B Tavora et al. Nature 000, 1-5 (2014) doi:10.1038/nature13541
FAK deficiency inhibits doxorubicin-stimulated endothelial-cellp65 activity, phosphorlyation and nuclear translocation.
Top Related
DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation
Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51
Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015
doi:10.1038/nature06481 LETTERS
Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility
Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat
1 November 2007 doi:10.1038/nature06221 LETTERS
Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128