia abyssinica that has been suggested by fossil pollen data (Taye et
al. submitted (a)) and the small population sizes, the AFLP analysis detected moderate to
high gene diversities within populations with considerable differences in He between
populations, and moderate but significant genetic differentiation among populations.
Since even little effective pollen per generation is sufficient to counteract loss of genetic
diversity (Wright 1931, Finkeldey & Hattemer 2007), the effect of recent colonization
and the small population sizes is not reflected in the levels of gene diversity. The ob
served variation at putatively neutral markers does not reflect clinal variation patems.
Consequently, 1) a seed zone approach is questionable to conserve genetic diversity, 2) it
is difficult to capture optimal variation for conservation and tree improvement based on
approaches to sample ecological and/or geographic zones, 3) Due to significant genetic
differentiation observed among populations, it is necessary to collect seeds from as many
populations as possible for gene bank storage, and for the establishment of provenance
trials and ex situ plantations. The very high gene diversity in some populations calls for
the need to conserve the observed variability. The moderate to high intraspecific variation
76
Paper II: Genetic diversity at AFLPs
and a wide vertical distribution o f the populations (2200 to 3200 m asl) may suggest that
Hagenia might have occupied wider areas in the past than at present. The extant popula
tions, on the other hand, harbor quite high levele of gene diversity despite of their small
sizes. Nonetheless, our data suggests that human impact in the form of selective removal
of trees conversely affects gene diversity, as observed in the two farmland populations. A
significant fine-scale spatial genetic structure was observed in some populations despite
the dispersal of seed and pollen o f Hagenia by wind.
Further work on the intraspecific genetic variation and palynological investigations in
other African countries where Hagenia is known to grow is suggested to fully understand
the colonization history and to identify the refugia of the species. Paternity analyses to
estimate effective pollen-flow distances are also recommended.
Acknowledgements
This project is a component of the “Support to the Forest Genetic Resources Conserva
tion Project” of the Ethiopian Institute of Biodiversity Conservation (1BC) supported by
the German Federal Ministry of Economic Cooperation and Development (BMZ) through
the German Technical Cooperation (gtz). The German Academic Exchange Service
(DAAD) executed the grant. The National Meteorological Service Agency of Ethiopia
provided climatic data. We thank Oleksandra Dolynska, Thomas Seliger and Olga Artes
for kindly assisting in the laboratory.
77
Paper II: Genetic diversity at AFLPs
References
Abayneh, D. 2007. Genetic variation in Cordia africana Lam. In Ethiopia. PhD thesis, Georg-August University of Gottingen.
Aalbaek A (1993) Tree seed zones for Ethiopia. National Tree Seed Project, Addis AbabaAga, E., Bekele, E. and Bryngelsson T. 2005. Inter-simple sequence repeat (ISSR) varia
tion in forest coffee tree (Coffea arabica L.) populations from Ethiopia. Genetica, 124:213-221.
Azene, B.T., Bimi,e A. and Tegnas, B 1993. Useful trees and shrubs for Ethiopia: identification, propagation and management for agricultural and pastoral communities. Technical handbook No. 5, Regional Conservation Unit, Swedish International Development Authority (SIDA).
Berhanu, M.A., Ngadjui, B.T., Merhatibeb, B. and Mdee, L.K. 1999. Novel natural products from marketed plants o f eastern and southern Africa. Pure Appl. Chem. 71: 919- 926.
Bensch, S. and Akesson, M. 2005. Ten years o f AFLP in ecology and evolution: why so few animals? Mol. Ecol. 14: 2899-2914.
Beuning, KRM, Talbot, M.R., Kelts, K. 1997. A revised 30,000-year paleoclimatic and paleohydrologic history o f Lake Albert, East Africa. Palaeogeogr. Palaeocl. 136: 259- 279.
Bonnefille, R., Riollet, G., Buchet, G., Icole, M., Lafont, R., Arnold, M., Jolly, D. 1995. Glacial/interglacial record from intertropical Africa, high resolution pollen and carbo data at Rusaka, Burundi. Quaternary Sci. Rev. 14: 917-936.
Cao, C-P., Finkeldey, R., Siregar, I.Z., Siregar, U.J., Gailing, O. 2006. Genetic diversity within and among-populations o f Shorea leprosula Miq. and Shorea parvifolia Dyer (Dipterocarpaceae) in Indonesia detected by AFLPs. Tree Genet Genomes, 2: 225-239.
Castillo-Cardenas, M.F., Toro-Perea, N., and Cardenas-Henao, H. 2005. Population genetic structure of neotropical Mangrove species on the Colombian Pacific Coast: Pel- liciera rhizophorae (Pellicieraceae). Biotropica, 37: 266-273.
Cavers S., Degen B., Caron H., Lemes, M.R., Margis, R., Salgueiro, F., and Lowe, A.J. 2005. Optimal sampling strategy for estimation of spatial genetic structure in tree populations. Heredity, 95: 281-289.
Cavers, S., Navarro, C., Lowe, A.J. 2003. Chloroplast DNA phylogeography reveals colonization history of a neotropical tree, Cedrela odorata L., in Mesoamerica. Mol. Ecol. 12: 1451-1460.
Coart, E., Van Glabeke, S., Petit, R.J., Van Bockstaele, E. and Roldan-Ruiz, I. 2005. Range wide versus local patterns of genetic diversity in hornbeam (Carpinus betulus L.). Conserv Genet. 6: 259-273.
Coart, E., Vekemans, X., Smulders, M..JM., Wagner, I., Huylenbroeck. J.V., Bockstaele, E.V. and Roldan-Ruiz, I. 2003. Genetic variation in the endangered wild apple (Ma- lus sylvestris (L.) Mill.) in Belgium as revealed by amplified fragment length polymorphism and microsatellite markers. Mol. Ecol. 12: 845-857.
78
Paper II: Genetic diversity at AFLPs
Comps, B., Gomory. D., Letouzey, J., Thiebaut, B. and Petit. R.J. 2001. Diverging trends between heterozygosity and allelic richness during post glacial colonization in the European beech. Genetics, 157: 389-397.
Dawit, A. and Ahadu A. 1993. Medicinal Plants and Enigmatic Health Practices of Northern Ethiopia. Addis Ababa.
Degen, B., Petit, R. and Kremer, A. 2001. SGS - Spatial Genetic Software: a computer program for analysis of spatial genetic and phenotypic structures of individuals and populations. J. Hered. 92: 447-448.
Demissew, S.D. 2007. Genetic variation of Juniperus procera Hochst. Ex Endl. populations in Ethiopia assessed by using microsatellite (SSR) and AFLP markers. MSc. Thesis. Georg-August University of Gottingen.
Excoffier, L., Laval, G., Schneider, S. 2005. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol Bioinformatics Online, 1: 47-50.
Faris, H. 1998. Seedling biomass, seed germination responses and cytology of Hagenia abyssinica (Bruce) J.F.Gmel. MSc. Thesis, Addis Ababa University.
Fichtl R, Admasu A 1994. Honeybee flora o f Ethiopia. DED - Margraf Verlag, Weikers- heim.
Finkeldey, R., and Hattemer, H.H. 2007. Tropical Forest Genetics. Springer-Verlag, Berlin.
Hamrick, J.L. 1989. Isozymes and the analysis of genetic structure in plant populations. In Isozymes in Plant Biology. Edited by D.E. Soltis, and P.S. Soltis. Dioscorides Press, Portland, pp. 87-105.
Hamrick, J.L., and Loveless, M.D. 1989. The genetic structure of tropical trees populations: associations with reproductive biology. In Evolutionary Ecology of Plants. Edited by J.H. Bockand, and Y.B. Lindhart. Westview Press, Boulder, pp. 129-146.
Hamrick, J. L., and Godt, M. J. 1989. Allozyme diversity in plant species. In Plant population genetics, breeding and germplasm resources. Edited by A.H.D Brown, M.T. Clegg, A.L. Kahler, and B.S. Weir. Sinauer, Sunderland, Mass.
Hamrick, J.L., and Godt, M.J.W. 1996. Effects of life history traits on genetic diversity in plant species. Philos. Trans. R. Soc. Lond. B. 351: 1291-1298.
Hardy, O.J. Maggia, L., Bandou, E., Breyne, P., Caron, H., Chevallier, M-H., Doligez, A., Dutech, C., Kremer, A., Latouche-Halle, C., Troispoux, V., Veron, V. and Degen, B. 2006. Fine-scale genetic structure and gene dispersal inferences in 10 Neotropical tree species. Mol. Ecol. 15: 559-571.
Hardy, O.J. 2003. Estimation of pairwise relatedness between individuals and characterization o f isolation-by-distance processes using dom inant genetic m arkers. Mol. Ecol. 12: 1577-1588.
Hardy, O. J., and Vekemans X. 2002. SPAGeDi: a versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol. Ecol. Notes, 2: 618-620.
Hedeberg, O. 1989. Rosaceae. In Flora o f Ethiopia, Vol. 3, Pittosporaceae to Arralaceae. Edited by I. Hedeberg, and S. Edwards. Addis Abeba and Asmara, Ethiopia; Uppsala, Sweden.
Hoffmann, A.A. and Blows, M.W. 1994. Species borders: ecological and evolutionary perspectives. Trends Ecol. Evol. 9: 223-227.
79
Paper II: Genetic diversity at AFLPs
Huh, M.K, Huh, H.W. and Back, K. 2005. Genetic diversity and population structure of Acanthopanax sessiliflorus (Araliaceae) using AFLP. Korean J Genetics, 27: 71-79.
Jansen, P.C.M. 1981. Spices, condiments and medicinal plants in Ethiopia, their taxonomy and agricultural significance. Wageningen.
Jump A.S., and Penuelas J. 2007. Extensive spatial genetic structure revealed by AFLP but not SSR molecular markers in the wind-pollinated tree, Fagus sylvatica. Mol. Ecol. 16: 925-936.
Lara-Gomez, G., Gailing O., and Finkeldey R. 2005. Genetic variation in isolated Mexican
populations of the endemic maple Acer skutchii Rehd. Allg. Forst- u J-Ztg. 176: 97- 103.
Legesse, N. 1995. Indigenous trees o f Ethiopia: biology, uses and propagation techniques. SLU, Reprocentralen, Umea.
Loh, J.P., Kiew, R., Hay, A., Kee, A., Gan, L.H. and Gan, Y.-Y. 2000. Intergeneric and interspecific relationships in Araceae tribe Caladieae and developmol/pl ent of molecular markers using amplified fragment length polymorphism (AFLP). Ann. Bot. 85: 371-378.
Loveless, M.D., and Hamrick, J.L. 1984. Ecological determinants o f genetic structure in plant populations. Annu. Rev. Ecol. Syst. 15: 65-95.
Luu, H.T. 2005. Genetic variation and the reproductive system o f Dipterocarpus cf. condorensis Pierre in Vietnam. PhD Thesis, Georg-August University of Gottingen.
Mueller, U.G. and Wolfenbarger, L. L. 1999. AFLP genotyping and fingerprinting. Trends Ecol. Evol. 14(10): 389-394.
Mulugeta, K., Ehrich D., Taberlet P., Sileshi N. and Brochmann, C. 2007. Phylogeography and conservation genetics o f a giant lobelia (Lobelia giberroa) in Ethiopian and Tropical East African mountains. Mol. Ecol. 16: 1233-1243.
Nei, M. 1987. Molecular evolutionary genetics. Columbia University Press. Pp 512.Nei, M. 1978. Estimation o f average heterozygosity and genetic distance from a small
number o f individuals. Genetics, 89: 583-590.Nybom, H. 2004. Comparison of different nuclear DNA markers for estimating intras-
pecific genetic diversity in plants. Mol. Ecol. 13: 1143-1155.Olago, D.O., Street-Perrott F.A., Perrott R.A., Ivanovich M., Harkness D.D. 1999. Late
quaternary glacial-interglacial cycle of climatic and environmental change on Mount Kenya. J Afir Earth Sci. 29: 593-618.
Ouborg, N.J., Piquot, Y., Van Groenendael, M. 1999. Population genetics, molecular markers and the study of dispersal in plants. J. Ecol. 87: 551-568.
Pankhurst, R. 1969. The Traditional Taenicides o f Ethiopia. J. Hist. Med. All. Sci. (XXIV): 323-334.
Petit, R.J., Aguinagalde, I., de Beaulieu J-L., et al. (2003) Glacial refugia: hotspots but not melting pots o f genetic diversity. Science, 300, 1563-1565.
Qian, J., Luscombe, N.M., and Gerstein, M. 2001. Protein family and fold occurrence in genomes: power-law behaviour and evolutionary model. J. Mol. Biol. 313: 673-681.
Rivera-Ocasio, E., Aide, T.M. and McMillan, W.O. 2002. Patterns of genetic diversity and biogeographical history o f the tropical wetland tree, Pterocarpus officinalis (Jacq.), in the Caribbean basin. Mol. Ecol. 11: 675-683.
80
Paper II: Genetic diversity at AFLPs
Rohlf, F.J. 1998. NTSYS-pc: Numerical taxonomy and multivariate analysis system (Version 2.0). State University of New York, USA.
Schaal, B.A., Hayworth, D.A., Olsen, K.M., Rauscher, J.T., Smith, W.A. 1998. Phylo- geographic studies in plants: problems and prospects. Mol. Ecol. 7: 465-474.
Slatkin, M. and Barton, N.H. 1989. A comparison of three indirect methods for estimating average levels o f gene flow. Evolution, 43: 1349-1368.
Tang, T., Zhong, Y., Jian, S.G. and Shi, S.H. 2003. Genetic diversity of Hibiscus tilia- ceus (Malvaceae) in China assessed using AFLP markers. Ann. Bot. 92: 409-414.
Tero, N., Aspi, J., Siikamaki, P., and Jakalaniemi. A. 2005. Local genetic population structure in an endangered plant species, Silene tatarica (Caryophyllaceae). Heredity, 94: 478—487.
Tileye, F. Nybom, H., Bartish I.V. and Welander M. 2007. Analysis of genetic diversity in the endangered tropical tree species Hagenia abyssinica using ISSR markers. Genet. Resour Crop Ev. 54: 947-958.
Umer, M., Lamb, H.F., Bonnefille, R., Lezine, A-M., Tiercelin, J-J., Gibert, E., Gazet, J- P., Watrin, J. 2007. Late Pleistocene and Holocene vegetation history of the Bale Mountains, Ethiopia. Quaternary Sci. Rev. 26: 2229-2246.
Vekemans, X., Beauwens, T., Lemaire, M. and Roldan-Ruiz, I. 2002. Data from amplified fragment length polymorphism (AFLP) markers show indication of size homo- plasy and a relationship between degree of homoplasy and fragment size. Mol. Ecol. 11: 139-151.
Vekemans, X., Hardy. O.J. 2004. New insights from fine-scale spatial genetic structure analyses in plant populations. Mol. Ecol. 13: 921-935.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., Lee, Th. van der, Homes, M., Frijters, A., Pot, J., Peleman. J., Kuiper, M. and Zabeau, M. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414.
White, T.L., Adams, W.T., and Neale, D.B. 2007. Forest Genetics. CABI Publishing, Wallingford and Cambridge.
Wright, S. 1969. The theory of gene frequencies. In Evolution and the Genetics of Populations, Vol. 2. University o f Chicago Press, Chicago. Pp 511.
Yeh, F.C. 2000. Population Genetics. In Forest conservation genetics: principles and practice. Edited by A.Young, D. Boshier, and T.Boyle. CABI Publishing. Pp 352.
Zhivotovsky, L.A. 1999. Estimating population structure in diploids with multilocus dominant DNA markers. Mol. Ecol. 8: 907-913.
81
Paper II: Genetic diversity at AFLPs
Supplementary materials to Paper II
Supplementary Table 1 The grouping of the sampled Hagenia populations that are used to examine the partitioning of genetic diversity at AFLP loci.
No. of List of populations1populations
Micro-ecosystem types of sampled populationsClosed forest 12 DO, Z0 , BB, MS, SM, UR, KB, DN, DR, BG,
CM, DDOpen forest/woodland 6 WW, CL, WD, RR, DK, WBFarm land/ Homestead 2 DS, HMWooded grassland 2 BR, KLPlantation 3 DKP, SMP, KDP
Types of Hagenia forest standsMixed stand, sparse Hagenia 8 ZQ, BB, MS, SM, UR, DN, DR, CM,//agew'a-dominated mixed 12 DO, KB. BG, DD, WW, CL, WD, RR, WB,stand HM, BR, KLPure Hagenia stand 2 DS, DKPlantation 3 D K P , S M P, K D P
Geographic regionsNorthern 7 DK, DKP, DR, KB, WB, WD, KDPCentral 5 WW, CL, DN, CM, ZQSouth-western 4 BB, BG, SM, SMPSouthern 9 BR, KL, DS, HM, DO, MS, UR, DD, RR
Chloroplast lineragesLineage I 9 DK, DKP, KDP, WD, DR, WB, SM, SMP, BGLineage II 16 BB, BR, CL, CM, DD, DN, DO, DS, HM, KB,
KL, MS, RR, UR, WW, ZQ
Tree seed zones215.3 1 WD17 4 CM, DO, DD, DS19 2 DK, KDP20.1 2 KB, WB20.2 2 WW, DR20.3 1 ZQ20.4 1 CM21.1 1 MS21.2 1 DN23.2 1 SM23.3 2 BG, BB24.1 4 KL, BR, UR, HM24.2In , .•___ , „
1 RRPopulation codes follow table 1; “Ffr details on tree seed zone descriptions, see Aalbaek (1993)
Supplenentary Table 2 Pairwise matrix showing Nei’s genetic distance among 25 populations of H. abyssinica from Ethiopia assessed by AFLP
82
Supplementary Table 2 Pairwise matrix showing Nei’s genetic distance among 25 populations of H. abyssinica from Ethiopia, assessed by AFLP
BB 0.000BG 0.012 0.000BR 0.007 0.0010.000CL 0.002 0.017 0.006 0.000CM 0.016 0.000 0.003 0.020 0.000DD 0.014 0.015 0.001 0.009 0.013 0.000DK 0.027 0.015 0.016 0.034 0.009 0.027 0.000DKP 0.014 0.023 0.019 0.020 0.018 0.027 0.018 0.000DN 0.023 0.002 0.006 0.030 0.005 0.020 0.011 0.031 0.000DO 0.040 0.036 0.035 0.045 0.036 0.037 0.043 0.053 0.036 0.000DR 0.018 0.007 0.007 0.017 0.002 0.014 0.009 0.017 0.010 0.039 0.000DS 0.017 0.036 0.022 0.007 0.037 0.021 0.058 0.038 0.056 0.057 0.037 0.000HM 0.015 0.016 0.007 0.012 0.020 0.005 0.039 0.034 0.025 0.041 0.019 0.018 0.000KB 0.015 0.014 0.016 0.025 0.009 0.025 0.011 0.021 0.021 0.042 0.018 0.048 0.031 0.000KDP 0.011 0.027 0.014 0.004 0.022 0.012 0.037 0.021 0.043 0.043 0.020 0.007 0.008 0.027 0.000KL 0.011 0.0100.001 0.010 0.009 0.001 0.023 0.025 0.015 0.031 0.014 0.020 0.005 0.017 0.011 0.000MS 0.005 0.009 0.008 0.005 0.013 0.015 0.023 0.021 0.021 0.036 0.011 0.018 0.014 0.026 0.013 0.018 0.000RR 0.021 0.044 0.029 0.015 0.044 0.032 0.070 0.041 0.062 0.067 0.042 0.007 0.023 0.056 0.010 0.032 0.024 0.000SM 0.006 0.017 0.012 0.003 0.019 0.021 0.036 0.020 0.033 0.046 0.022 0.004 0.017 0.029 0.008 0.015 0.009 0.0) 1 0.000SMP 0.010 0.012 0.008 0.009 0.015 0.015 0.028 0.021 0.024 0.044 0.009 0.021 0.019 0.030 0.020 0.017 0.001 0.027 0.010 0.000UR 0.012 0.032 0.018 0.004 0.034 0.020 0.054 0.031 0.052 0.055 0.033 0.000 0.016 0.045 0.004 0.018 0.013 0.005 0.002 0.018 0.000WB 0.013 0.013 0.006 0.017 0.008 0.007 0.009 0.016 0.018 0.033 0.013 0.030 0.011 0.013 0.009 0.003 0.014 0.036 0.022 0.022 0.025 0.000WD 0.000 0.012 0.004 0.000 0.011 0.011 0.016 0.015 0.022 0.038 0.009 0.011 0.016 0.014 0.009 0.007 0.001 0.021 0.003 0.001 0.008 0.010 0.000W W 0.003 0.016 0.009 0.002 0.014 0.014 0.028 0.024 0.032 0.038 0.018 0.012 0.017 0.017 0.006 0.012 0.006 0.014 0.004 0.009 0.008 0.016 0.000 0.000ZQ 0.017 0.040 0.027 0.016 0.041 0.028 0.060 0.035 0.055 0.058 0.038 0.015 0.019 0.054 0.013 0.028 0.019 0.009 0.018 0.0260.008 0.029 0.016 0.019 0.000
BB BG BR CL CM DD DK DKP DN DO DR DS HM KB KDP KL MS RR SM SMP UR WB WD WW ZQ
00LO
Paper II: Genetic diversity at AFLPs
Supplementary Fig. 1. Correlograms showing kinship coefficient (F(d)) averaged over distance classes and plotted against the maximum distances of 8 distance classes from AFLPs of 21 natural populations of Hagenia abyssinica. Descriptions of plots: solid line with diamond marks = observed values, broken line with triangle marks = upper bound of 95% confidence interval, broken line with square marks = lower bound of 95% confidence interval. For population codes refer to Table 1.
00Lr,
Paper II: G
enetic diversity
at AFLPs
III. Conservation genetics of African redwood (Hagenia abyssinica (Bruce) J.F. Gmel): a remarkable but gravely endangered tropical tree species
Taye Bekele Ayele, Oliver Gailing, Reiner FinkeldeyForest Genetics and Forest Tree Breeding, Georg-August University o f Goettingen, Buesgenweg 2, 37077 Goettingen, Germany
Abstract
A major challenge for the conservation o f a given taxon in nature is a well-defined incorpora
tion o f genetic, demographic, and political criteria into decision-making processes. This paper
describes genetic and demographic factors that are instrumental in planning conservation, tree
improvement and domestication programs. A study is presented on a tropical tree species,
Hagenia abyssinica, which is prone to extinction using morphological, chloroplast microsatel
lite and AFLP markers. The analysis o f variance (ANOVA) revealed a significant differentia
tion among 22 natural populations o f Hagenia abyssinica in all quantitative morphological
traits at p<0.001. Multivariate and univariate taxonomic distances o f leaf traits between popu
lations are not correlated with the corresponding genetic distances (r= -0.03484, p = 0.3926),
showing that the genetic differentiation at anonymous and presumably neutral AFLPs is not
associated with the morphological differences among populations. The chloroplast microsatel
lite data allowed us to identify lineages and to reconstruct population history by analyzing
seed dispersal, while the AFLP data enabled us to identify populations o f high genetic diversi
ty. A weighted-score population prioritization matrix (WPPM) that combines genetic, mor
phological and demographic criteria was developed and used for the first time to prioritize
populations for conservation and domestication. Action is needed to launch conservation and
massive plantation programs o f the African redwood to ensure the long-term survival o f the
species and to boost its economic and ecological uses.
Key words: AFLP, chloroplast microsatellite, conservation genetics, genetic diversity, haplotypes, prioritization criteria, quantitative traits
‘Correspondence: Taye B. Ayele; e-mail: tavele@,ibc-et.org
Permanent address: Institute o f Biodiversity Conservation, Fax: 251-11-6613722
P.O.Box: 30726, Addis Ababa, Ethiopia;
86
Paper III: Converstion genetics
Introduction
Conservation o f forest ecosystems in general and o f critically endangered tree species in par
ticular is a challenging task in the face o f high pressure from local communities on forest land.
To develop appropriate conservation strategies that {inter alia) preserve maximum genetic
diversity, it is imperative to know the extent and distribution o f genetic variation within a spe
cies (Bawa & Krugman 1990; Loveless and Hamrick 1984). Investigation o f intraspecific ge
netic variation may help to assess extinction risks and evolutionary potential (fitness) in a
changing world (Bawa & Krugman 1990; Hedrick 2001) and is instrumental to identify ap
propriate units for conservation o f rare and threatened species (Newton et al. 1999). The pre
servation o f germplasm in genebanks and the establishment of in situ and ex situ conservation
stands requires sound knowledge o f the genetic structure o f a given species in order to capture
the optimum genetic and demographic variations. Whereas genetic variation estimates have
been used to formulate some general rules o f thumb about viable population size (Franklin
1980; Lande 1995; Lynch at al. 1995), demographic analyses o f individual species are more
often used to assess short-term population health and to suggest management alternatives
(Menges 1990; McCarthy et al. 1995). The ecological processes o f migration and colonization
are crucial to species survival and can have a profound impact on the spatial organization of
genetic structure within and among natural populations (Husband & Barrett 1996).
Higher genetic diversity enhances a population's survival probability over ecological or evolu
tionary time (Avise 2004). Small population sizes tend to reduce genetic variation, and might
therefore lead to a decreased ability o f such populations to adapt to ecological challenges
(DeSalle & Amato 2004; Amos & Balmford 2001). When populations are few in number and
small in size, the possibility o f species extinction through stochastic demographic fluctuations
can be o f paramount immediate concern (Gilpin and Soule 1986; Hanski and Gilpin 1997).
Reduced fitness may be a direct consequence o f reduction in the number o f heterozygous loci
(Amos & Balmford 2001). On the other hand, in some endangered species (such as the north
ern elephant seal), low genetic variation has not seriously inhibited population recovery from
dangerously low levels (Avise 2004). Genetic inventories can provide conservationists with
unprecedented precision and can add greatly to their understanding o f the genetic parameters,
on the basis o f which many decisions are made.
87
Paper III: Conversion genetics
A ssessm en t o f m orpho log ical traits is particu larly usefu l to enhance tree im provem ent and
domestication programs by identifying appropriate characters and superior traits. It also as
sists in conservation decisions through the identification of population structures based on di
ameter/age classes o f trees. This paper describes morphological and molecular genetic varia
tions in the African redwood (Hagenia abyssinica) and proposes various conservation and
domestication measures. Hagenia abyssinica is a monotypic tree species o f the Rosaceae fam
ily that is native to Africa (Hedeberg 1989; Legesse 1995). It is an anemogamous and anemo-
chorous broad-leaved dioecious tree species with distinctly coloured male and female flowers.
Fossil pollen records suggested that Hagenia immigrated into Ethiopia from the south during
the late Pleistocene (since 16,700 years Before Present (BP)) and became abundant in the
southern regions o f Ethiopia about 2500 years BP (Beuning et al. 1997; Bonnefille et al. 1995;
Olago et al. 1999; Umer et al. 2007). The tree provided enormous timber and non-timber
products and various ecological values. Hagenia has been logged heavily and selectively due
to its superior timber and it is one o f the endangered tree species in Ethiopia (Legesse 1995).
According to the present inventory, about 7000 individuals are left in Ethiopia and only two
populations out o f 22 natural populations recruited young trees. Furthermore, planting efforts
were very limited and were not successful in most o f the cases. This is a seriously alarming
situation for the genetic resources o f the species, eventually leading to extinction. We present
information on the amount and distribution of diversity at morphological and molecular ge
netic markers with the objective to (1) identify conservation units for in situ conservation, (2)
identify populations for collection o f germplasm for ex situ conservation. (3) enhance domes
tication and tree improvement programs.
Materials and Methods
Sampling
Twenty two natural populations were sampled from diverse ecologies including closed forests
(12 populations), open forests/woodlands (6 populations), wooded grasslands (2 populations),
and farmlands/ homesteads (2 populations), representing most o f the extant distribution o f the
species in Ethiopia. In addition, three plantations were also sampled. The distribution o f the
sampled populations in the country is illustrated in Fig. 1. Table 1 presents the characteristics
o f the populations investigated in this study. The distance between populations ranges from 21
to 806 km within an altitudinal range of 2200 masl at Bonga to 3200 masl at Wofwasha.
Temperatures range from an absolute minimum o f -1°C at Dinsho to a maximum of 33.5 °C at
Kosso Ber. Higher rainfall and lower temperatures are expected than those shown in the table
Paper III: Converstion genetics
as the nearest meteorological stations are situated at altitudes lower than the actual popula
tions in most o f the cases.
Morphological and ecological assessment
The following dimensional, counted and visually observed variables were assessed from 1109
individuals (26-50 trees per population, see Table 1): total height, bole height, diameter at
breast height (DBH), length o f petiole, width o f serrated tooth o f leaf, number o f leaflets,
number o f stipules, number o f pairs o f leaflets having stipules at the back of their bases, num
ber o f stipules between two pairs o f leaflets, arrangement of leaflets, bole form/timber quality,
shape o f tree and sex. Twigs were harvested at random from each tree and the largest leaf was
chosen for leaf measurements. In addition, distance between trees, compass bearing to next
tree, total number o f individuals, longitude and altitude were assessed at the population level.
Distances between populations were computed from the GPS data.
Molecular inventories
Chloroplast microsatellite
Three polymorphic consensus chloroplast microsatellite primers (CCMP2, CCMP6 &
CCMP10) were used to screen 273 samples (9-12 individuals from each population) from
twenty two natural and three planted populations o f Hagenia. Details o f the methods are de
scribed in Taye et al. submitted (a).
AFLP
A total o f 596 individuals (23-24 trees/population) from twenty two natural and three planted
populations o f Hagenia were analysed by using the selective primer combination E41-M67
(nomenclature according to Keygene N.V. ®). Details of the methods are described in Taye
et al. submitted (b).
Data analysis
The program SPSS 16.0 (SPSS Inc®) was used to perform analyses o f variance (ANOVA) o f
morphological traits and to compute taxonomic distances (as described by Sneath & Sokal
1973) from morphological data by using the Euclidean distance option. The program NTSYS-
pc 2.0 (Rohlf 1998) was used to draw dendrograms and to perform Mantel tests (Mantel
1967). Mantel tests were performed between univariate or multivariate taxonomic distances of
Paper III: Converstion genetics
morphological traits and N ei’s genetic distances among populations. Similarly, the association
between average taxonomic distances o f morphological traits between populations and
Euclidean distances o f climatic variables between populations was tested. Molecular genetic
data analysis softwares PermutcpSSR (available at
http://www.pierroton.inra.fr/genetics/labo/Software/PennutCpSSR/index.html. accessed on 3
February 2008) and ARLEQUIN Version 3.0 (Excoffier et al. 2005; available at
http://cmpg.unibe.ch/software/arlequin3. accessed on 10 February 2008) were used to analyze
the cpSSR data, while ARLEQUIN Version 3.0, AFLP-SURV (Vekemans et al. 2002, avail
able at http://www.ulb.ac.be/sciences/lagev/. accessed on 2 March 2008) and NTSYS-pc 2.0
(Rohlf 1998) were used to analyze the AFLP data. A weighted-score population prioritization
matrix (WPPM) that combines genetic, morphological and demographic criteria was devel
oped and used for the first time to prioritize populations for conservation and domestication.
Fig. 1 The distribution o f populations o f Hagenia abyssinica showing the two chloroplast lineages observed in Ethiopia (Taye et al. submitted (a)). Square-dotted enclosure shows lineage I; long-dashed enclosure shows lineage II. Small filled-circles indicate the locations o f the populations; population codes are provided in Table 1. Base map: A ssefa Guchi (unpublished).
oi£bK P
90
Paper III: Converstion genetics
Table 1 Description o f Hagenia populations sampled from the mountains o f Ethiopia showing
some measures o f genetic diversity
Populations Code Lat. Long. M asl ARF Min T Max T n N H He
Debark-Mariam DK 1 3 ° ir 37°57' 3013 1270 8.8 19.7 26 26 4 0.217
Debark-
Plantation
DKP 13°12' 38o01' 3005 1270 8.8 19.7 50 - 4 0.226
Kimir-Dingay
plantation
KDP 11°48' 38°14' - 1350 9.2 21.9 30 1,6 0.183
Woldiya Se’at
Michael
WD 11°55' 39°24’ 3112 908 na na 50 120 6 0.194
Kosso Ber KB 10°59' 36°54' 2702 2381 12.9 27.4 50 60 1 0.206
Denkoro DR 10°52' 38°47’ 3061 896 10.9 21.8 50 60 6 0.189
Wonbera WB 10°34' 35°41' 2428 1622 na na 50 60 5 0.211
Wof washa ww 09°45’ 39°44' 3159 941 6.1 19.9 30 45 1 0.189
Chilimo CM 09°05’ 38°10' 2805 1114 11.5 25.8 50 65 1,4 0.192
Dindin DN 08°36' 40°14' 2410 989 12.7 28,0 30 55 1 0.212
Zequala Abo ZQ 08°32' 38°50' 2856 1215 na na 33 60 1 0.205
Boterbecho BB 08°24' 37°15' 2772 1666 5.7 23.6 50 60 1 0.213
Chilalo CL 07°56' 39°11’ 2815 796 9.8 23,0 50 70 1 0.177
Sigmo plantation SMP 07°55' 36°10' 2300 1837 11.4 21.6 30 - 4 0.146
Sigmo SM 07°46' 36°05' 2651 1837 11.4 21.6 30 60 4 0.170
Munesa MS 07°25' 38°53' 2459 1028 10.1 24.3 50 80 1 0 .200
Bonga BG 07°17' 36°22' 2238 2217 11.9 26.6 50 80 4 0.198
Kofele KL 07°11' 38°52’ 2757 1305 7.7 20.1 50 110 1,2,3 0.195
Dinsho DO 07°05' 39047- 3117 1213 3.4 20.8 50 260 2 0.362
Doddola-Serofta DS 06°52' 39°02’ 2700 1074 6.7 24.3 50 75 2 0.139
Doddola-
Dachosa
DD 06°52' 39°14' 3039 1074 6.7 24.3 50 5000 2 0.173
Rira RR 06°45' 39043- 2725 736 11a na 50 170 2 0.169
Bore BR 06°17' 38°39' 2631 1526 8.3 18.8 50 100 1,2,3 0.187
Uraga UR 06°08' 38°33' 2508 1228 8.3 18.8 50 70 2,3 0.160
HagereMariam
Total/mean
HM 05°51' 38°17' 2443 1228 12.3 23,0 50
1109
55
6741
2 0.168
0.195
M asl= m eters above sea level; ARF = M ean annual rainfall in milliliters; M in T = M ean minim um temperature (C°); Max T = M ean maximum temperature; n= no. o f samples assessed for morphological characters; N= Population size (estimation o f total no. o f individuals), H = chloroplast haplotypes (Taye et al. submitted (a)); He = gene diversity (Taye et al. submitted (b)). Population codes w ill be used throughout the paper.
91
Paper III: Conversion genetics
Results and discussions
Morphological diversity
The morphological traits observed in Hagenia abyssinica were highly variable among popula
tions. Supplementary Table 1 summarizes the mean values o f morphological traits observed
within populations. The DBH-based population structure (Supplementary Fig. 1) indicated
that m ost o f the populations (59% ) fall under a J-shaped distribution pattern, indicating no/bad
reproduction and no/poor recruitment. Populations Munesa (MS) and Wonbera (WB) show
nearly complete coverage o f diameter classes that was close to normal distribution. Population
Chilimo (CM) also shows a nearly complete representation o f diameter classes but deviated
from a normal distribution. Population Zequala (ZQ) demonstrated an example o f a U-shaped
distribution that is an indication o f a selective removal o f middle diameter class trees. In gen
eral, Hagenia exhibited unsatisfactory population structure as several diameter classes were
missing from the majority o f the populations. Natural regeneration was observed in only two
populations - Bonga (BG) (112 wildings) and Boterbecho (BB) (5 saplings). A one-way
analysis o f variance (ANOVA) revealed a significant differentiation among the 22 natural
populations o f Hagenia abyssinica in all morphological traits at p<0.001 (Table 2). Large
proportion o f variation (>65%) is allocated within populations for all traits. The highest per
centage of variation among populations was observed for DBH (34.1%) while the lowest was
observed for the number o f leaflets (9% ).
The cluster analysis based on the average taxonomic distances matrix o f all leaf traits grouped
the populations into two main clusters and separated four outlier populations (Fig. 2). In gen
eral, no clear association between geographic regions and taxonomic distances could be ob
served. Both main clusters are composed o f populations from the main distribution areas of
the species. The average multivariate taxonomic distances o f all morphological traits in our
dataset did not show any correlation with the average Euclidean distances o f climatic vari
ables (r = 0.17062, p = 0.9281), suggesting that the observed morphological traits are not in
volved in the adaptation to different climatic conditions. Similarly, separate tests o f associa
tion o f taxonomic distances o f individual morphological traits with the Euclidean distances of
climatic variables did not show any correlation (not shown). The pronounced divergence o f
quantitative morphological traits is likely to be due to different age structures, stand histories
and edaphic factors, which were, however, not assessed. It may also reflect different physio
logical responses to changes in the environment.
92
Paper III: Conversion genetics
Table 2 Analysis o f variance (ANOVA) of morphological traits among 22 natural populations
o f Hagenia abyssinica.
Source o f variation SS df MS F % variation
Is
Tree height between populations 6601.2 21 314.3 17.5 28.5Within populations 16536.5 919 18.0 71.5Bole height between populations 1617.2 21 77.0 11.2 20.3Within populations 6342.8 919 6.9 79.7DBH between populations 414377.9 21 19732.3 22.7 34.1Within populations 799144.1 919 869.6 65.9Petiole length between populations 1175.1 21 56.0 10.7 19.7Within populations 4780.6 918 5.2 80.3No. leaflets between populations 198.2 21 9.4 4.3 9.0Within populations 2011.5 918 2.2 91.0No. o f stipules between populations 10351.1 21 492.9 16.2 27.0Within populations 27977.3 918 30.5 73.0No. o f back stipules between pops 133.9 21 6.4 10.2 24.2Within populations 420.3 673 0.6 75.8Tooth width between populations 49.6 21 2.4 7.5 16.7Within populations 247.6 786 0.3 83.3d f = degrees of freedom, SS = sum o f squares, MS= mean sum o f squares, F = computed F value, Is = level o f significance, **** = highly significant at pO.OOOl.
Molecular genetic diversity
Chloroplast microsatellites
Six haplotypes that were phylogenetically grouped into two lineages were identified from the
combination o f 8 variants from the three loci (Table 1, Fig. 1). The observed haplotypes
showed a strong geographic pattern as a result o f highly restricted gene flow via seeds and a
rare occurrence o f long-distance seed dispersal. The two lineages were separated by an indel
(insertion/deletion) o f 10 nucleotides in locus CCMP2. The first lineage contains haplotypes
H4, H5 & H6, which are distributed in the south-western and northern regions, while the sec
ond lineage contains haplotypes H 1, H2 & H3 in central and southern regions. A remarkable
subdivision o f cpDNA diversity in the species was found, as indicated by a high level o f ge
netic differentiation ( G st = 0. 899, N st = 0. 926). Also, the non-hierarchical analysis o f mole
cular variance (AMOVA) showed that 92.3% of the total genetic diversity is represented
among populations (Taye et al. submitted (a))
93
Paper III: C onversion genetics
}
Ed -
BB(C)DK(A)
WB(A)DR(A)CL(B)KB(A)BR(D)DD(D)MS(D)BG(C)- K L(D )- DN(B) -
WW(B) - DO(D) - WD(A)- UR(D) ■D S(D )- H M (D)- ZQ (B)- SM (C)- CM(B)-
R R (D )--- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 'i--------------------------- 1-1-------------- 1-------------- 1-------------- 1-1-------------- 1-------------- 1-------------- 1-------------- 1-i-------------- 1-------------- 1-------------- 1-------------- 1-1-------------- 1-------------- 1-------------- 1-------------- 1
065 249 433 8.18 8MEuclidean distance (leaf characters)
Fig. 2 UPGMA cluster diagram drawn based on average taxonomic distances computed from five leaf characters o f 22 natural populations o f Hagenia abyssinica from Ethiopia. Population codes follow Table 1. Letters in parenthesis indicate geographic regions: A= northern region, B= central region, C= southwestern region, D= southern region.
AFLP
Moderate to high gene diversities were observed at AFLP loci ranging from 0.139 at Dodola-
Serofta (DS) to 0.362 at Dinsho (DO) (Table 1). Interestingly, the lowest gene diversities
were recorded for the two farmland populations (DS & UR) while the maximum gene diver
sity was recorded for a well-protected Park Forest (DO), pointing to negative human impact
on genetic diversity. The second largest population (DO) demonstrate remarkably high gene
diversity (36.2%), reflecting strong divergence from the rest o f the populations. The mean
gene diversity in subdivided populations o f Hagenia abyssinica showed high within-
population variation (0.195) and moderate but significant population differentiation (F St =
0.077) (Taye et al. submitted (b)). The largest remaining population (DD) does not show the
highest genetic diversity whereas much smaller populations show higher diversity (Table 1).
Ten out o f 21 natural populations (KB, CM, BB, DO, DS, HM, KL, DK, CL and RR) showed
significant spatial genetic structure (SGS) (Taye et al. submitted (b)).
The non-hierarchical analysis o f molecular variance (AMOVA) performed for all populations
at AFLP markers revealed that 10.4% of the total variation is represented among populations.
Paper III: Conversion genetics
The phylogenetic tree drawn from N ei’s (1978) genetic distances using the Unweighted Pair
Group Method with Arithmetic mean (UPGMA) clustering method congregated the 22 natural
populations into two major clusters (Fig. 3). The dendrogram reflects a weak spatial distribu
tion pattern o f the populations. Likewise, a test o f association (Mantel test) between the mul
tivariate taxonomic distances o f combined leaf traits and genetic distances did not show any
correlation (r = -0.03484, p = 0.3926). Similarly, separate tests for association o f the taxo
nomic distances o f individual morphological traits (including growth traits) with the genetic
distances did not show any correlation (not shown). This result suggests that the genetic dif
ferentiation at anonymous AFLP markers is not associated with the morphological differences
among populations.
Despite the recent immigration into Ethiopia and small population sizes, Hagenia exhibited
moderate to high gene diversity within populations. Since even little effective pollen per gen
eration is sufficient to counteract loss o f genetic diversity (Wright 1931, Finkeldey & Hatte-
mer 2007), the effect o f recent colonization and o f the small population sizes is not reflected
in the levels o f gene diversity. Likewise, studies on many rare and endangered animal species
such as the spring-dwelling fish (Gambusia nobilis), przewalski’s horse (Equus przewalskii),
manatee ( Trichechus manatus) and Stephens's kangaroo rat (Dipodomys stephensi) revealed
more or less average levels o f genetic variation due to effective mating (reviewed by Avise
2004).
Conservation priorities
We have estimated the total number o f the extant individual Hagenia trees throughout the
country as not exceeding 7,000 (including the estimation o f scattered trees that were not in
cluded in the present study), the majority o f which are old and dying without recruiting young
generations. The three plantations included in the present study are small in size amounting to
about 450 individuals in total. There are no records on the existence o f large plantations of
Hagenia in Ethiopia. Given the present open-access to most o f the populations and lack of
natural regeneration, Hagenia will unquestionably face extinction in the following decades.
Bonga is the only viable population that recruited new generation in southwest o f Ethiopia,
but with only 80 mature individuals left at the time of this survey. The largest remaining pop
ulation (DD) does not have natural regeneration. The fossil pollen stratigraphy from African
countries other than Ethiopia also showed that the fossil pollen accumulation o f Hagenia
95
Paper III: Conversion genetics
abyssinica has declined alarmingly through time (Beuning et al. 1997; Bonnefdle et al. 1995;
Olago et al. 1999), suggesting a dramatic reduction in the size o f the populations and probable
local extinction in some locations (Taye et al. submitted (a)). Surprisingly, despite the evident
severe threat on its survival, Hagenia is not included in the red list o f the International Union
for Conservation o f Nature (IUCN) whereas Juniperus procera, which is in a comparatively
better conservation status than Hagenia in terms o f geographic range, population size and re
cruitment o f young trees (field observation during the preset survey), was red-listed
(http://www.iucnredlist.org/, accessed on 26 May 2008).
Fig. 3 Phylogenetic tree drawn based on Nei’s (1978) genetic distances computed by UPGMA clustering from AFLPs o f 22 natural populations o f Hagenia abyssinica from Ethiopia. Population codes follow Table 1. Letters in parenthesis designate geographic regions: A= northern region, B= central region, C= southwestern region, D= southern region.
A number o f organizations foster the conservation o f biodiversity in general and that o f
threatened species in particular at the global level. The major objectives o f the Convention on
Biological Diversity (CBD) are the conservation o f biological diversity, the sustainable use o f
its components, and the fair and equitable sharing o f the benefits arising out o f the utilization
of genetic resources (http://www.cbd.int/convention/. accessed on 2 June 2008). The IUCN's
Red List Criteria are based on available evidence concerning the numbers, trend and distribu
tion o f a given species based on changes over periods o f time (IUCN, 2001). Such compre
hensive time-bound information is lacking in Ethiopia. The Convention on International Trade
in Endangered Species (CITES) regulate the complex wildlife trade by controlling species-
96
Paper III: Conversion genetics
specific trade levels on the basis o f biological criteria (http://www.cites.org/. accessed on 3
June 2008). CITES classified species as prohibited (Appendix I), restricted (Appendix II) and
optional (Appendix III) for trade, but Hagenia is not included in any o f them. There is a lose
end, though, in the convention o f CITES, which provides exceptional cases that allow utiliza
tion of endangered species categorized even under Appendix I. The Endangered Species Act
o f the United States o f America defined a species as endangered if it is at risk o f extinction
throughout all or a significant portion o f its range, and to be threatened if it is likely to be
come endangered in the foreseeable future (http://www.nmfs.noaa.gov/pr/pdfs/laws/esa.pdf.
accessed on 2 June 2008).
Given the scanty financial resources the country has and the complex nature o f conservation,
it is indispensable to prioritize populations o f Hagenia for conservation. The need to integrate
demographic and genetic criteria in plant conservation has been recognised during the last two
decades (e.g., Lande 1988; Ostermeijer et al. 2003; DeSalle and Amato 2004; Delgado et al.
2008; Hoebee et al. 2008). Delgado et al. (2008) standardized phylogenetic, demographic and
genetic values to obtain conservation indices for populations o f Mexican rare pines. We pro
pose a “weighted-score population prioritization matrix” (WPPM), a method that integrates
genetic, morphological and demographic criteria to prioritize populations o f a single species
for conservation and domestication purposes. Our method is similar in approach but different
in criteria and scoring from that o f Delgado and co-workers (2008) in several ways. Our me
thod 1) uses actual values instead of standardized values as our target is a single species, 2)
uses morphological and additional demographic criteria, 3) prioritizes populations for differ
ent conservation measures and domestication, 4) accords different weights to demographic
and genetic criteria for each o f the measures, 5) uses only one distance measure, i,e., average
genetic distance (computed from N ei’s genetic distances) as suggested by O ’Meally and Col-
gan (2005) instead of branch-node lengths o f a phylogenetic tree, 6) uses information on chlo
roplast lineages as a complementary criterion. The values from all criteria will be summed up
and the population with the highest value will be accorded the top priority and so forth. It is a
simple and straight-forward tool that can easily be understood and applied by forestry experts
and decision makers to prioritize populations o f a given taxon for in situ conservation, ex situ
conservation, and tree improvement and domestication programs. The genetic criteria em
ployed are the amount o f genetic diversity (He) and average genetic distance (AGD) from the
AFLP data (Taye et al. submitted (b)) while the demographic criteria included status o f natu
ral regeneration, DBH-based population structure, present conservation status, total popula
97
Paper III: Converstion genetics
tion size, and timber quality measured as mean bole height. More details are provided in Sup
plementary Table 2. The weight attributed to genetic, morphological and demographic criteria
differs according to the aim o f the prioritization (Supplementary Table 2). Presence o f natural
regeneration and other demographic factors are comparatively more important to conservation
in situ than the genetic criteria whereas the reverse applies for conservation ex situ. Similarily,
morphological criteria (particularly timber quality) deserve more weight than the genetic crite
ria to select superior trees for domestication and tree improvement programs. Accordingly, the
weights o f genetic criteria for in situ conservation, ex situ conservation, and for tree improve
ment and domestication programs are set in the order o f 40%, 80% and 40%, respectively.
The remaining proportions in each program are accorded to the demographic/morphological
criteria. The information from the chloroplast microsatellite data (Taye et al. submitted (a)) is
considered after the outcome o f the prioritization in order to represent populations in different
chloroplast haplotypes/lineages.
Outcome o f prioritization
The supplementary Table 3 (a-c) summarizes the results o f the prioritization of the extant
populations o f Hagenia for in situ conservation, ex situ conservation, and for tree improve
ment and domestication purposes. The top two priority populations selected for in situ conser
vation are Bonga (with the largest natural regeneration and high genetic diversity) and Dinsho
followed by Boterbecho at the third position. Populations Kosso Ber and Zequala equally fol
lowed in the fourth position. Since only Bonga represented chloroplast lineage I in the top
priority list, population Wonbera from the same lineage, which stood sixth in the rank, should
be given at least the fourth priority for in situ conservation. The top candidate population for
ex situ conservation is Dinsho (with the highest genetic diversity but no natural regeneration)
followed by Kosso Ber, Dindin and Zequala equally at the second position, and Debark at the
third position. Wonbera and Boterbecho shared the fourth rank. This top priority list is domi
nated by populations from chloroplast lineage II. Therefore, population Wonbera from lineage
I should also be considered for ex situ conservation. The top three candidate populations se
lected for tree improvement and domestication programs are Kosso Ber, Dinsho and Bore fol
lowed by Wonbera, Dindin, Zequala and Boter Becho. This priority list should be maintained
because timber quality matters most (at least at present) than the other criteria for tree im
provement and domestication programs. Regardless o f the differences in the types and/or
weights o f the criteria, the populations Kosso Ber, Zequala, Dinsho and Boterbecho appeared
in the top four ranks o f all the three objectives while populations Wonbera and Dindin are se
98
Paper III: Converstion genetics
lected for both ex situ conservation, and tree improvement and domestication programs. Spe
cial consideration should be given to populations that are chosen for multiple objectives. A
multiple population breeding strategy that combines breeding goals and conservation (Nam-
koong 1984) is particularly useful in this regard. Some purposefully weighted criteria played
influential roles to select populations for different objectives. For example, the presence of
natural regeneration influenced the selection o f populations for in situ conservation (Bonga
and Boterbecho) while the amount o f gene diversity was crucial to choose populations for ex
situ conservation (Dinsho). Similarly, the criterion bole height was vital to choose populations
for tree improvement and domestication. The largest remaining population (DD) does not ap
pear in the top priority lists for in situ and ex situ conservation because it does not have natu
ral regeneration and has lower genetic diversity than others. Also, it is located in a protected
area. But it appeared in the 6th priority for tree improvement and domestication because it har
bors good quality timber. The production and recruitment o f young trees is often overlooked
as a key criterion; but it is essential for the success o f gene conservation in situ.
Conclusions and recommendations
Distinctive quantitative traits were observed in Hagenia. The chloroplast microsatellite data
allowed us to identify lineages and to reconstruct population history by analyzing seed disper
sal while the AFLP data allowed us to identify populations o f higher genetic diversity. The
morphological data enabled us to identify populations o f desirable quantitative traits that can
be used in conservation and domestication o f the species. The sizes o f the extant populations
were reduced to very small patches due to human impact, probably affecting the genetic struc
ture and increasing the risk o f extinction. The absence o f natural regeneration in most o f the
populations, the small sizes o f all but one (Doddola-Dachosa) populations and the current
high demand and pressure from the people for Hagenia lumber are main reasons to regard the
species as prone to extinction at least in Ethiopia in the following decades. Action is needed to
launch conservation and massive plantation programs o f this remarkably valuable but gravely
endangered tree species. The work presented here might serve as a starting point to select ge
netic resources and superior individuals o f Hagenia. The priority rank should be considered
taking into account the availability o f resources for conservation, tree improvement and do
mestication programs. The populations that lack natural regeneration but selected for conser
vation in situ should be enriched by planting seedlings raised from the same stand. Conserva
Paper III: Conversion genetics
tion decisions depend on a number o f factors that go beyond scientific information. A major
challenge for the conservation o f the genetic resources o f Hagenia abyssinica will be the well-
defined incorporation o f social, cultural and political criteria into the decision-making
processes. Seed collection for ex situ conservation and tree improvement programs should
consider the information on spatial distribution o f genetic structure (SGS) described in Taye
et al. (submitted (b)) to minimize collection o f seeds from related individuals. In conclusion,
the present work allowed us to establish priorities for the conservation and domestication o f
the African redwood based on genetic, morphological and demographic information. This in
formation can serve as a benchmark for monitoring its conservation status in the future. In
vestigation into the possible impediments to natural regeneration including, inter alia, the eco
logical (moisture, soil, animal browsing) and physiological characteristics (seed quality cha
racters and viability) o f the relict populations o f Hagenia abyssinica is crucial to ensure the
long-term survival o f the species. Common garden experiments and the establishment of
comprehensive provenance trials may help to reexamine the association between morphologi
cal and molecular genetic traits by separating the genetic differences from non-genetic envi
ronmental effects at important adaptive and economic traits. Similar work is recommended in
other African countries where Hagenia is known to grow. International organizations such as
IUCN and CITES should consider Hagenia in their appropriate databases/programs as it is at
high risk o f extinction.
Acknowledgements
This project is a component o f the “Support to the Forest Genetic Resources Conservation
Project” o f the Ethiopian Institute o f Biodiversity Conservation (IBC) supported by the Ger
man Federal Ministry o f Economic Cooperation and Development (BMZ) through the Ger
man Technical Cooperation (gtz). The German Academic Exchange Service (DAAD) ex
ecuted the grant as a PhD project o f the first author. The National Meteorological Service
Agency o f Ethiopia provided climatic data. We thank Oleksandra Dolynska, Thomas Seliger
and Olga Artes for kindly assisting in the laboratory and Daniel Bekele for helping during the
fieldwork.
100
Paper III: Conversion genetics
References
Aalbsek A (1993) Tree seed zones for Ethiopia. National Tree Seed Project, Addis Ababa Amos M, Balmford A (2001) When does conservation genetics matter? Heredity 87: 257-265 Avise JC (2004) Molecular Markers, Natural History and Evolution, 2nd edn. Sinauer Associ
ates Inc, Sunderland, MA Bawa KS, Krugman SL (1990) Reproductive biology and genetics o f tropical trees in relation
to conservation and management. In: Rain Forest Regeneration and Management (eds Gomez-Pampa A, Whitmore TC, Hadley M), The Parthenon Publishing Group, pp. 119- 136
Beuning KRM, Talbot MR, Kelts K (1997) A revised 30000-year paleoclimatic and paleohy- drologic history o f Lake Albert, East Africa. Palaeogeogr Palaeocl 136: 259-279
Bonnefille R, Riollet G, Buchet G, Icole M, Lafont R, Arnold M, Jolly D (1995) Glacial/interglacial record from intertropical Africa, high resolution pollen and carbo data at Rusaka, Burundi. Quaternary Sci Rev 14: 917-936
Delgado P, Eguiarte LE, Molina-Freaner F, Alvarez-Buylla ER, Pinero D (2008) Using phylogenetic, genetic and demographic evidence for setting conservation priorities for Mexican rare pines. Biodivers Conserv 17: 121-137
DeSalle R, Amato G (2004) The expansion o f conservation genetics. Nat Rev Genet 5: 702- 712
Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1: 47- 50
Finkeldey, R., and Hattemer, H.H. 2007. Tropical Forest Genetics. Springer-Verlag, Berlin. Franklin IR (1980) Evolutionary change in small populations. In Soule MA & Wilcox BA
(eds) Conservation biology: an evolutionary-ecological perspective. Sinauer Associates, Sunderland, MA, pp 135-149
Hedeberg O (1989) Rosaceae. In: Inga Hedeberg and Sue Edwards, eds. Flora o f Ethiopia, Vol. 3, Pittosporaceae to Arralaceae. Addis Abeba and Asmara, Ethiopia; Uppsala, Sweden
Hedrick PW (2001) Conservation genetics: where are we now? Trends Ecol Evol 16: 629-636 Hoebee SE, Thrall PH, Young AG (2008) Integrating population demography, genetics and
self-incompatibility in a viability assessment o f the Wee Jasper Grevillea (Grevillea iaspi- cula McGill., Proteaceae). Conserv Genet 9: 515-529
Husband BC, Barrett SCH (1996) A metapopulation perspective in plant population biology. J Ecol 84: 461-469
IUCN (2001) IUCN Red List Categories and Criteria: Version 3.1. IUCN Species Survival Commission, Gland, Switzerland and Cambridge, UK
Gilpin MA, Soule ME (1986) Minimum viable populations: Processes o f species extinction. In Soule ME (ed) Conservation biology: The Science of scarcity and diversity. Sinauer Associates Inc, Sunderland, MA
Hanski IA, Gilpin MA (eds) (1997) Metapopulation biology: Ecology, genetics and evolution.Academic press, New York
Lande R (1988) Genetics and demography in biological conservation. Science 241: 1455- 1460
Lande R (1995) Mutation and conservation. Conservation biology 9: 782-791Legesse N (1995) Indigenous trees of Ethiopia: Biology, uses and propagation techniques.
SLU, Reprocentralen, Umea Loveless MD and Hamrick JL (1984) Ecological determinants o f genetic structure in plant
populations. Ann Rev Ecol Syst 15: 65-95
101
Paper III: Converstion genetics
Lynch M (1996) A quantitative genetic perspective on conservation issues. In: Avise JC, Hamrick JL (eds) Conservation genetics: case histories from nature. Chapman & Hall, USA, pp 471-501
Lynch M, Convey J and Burger R (1995) Mutation accumulation and the extinction o f small populations. Am Nat 146: 489-518
Mantel NA (1967) The detection o f disease clustering and a generalized regression approach.Cancer Res 27: 209-220
Menges ES (1990) Population viability analysis for an endangered plant. Conser Biol 4: 52-64 McCarthy MA, Burgman MA and Ferson S (1995) Sensitivity analysis o f models population
viability. Biol Conserv 73: 93-100 Namkoong G (1984) A control concept o f gene conservation. Silvae Genet 33: 160-163 Nei M (1978) Estimation o f average heterozygosity and genetic distance from a small number
o f individuals. Genetics 89: 583-590 Newton AC, Allnutt TR, Gillies ACM, Lowe AJ and Ennos RA (1999) Molecular phy
logeography, intraspecific variation and the conservation o f tree species. Trends Ecol Evol 14: 140-145
Olago DO, Street-Perrott FA, Perrott RA, Ivanovich M, Harkness DD (1999) Late quaternary glacial-interglacial cycle o f climatic and environmental change on Mount Kenya. J Afr Earth Sci 29: 593-618
O ’Meally D, Colgan DJ (2005) Genetic ranking for biological conservation using information from multiple species. Biol Conser 122: 395-407
Oostermeijer JGB, Luijten SH, den Nijs JCM (2003) Integrating demographic and genetic approaches in plant conservation. . Biol Conser 113: 389-398
Rohlf FJ (1998). NTSYS-pc: Numerical taxonomy and multivariate analysis system (Version 2.0). State University o f New York, USA
Sneath PHA and Sokal RR (1973) Numerical taxonomy: the principles and practice o f numerical classification. WH Freeman and Company, San Fransisco
Umer M, Lamb HF, Bonnefille R, Lezine A-M, Tiercelin J-J, Gibert E, Gazet J-P, Watrin J (2007) Late Pleistocene and Holocene vegetation history o f the Bale Mountains, Ethiopia. Quaternary Sci Rev 26: 2229-2246
Vekemans X, Beauwens T, Lemaire M and Roldan-Ruiz I (2002) Data from amplified fragment length polymorphism (AFLP) markers show indication o f size homoplasy and a relationship between degree o f homoplasy and fragment size. Mol Ecol 11: 139-151
Wright S (1931) Evolution in Mendelian populations. Genetics 16: 97-159.
102
Supplementary Table 1. Mean values (with standard deviations) for morphological traits observed within the populations o f Hagenia in Ethiopia.
Populations D (m ) SI TH (m) B H (m ) DBH (cm) LP (cm) NL NS NLBS WT (mm)Debark M ariam 31.0 1 9.6±2.6 2.1±1.4 67.9±31.7 12.4±2.2 14.2±1.2 16.6±4.5 1.4±0.7 1.9±0.6Debark Plantati naon na na Na na 7.5±1.6 13.0±1.6 22.5±5.7 1.2 ±0.8 2 .2±0.6Kimir Dengay naPlantation na na Na na 10.8±2.4 12 .8± 1.8 15.7±5.7 0 .6 ±0.8 2 .2±0 .6Woldiya Se’at naMichael na 13.5±2.1 3.5±0.7 114.5±14.8 14.0±2.1 13.8±1.4 18.7±4.6 1.7±0.6 1.8±0.7Kosso Bcr 9.3 na 1 1.0±2.9 6.4±2.3 24.2±9.7 14.7±3.2 14.8±1.7 17.4±5.2 1.1 ±0.9 2.3±0.6Denkoro 21.1 0.7 12.9±2.5 4.1±2.2 82.3±31.3 12.7±2.4 13.9±1.7 16.8±4.9 0.6±0.7 2.0±0.7W onbera 13.2 na 12.3±2.8 4.7±2.4 34.6±15.7 12.3±1.8 14.8±0.9 17.1±4.8 1,4±0.6 1.9±0.5W ofwasha 27.3 na 7.8±2.7 2.7±1.7 54.5±36.2 14.4±2.4 14.5±1.4 21.7±5.5 1.6 ±0.6 2.7±0.7Chilmo 28.0 na 17.0±9.2 5.2±4.0 43.1±25.5 1 1.8±2.5 13.6±2.1 9.6±2.2 1.3±0.9 2.4±1.1Didndin 29.3 na 15.4±5.8 5.9±2.6 64.7±47.2 14.2±2.9 14.9±2.3 20.5±7.3 1.3±0.9 2.2±0.5Zequala Abo 18.7 0.3 13.1±6.4 4.5±3.2 52.7±57.4 9.0±2.3 11.0± 1.8 18.0±6.1 1.0±0.9 2 .0± 0.6Boter-Becho 15.0 1.2 12 .6 ±6.2 5.8±2.8 32.5±25.3 11.9±2.3 14.0±1.4 16.9±6.2 1.2± 0.8 1.9±0.5Chilalo 31.1 1.8 10.4±2.7 3.5±1 .6 54.5±30.0 13.5±2.2 14.9±1.1 17.7±5.8 1,8±0.5 1.8±0.6Sigmo Plantation na na na na na 12 .1± 1.8 14.8±1.6 22.3±5.6 1.3±-0.9 2 .2± 0.6Sigmo 22.7 1 17.0±5.3 5.5±2.8 80.2±33.7 13.3±2.6 13.7±1.8 24.8±7.3 1.5±0.9 2.5±0.8M unesa 18.3 na 11.5±2.9 4.7±2.8 40.5±19.5 14.6±2.4 14.4±1.4 15.2±5.9 1,8±0.5 2.2±0.7Bonga 22.6 0.9 13.4±2.6 5.3±2.2 44.3±13.8 1 1.8± 2.2 14.0±1.8 21.3±6.8 1. 1±0.8 2.4±0.6Kofele 22.5 1.8 14.6±3.7 5.8±3.3 99.2±32.8 10.4±1.7 14.0±1.1 20.4±4.5 1.4±0.8 1.8±0.5Dinsho 22.7 3 16.1 ±2.4 3.3±2.3 85.2±24.7 14.4±2.0 14.2±1.1 19.0±4.3 1.6±0.6 2.4±0.8D odola-Serofta 21.9 2.9 19.5±2.9 6.7±2.4 88.6±38.5 12.4±1.8 14.7±0.8 19.2±4.6 1.7±0.6 3.0±0.6D odola-Dachosa 18.3 na 15.7±4.8 5.0±3.3 84.2±40.3 13.7±2.6 14.4±1.4 16.0±4.8 1.8±0.5 2.5±0.6Rira 19.3 na 15.2±4.7 4.2±2.8 66.5±31.3 13.3±2.4 14.0±1.2 12.9±4.9 1.3±0.7 2.5±0.7Bore 24.5 1.1 17.3±3.4 7.2±2.5 64.4±16.1 13.2± 1.7 14.6±1.1 15.9±5.2 2.1±0.7 1.6± 0.6Uraga 171.3 0.7 14.4±2.0 7.1±2.3 49.7±16.1 13.2±2.2 13.5±1.7 19.4±6.7 l.ldb0.8 1.9±0.5H agereM ariam 28.7 0.9 12.7±3.2 7.0±2.5 54.3±24.6 12 .8± 2.1 15.0±1.3 19.8±6.8 1.9±0.9 1.7±0.6Average 13.8±2.80 5.0±1.44 62.8±23.16 12.6±1.74 14.0±0.86 18.2±3.24 1.4±0.37 2.2±0.34D= distance between trees, SI= sex index (relative number of male to female), TH= total height, BH= Bole height, DBH= diameter at breast height, LP= maxi-
— mum length of petiole, NL= no. of leaflets, NS= No. of stipules, NLBS= No. of pairs of leaflets with stipules at the back of their bases, WT= width of serrated uj edges of leaf tooth.
Paper III: C
onverstion genetics
Paper III: Conversion genetics
Supplementary Table 2. Weighted-score population prioritization matrix (WPPM)
a) for in situ conservationCritera Weight
(out of 10)Score3 Product
(weight x score)
0 1 2 3 4 5
1 G enetic criteria 4
1.1 Within-population gene diversity (He)
3
1.2 Average genetic distance (AGD)
1
2 Demographic criteria 62.1 Status of natural regeneration 32.2 DBH-based population structure 1
2.3 Present conservation status 1
2.4 Population size 1sum
b) for ex situ conservation (seed bank & ex situ conservation stands)Critera Weight
(out of 10)Score3 Product
(weight x score)
0 1 2 3 4
1 Genetic criteria 8
1.1 Within-population gene diversity(He)
5
1.2 Average genetic distance (AGD) 32 Demographic criteria 22.1 Population size 2
sum
c) for tree improvement and domestication programs
CriteraWeight (out o f 10)
Score3 Product (weight x score)
0 1 2 3 4
1 Genetic criteria 4
1.1 Within-population gene diversity (He)
3
1.2 Average genetic distance AGD)
1
2 Demographic criteria 6
104
Paper III: Conversion genetics
2.1 Boleform/height 52.2 Population size 1
sumaA box under the appropriate score is crossed based on the evaluation of the population based on the predetermined weights and scores of each criterion.
Description of scoring
1. Amount of genetic diversity (AFLP)
1.1 Within-population gene diversity
Scores1 = Mean population gene diversity values (He) less than the overall mean minus 15% of
the overall mean2 = He greater than or equal to the mean minus 15% of the mean, less than mean minus
5% of the mean3 = He greater than or equal to the mean minus 5%, less than the mean plus 5% of the
mean4 = He greater than or equal to the mean plus 5% of the mean, less than the mean plus
15% of the mean5 = He greater than the mean plus 15% of the mean
1.2 Average genetic distances (AGD)
1 = 0 .010-0 .0192 = 0 .020-0 .0293 = 0 .030-0 .0394 = 0 .040-0 .049
2. Status of natural regeneration (total count around the sample trees)
0 = No regeneration1 = low (1-10) wildings
2 = fair (10-25) wildings3 = good (25-50) wildings4 = high (>50) wildings
3. DBH-based population structure
1= > 6 DBH classes missing2 = 5-6 DBH classes missing3 = 3-4 DBH classes missing
105
Paper III: Converstion genetics
4 = 1-2 DBH class missing5 = complete distribution
4. Present conservation status (refers to the pressure from the surrounding community and the current level of protection)
0= well-protected - not threatened at the moment1 = fair protection - but vulnerable 2= open access -endangered3 = open access - gravely endangered
5. Population size (y)
1= y < 502 = 50 < y >1503 = 150< y > 2504 = 250< y > 3505 = y > 350
6. Bole quality measured as mean bole height (z)
1 = z < 4 m2 = 4< z < 6 m3 = z > 6 m
106
Supplementary Table 3 Summary of the results of the prioritization o f the extant populations of Hagenia for in situ conservation, ex situ conservation, and for tree improvement and production purposes.
a) Prioritization of Hagenia populations for in situ conservation
Criteria DK WD KB DR WB WW CM DN ZQ BB CL SM MS BG KL DO DS DD RR BR UR HMAmount o f He gene diver
12 9 12 9 12 9 9 12 12 12 6 6 9 9 9 15 3 6 6 9 3 6
sity AGD 2 1 2 1 1 1 1 2 2 1 1 1 1 1 1 4 2 1 3 1 2 1
Status o f natural regeneration
0 0 0 0 0 0 0 0 0 3 0 0 0 12 0 0 0 0 0 0 0 0
DBH-based population structure
1 1 5 1 3 3 4 3 3 4 4 2 5 3 1 1 1 2 3 1 3 4
Present conservation status
1 1 1 1 2 1 1 2 3 1 3 2 1 2 2 0 1 0 1 3 2 3
Population size 1 2 2 2 2 1 2 2 2 2 2 2 2 2 2 4 2 5 3 2 2 2sum 17 14 22 14 20 15 17 21 22 23 16 13 18 29 15 24 9 14 16 16 12 16Rank 8 11 4 I 1 6 10 8 5 4 3 9 12 7 1 10 2 14 11 9 9 13 9
b) Prioritization of Hagenia populations for ex situ conservation
Criteria_________________ DK WD KB DR WB WW CM DN ZQ BB CL SM MS BG KL DO DS DD RR BR UR HMAmount o f ge He 20 15 20 15 20 15 15 20 20 20 10 10 15 15 15 25 5 10 10 15 5 10ne diversity
AGD 6 3 6 3 3 3 3 6 6 3 3 3 3 3 3 12 6 3 9 3 6 3
Population size 2 4 4 4 4 2 4 4 4 4 4 4 4 4 4 8 4 10 6 4 4 4sum 28 22 30 22 27 20 22 30 30 27 17 17 22 22 22 45 15 23 25 22 15 17Rank 3 7 2 7 4 8 7 2 2 4 9 9 7 7 7 1 10 6 5 7 10 9
c) Prioritization of Hagenia populations for tree improvement and domestication purposes
Criteria DK WD KB DR WB WW CM DN ZQ BB CL SM MS BG KL DO DS DD RR BR UR HMAmount of Hc 12 9 12 9 12 9 9 12 12 12 6 6 9 9 9 15 3 6 6 9 3 6gene diversity
AGD 2 1 2 1 1 1 1 2 2 1 1 1 1 1 1 4 2 1 3 1 2 1
Bole height 5 5 15 10 10 5 10 10 10 10 5 10 10 10 10 5 15 10 10 15 15 15Population size 1 2 2 2 2 1 2 2 2 2 2 2 2 2 2 4 2 5 3 2 2 2sum 20 17 31 22 25 16 22 26 26 25 14 19 22 22 22 28 22 22 22 27 22 24Rank 7 9 1 6 4 10 6 4 4 4 11 8 6 6 6 2 6 6 6 3 6 5
Population codes follow Table 1; Hc= gene d iv e rsity , AGD = average genetic distance between one population and the rest
Paper III: Converstion
genetics
Paper III: Converstion genetics
9 a « s z t s
109
Supplementary Fig. 1. DBH-based population structure of 21 natural populations of Hagenia abyssinica from Ethiopa. Population codes as in Table 1.
10 Appendices
Appendix l. Description of Tree Seed Zones (TSZ) of Ethiopia in which H. abyssinica is
growing
TSZ no. Name of Tree Seed Zones_______________________________________________15.3 Welo Dry Juniperus Forest (Welo in Amhara and South extreme of Tigray)17 Southeastern High Altitude Juniperus Forest (Chilalo, Kaka & Batu mountains
- Western Arsi and North western Sidamo)18 Upper Wabe Juniperus Forest (Southwestern extreme of Arsi and Northwes
tern extreme of Sidamo)19 Western Highlands Moist Juniperus Forest (Northeastern Gonder, Including
Wegera Mts.)20.1 Gojam Undifferentiated Afromontane Forest (Gojam and southeastern Gonder)20.2 Northeastern Drier Undifferentiated Afromontane Forest (northeastern Shewa
& southwestern Wello)20.3 Southeastern Shewa Undifferentiated Afromontane Forest (Highlands east and
south of Addis Abeba and Gurage Mt.)20.4 Western Humid Undifferentiated Afromontane Forest (western Welega and
western Shewa)21.1 Arsi Western Escarpment Undifferentiated Afromontane Forest (western Arsi)21.2 Gelemso Central Undifferentiated Afromontane Forest (western Arsi & north
central Hararghe)23.2 Central Wet Broad-leaved Afromontane Rainforest (northwestern Illubabor,
eastern Illubabor & central northeastern Kaffa)23.3 Eastern Higher Broad-leaved Afromontane Rainforest (northeastern half of
Gamo Gofa, southwestern extreme of Shewa & southeastern Keffa)24.1 Southeastern Upper Wet Broad-leaved Afromontane Rainforest (southern
slopes of Batu mountains in areas above 2000 masl, north of Hagere Mariam)24.2 Southeastern Lower Broad-leaved Afromontane Rainforest (southern slopes of_________ Batu mountain in areas below 2000 masl, south of Hagere Mariam)___________Source: Aalbaek 1993
Appendices
Appendix 2. Ranges o f absolute morphological and some ecological values observed among populations of Hagenia in Ethiopia.
Variables Minimumrecord
Maximumrecord
Variables Min.record
Max.record
altitude 2221 3193 width of serrated tooth (mm) 1 8sex ratio 1:0.3 1:30 no. of pairs o f leaflets having 0 4(M:F) stipules at the back of their
basestree height 3.0 35 no. of stipules between two 0 10(m) pairs of leafletsbole height 0.0 20 diameter at breast height (cm) 2.5* 242(m)length of 5.5 20.5 distance between trees (m) 0.1 730petiole (cm)no. o f leaf 7 19 distance between populations 20.6 806.4lets (km)
no. o f stipu 2 41les* Plants having diameter at breast height (DBH) values less than 2.5 cm are recorded as either saplings or seedlings
112
Appendix 3. Pairwise matrix showing geographic distances between 22 natural populations of Hagenia abyssinica from Ethiopia (see Table 1 of papers I & II for population codes)
KB 0BG 415.70HM 585.8 263.0 0BR 555.8 280.2 62.6 0BB 292.8 157.4 301.9 281.0 0UR 567.4 273.1 41.0 20.60 286.2 0CL 424.7 317.5 250.4 190.3 208.3 209.8 0CM 259.9 276.6 356.0 314.3 122.2 330.5 170.5 0DR 214.1 475.1 555.6 505.2 317.7 520.8 325.8 207.9 0KL 480.1 277.6 160.1 103.0 222.7 124.7 87.4 224.5 705.5 0DN 461.0 450.8 367.9 308.6 327.8 327.8 136.3 239.5 298.5 215.6 0DO 543.0 378.7 208.3 153.1 314.0 173.8 116.2 286.5 430.1 101.2 175.2 0DD 528.4 321.4 153.9 92.7 276.0 110.9 116.0 273.1 442.7 51.9 220.8 65.9 0DS 516.5 301.5 137.2 78.1 257.1 98.3 116.7 263.0 439.8 39.1 230.0 84.6 22.3 0WB 141.2 369.6 595.9 575.7 295.4 584.4 476.6 314.2 340.6 511.9 544.1 591.5 564.9 549.1 0DK 264.5 671.2 806.4 763.5 530.5 777.8 593.5 451.5 267.7 664.7 562.5 700.2 708.6 704.7 376.5 0MS 455.1 277.7 191.0 131.5 210.0 151.1 61.4 200.5 378.1 28.50 197.4 107.7 73.8 65.6 492.9 641.8 0RR 567.1 376.0 185.2 126.6 326.9 143.6 145.0 311.1 466.8 101.8 210.6 37.5 57.2 77.3 611.5 730.0 121.9 0WD 294.3 609.3 679.6 627.0 452.2 643.6 439.4 388.2 131.7 524.2 375.3 533.2 556.0 555.0 428.7 215.0 500.0 570.0 0SM 371.1 69.3 331.6 338.9 155.4 337.3 352.8 276.2 456.6 327.2 476.3 427.0 371.8 353.4 311.4 632.0 324.8 427.8 589.1 0WW 348.4 463.7 464.2 407.2 312.9 424.4 213.7 191.2 160.6 303.9 141.7 296.7 326.1 329.5 451.3 420.3 276.0 336.3 239.7 470.0 0ZQ 350.4 304.9 301.5 247.8 175.2 266.4 78.3 98.8 257.1 148.4 151.4 189.4 187.8 182.4 409.7 521.1 120.0 212.0 377.6 323.3 167.3 0
KB BG HM BR BB UR CL CM DR KL DN DO DD DS WB DK MS RR WD SM WW ZQ
J
Appendices
TAYE BEKELE [email protected]
Curriculum Vitae
Date o f birth:Sex:Nationality: Marital status:
23 July 1965MaleEthiopianMarried, two daughters
Education
2005 - 2008 PhD study, Department of Forest Genetics and Forest Tree Breeding, Georg-August University Goettingen, Germany Master of Science, Farm Forestry, Swedish University of Agricultural Sciences (SLU), Uppsala & Wondo Genet. Ethiopia Bachelor of Science, Forestry Management, Swedish University of Agricultural Sciences (SLU), Uppsala & Wondo Genet, Ethiopia Diploma, Wondo Genet Forestry Resources Institute, Ethiopia,
1994-1996
1988-1990
1983-1985
Professional experience
06, 2000 - 01, 2005 Head, Department o f Forest and Aquatic Plants, Ethiopian Institute o f Biodiversity Conservation (IBC) and Counterpart to Forest Genetic Resources Conservation Project
• Chief Editor, Biodiversity Newsletter (2000-2004)• Forestry Team Leader, National Biodiversity Strategy and Action Plan (BSAP)
0 2 ,1 9 9 9 -0 6 ,2 0 0 0 Forestry Expert, GTZ- Forest Genetic Resources ConservationProject, Ethiopia
07 1996 - 02, 1999 Programming Senior Expert/Assistant Farm Forestry Program Coordinator, Ethiopian Orthodox Church Development and Inter- Church Aid Commission (EOC-DICAC), Ethiopia
06, 1990 -08, 1994 Junior Research Officer, Bako Agricultural Research Centre, Institute of Agricultural Research, Ethiopia
07, 198 5 -0 8 , 1988 Technical Assistant, Forestry Research Centre (based in Jimma),Ministry o f Agriculture, Ethiopia
Publications
Tave BA. Gailing O, Mohammed U, Finkeldey R. Colonization history and phylogeography of Hagenia abyssinica (Bruce) J.F. Gmel in Ethiopia inferred from chloroplast microsatellite markers. Submitted
Tave BA. Gailing O, Finkeldey R. Spatial distribution o f genetic diversity in Hagenia abyssinica from Ethiopia assessed by AFLP molecular markers. Submitted
116
Taye BA. Gailing O, Finkeldey R. Conservation genetics of African redwood (Hagenia abyssinica) (Bruce) J.F. Gmel: a remarkable but gravely endangered tropical tree species. Submitted
Getachew Berhan and Taye Bekele (2006) Population structure and spatial distribution of four woody medicinal plant species in Bonga forest, Ethiopia. Ethiop. J. Nat. Sci. 8: 19-38
Kumlachew Yeshitela and Taye Bekele (2003) The Woody Species Composition and Structure of Masha-Anderacha Forest, Southwestern Ethiopia. Ethiop. J. Biol. Sci. 2(1): 31-48
Taye Bekele. Getachew Berhan, Matheos Ersado and Elias Taye (2003) Regeneration Status o f Moist Montane Forests o f Ethiopia: Part II: Godere, Sigmo, Setema and Ti- ro-Boterbecho Forests. Walia 23: 19-32
Taye Bekele (2003) The benefits of Forest Certification to Ethiopia. In Proceedings of the National Stakeholders Workshop on Forest Certification. 25 - 26 August 2003, Addis Abeba, Ethiopia
Taye Bekele (2003) The Potential of Bonga Forest for Certification. In Proceedings of the National Stakeholders Workshop on Forest Certification. 25 - 26 August 2003, Addis Abeba, Ethiopia
Simon Shibru, Taye Bekele and Girma Balcha (2003) Preliminary Survey of the Effect of Drought on the Forest Resources. Biodiversity Newsletter, Vol. 2, No. 1
Taye Bekele. Getachew Berhan, Elias Taye, Matheos Ersado and Kumlachew Yeshitela (2001) Regeneration Status of Moist Montane Forests of Ethiopia: Consideration for Conservation (Part I). Walia 22: 45-62
Franzel S, Ndufa, JK, Obonyo OC, Taye Bekele and Coe R (2002) Farmer-designed agroforestry trials: farm ers' experiences in Western Kenya. In Franzel S and Scherr SJ (eds). Trees on the Farm: Assessing the Adoption Potential o f Agroforestry Practices in Africa. CABI Publishing, New York
Taye Bekele. Kumlachew Yeshitela, Getachew Berhan and Sisay Zerfu (2002) Forest Biodiversity Conservation: Perspectives of the Ethiopian Orthodox Church. In Ishii K, Masumori M & Suzuki K Proceedings of BIO-REFOR Tokyo Workshop. 7-11 October 2001, Tokyo
Taye Bekele (2002) Indigenous Knowledge of Medicinal Plants: Perspectives of the Ethiopian Orthodox Church. In Mersha Alehegne, Taye Bekele & Netsanet Tesfaye (eds.). Proceedings of the Workshop on the Ethiopian Church: Yesterday, Today and Tomorrow. 18-19 April 2002, Addis Abeba, Ethiopia
Edwards S, Abebe Demissie, Taye Bekele & Haase G (eds.) (1999) Forest genetic resources conservation: principles, strategies and actions: proceedings of the national forest genetic resources conservation strategy development workshop, June 21-22, 1999, Addis Abeba, Ethiopia
Taye Bekele. Haase G & Teshome Soromessa (1999). Forest genetic resources of Ethiopia: status and proposed actions. In Edwards, et al., Forest genetic resources conservation: principles, strategies and actions: proceedings of the national forest genetic resources conservation strategy development workshop, June 21-22, 1999, Addis Abeba, Ethiopia
Taye Bekele. 1993. Direct sowing Pigeon pea: A successful low cost establishment technique. IAR Newsletter. Vol. 8 No. 4
117
_____________________
The m onotypic tropical tree species Hagenio abyssinica (Rosaceaej is an anemogamous and
anemochorous broad-leaved dioecious tree species native to Africa. Fossil pollen evidences sug
gest that it immigrated in to Ethiopia from the south during the late Pleistocene. The chloroplast
haplotypes identified in Hagenia are grouped into two lineages and demonstrated a strong pat
tern of congruence between their geographical d istribution and genealogical relationships. Re
stricted gene flow through seeds, contiguous range expansion, mutation and rare long-distance
dispersal shaped the genetic structure in the chloroplast genome of Hagenia.
Populations showed moderate to high gene diversities and moderate but significant genetic d if
ferentiation at AFLP markers, reflecting high levels of post-colonization gene flow. Despite the
dispersal of seed and pollen by wind, a significant fine-scale spatial genetic structure (SGS) was
observed in some populations. A weighted-score population prioritization matrix(WS-PPM) that
combines genetic, morphological and demographic criteria was developed and used for the first
time to prioritize populations for conservation and domestication. Conservation and massive
plantation programs should be launched to ensure the survival of the gravely endangered Kosso
and to boost its economic and ecological values.
ISBN 13:978-3-941274-07-5
9" 783941 11 274075 02850
Top Related