Genetically Engineered U.S. Domestic Product (2012)
http://www.nature.com/nbt/journal/v34/n3/abs/nbt.3491.html
http://en.wikipedia.org/wiki/Subtilisin
=
1x~20x
~200,000x
~1980, better soap cut US domestic hot water heating by up to 10% (or 100,000 bbl oil per day)
7
http://www.apsnet.org/edcenter/intropp/lessons/viruses/Pages/PapayaRingspotvirus.aspx
Dennis Gonsalves
TAATACGACTCACTATAGGGAGA
Gene & Genome Constr. = #1 Tech. of 21st Ctry.
From abstract information to physical, living DNA designs.
2003: $4/bp2015: $0.04/bp2027: $0.0004/bp?
16
http://www.wired.com/2013/04/how-pixar-used-moores-law-to-predict-the-future/
“When the group moved to California to become part of Lucasfilm, we got close to making a computer-animated movie again in the mid-1980s — this time about a monkey with godlike powers but a missing prefrontal cortex. We had a sponsor, a story treatment, and a marketing survey. We were prepared to make a screen test: Our hot young animator John Lasseter had sketched numerous studies of the hero monkey and had the sponsor salivating over a glass-dragon protagonist.
But when it came time to harden the deal and run the numbers for the contracts, I discovered to my dismay that computers were still too slow: The projected production cost was too high and the computation time way too long. We had to back out of the deal. This time, we [knew enough] to correctly apply Moore’s Law — [] we had to wait another five years to start making the first movie. And sure enough, five years later Disney approached us to make Toy Story.” — Alvy Ray Smith
http://www.synthesis.cc/cgi-bin/mt/mt-search.cgi?blog_id=1&tag=Carlson%20Curves
DNA sequencing (read) & synthesis (write) are improving faster than silicon-based fab.
DNA sequencing (read) & synthesis (write) are improving faster than silicon-based fab.
OK GO, on treadmills https://www.youtube.com/watch?v=dTAAsCNK7RA
http://www.livingplanetindex.org/projects?main_page_project=AboutTheIndex&home_flag=1
Past ~45 years, humans x 2, animals / 2
The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot.com/)
Reproducing, growing, &
healing materials
~90 terawatts; pre-distributed
Massively functional
Living ramifications
Biology is nature’s nanotechnology
Take infectious & other diseases off the table
Provide for all of humanity
Stabilize & recover natural biodiversity
Enable a culture of citizenship
Understand life via building
You are what you eat!
We eat what we are...
SISSEL TOLAASCHRISTINA AGAPAKIS
SISSEL TOLAASCHRISTINA AGAPAKIS www.syntheticaesthetics.org
The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot.com/)
Reproducing, growing, &
healing materials
~90 terawatts; pre-distributed
Massively functional
Living ramifications
Biology is nature’s nanotechnology
Take infectious & other diseases off the table
Provide for all of humanity
Stabilize & recover natural biodiversity
Enable a culture of citizenship
Understand life via building
Top Related