DIPLOMARBEIT
Titel der Diplomarbeit
Alterations in the Gap-Junctional Protein Cx43
under Conditions of Ether Lipid Deficiency
Verfasserin
Fatma Aslı Erdem
angestrebter akademischer Grad
Magistra der Naturwissenschaften (Mag.rer.nat.)
Wien, 2011
Studienkennzahl lt. Studienblatt: A 490
Studienrichtung lt. Studienblatt: Diplomstudium Molekulare Biologie
Betreuerin / Betreuer: Univ.-Prof. Dr. Johannes Berger
ACKNOWLEDGEMENTS
First, without my family nothing would have been possible: Thank you for encouraging me in
all aspects and reminding me that there’s always a brake in life.
Secondly, all teachers from my school, especially Rosemarie Fürst and Maria Schink (rest in
peace) from preliminary school; as well as all professors and supervisors of my university
years shall also be thanked who were keen on giving the best knowledge.
In the course of my diploma thesis, special thanks go to Johannes Berger for his support and
endless confidence in me.
I also thank Sonja Forss‐Petter sincerely for everything including the critical reading of this
manuscript.
Thanks to my colleagues in the lab for the nice and supportive atmosphere.
My deepest gratitudes go to my friends Anja, Antonia, Franziska, Iduna, Song‐Hi and Sania
for their never‐ending care and support.
This thesis is dedicated to all RCDP children and their caring parents.
Fatma, Vienna 2011.
CONTENTS
1 Abstract ........................................................................................................................................... 5
2 Introduction ..................................................................................................................................... 7
2.1 Membranes and Lipids ............................................................................................................ 7
2.2 Membrane Rafts .................................................................................................................... 10
2.3 Ether Lipids ............................................................................................................................ 12
2.3.1 Biosynthesis of Plasmalogens ........................................................................................ 14
2.3.2 Peroxisomes and the Peroxisomal Import .................................................................... 15
2.4 Rhizomelic Chondrodysplasia Punctata (RCDP) .................................................................... 17
2.4.1 Cases of RCDP associated with heart abnormalities ..................................................... 18
2.4.2 Mouse Models ............................................................................................................... 20
2.5 Connexins .............................................................................................................................. 21
2.6 The role of lipid rafts in gap junctions ................................................................................... 24
2.7 Connexin‐43........................................................................................................................... 25
2.7.1 The role of Cx43 in cardiac function .............................................................................. 28
3 Aim of the Study ............................................................................................................................ 31
4 Materials and Methods ................................................................................................................. 32
5 Results ........................................................................................................................................... 42
5.1 Cx43 from dermal fibroblasts is detected as several bands in immunoblot analysis ........... 42
5.2 Amount of expressed Connexin‐43 depends on the cell confluency .................................... 42
5.3 Human primary fibroblasts deficient in ether lipids show a clear reduction in Cx43 ........... 43
5.4 In ether‐lipid deficient cells Cx43 expression is not increased upon confluency .................. 44
5.5 Three‐day‐treatment with ether lipid precursors is not sufficient to restore Cx43 levels ... 45
5.6 Cx43 is concentrated at sites of cell‐cell contact .................................................................. 47
5.7 Cx43 localization is affected by ether lipid‐deficiency .......................................................... 48
5.8 Ether lipid deficiency leads to a mislocalization of Cx43 phospho‐isoforms in rafts ............ 49
5.9 Adult Dhapat‐deficient mice show reduced amounts of Connexin‐43 in heart ................... 50
6 Discussion ...................................................................................................................................... 52
7 References ..................................................................................................................................... 59
8 Appendix ........................................................................................................................................ 72
ABBREVIATIONS
AA Arachidonic acid ADHAPS or ADHAP‐S Alkyl‐dihydroxyacetone phosphate synthase App# Application number BA Batyl‐Alcohol BSA Bovine serum albumin CoIP Co‐immunoprecipitation Conj conjugated const constant Cx43 Connexin‐43 DHA Docosahexaenoic acid DHAPAT or DHAP‐AT Dihydroxy‐Aceton Phosphate Acyltransferase dNTP Deoxynucleotide triphosphate ER Endoplasmatic reticulum EtOH Ethanol EtOH abs. Ethanol absolute FA Fatty acid FBS Fetal bovine serum GJA1 Gap‐junctional Protein alpha 1 GPI Glycosyl‐phosphatidyl‐inositol HDG Hexadecylglycerol kDa Kilo‐Dalton KO Knockout o/n Overnight PBD Peroxisomal biogenesis disorder PBS Phosphate‐buffered saline PC Phosphatidylcholine PCR Polymerase Chain Reaction PE Phosphatidylethanolamine Pex Peroxin PI Protease inhibitor cocktail PMP Peroxisomal membrane protein Pol Polymerase PTS Peroxisomal targeting signal RCDP Rhizomelic Chondrodysplasia Punctata s.d. Standard deviation SDS Sodium dodecylsulfate SM Sphingomyelin TAE Tris‐Acetate‐EDTA TBST Tris‐buffered saline supplemented with Tween TOF Tetralogy of Fallot VLCFA Very‐long‐chain fatty acids WT Wildtype
5
1 ABSTRACT
Plasmalogens are special ether lipids that differ in having a vinyl ether bond at their sn1
position and in being abundant in membrane rafts. Plasmalogen deficiency leads to the rare
inherited disorder rhizomelic chondrodysplasia punctata (RCDP) that, in some cases, is also
accompanied by heart defects. In non‐RCDP patients, such cardiac defects have been
associated with a downregulation and/or mislocalization of Connexin‐43 (Cx43). This protein
has been shown to be reduced in fibroblasts of ether lipid‐deficient mice.
The aim of the present thesis was to detect a possible molecular link between Cx43 and
ether lipids in RCDP cells and hearts of mice deficient in ether lipids.
We were able to distinguish the non‐phosphorylated and phosphorylated isoforms of
Cx43 in our system. The non‐phosphorylated isoform represents newly synthesized
intracellular protein, while phosphorylated Cx43 isoforms are at the cell surface or in gap
junctions. Our results demonstrate a confluency‐dependent expression of Cx43. This protein
was upregulated in human primary control fibroblasts upon confluency. However, this
induction was not observed in ether lipid‐deficient fibroblasts. These cells showed a
significant reduction in Cx43 protein levels compared to control. Interestingly, Cx43 was
particularly reduced in its phospho‐isoforms. Furthermore, immunofluorescence staining
revealed Cx43 to be localized exclusively at sites of cell‐cell contact in control cells, resulting
in a continuous signal. Human primary fibroblasts lacking ether lipids did not exhibit this
pattern. We also examined localization of Cx43 in rafts by isolating detergent‐resistant
membranes from both primary cell lines and detected most of the Cx43 phospho‐isoforms to
be in raft fractions of control cells, whereas in ether lipid‐deficient cells they were merely
present. Due to the many reported RCDP cases associated with heart anomalies, mouse
heart tissues were examined. Hearts of mice lacking a crucial biosynthetic enzyme for ether
lipid biosynthesis also showed significantly lower amounts of Cx43.
Taken together, this study points towards a possible involvement of Cx43 in the
pathologic course of RCDP. It is also tempting to speculate that Cx43 might be involved in the
molecular mechanisms underlying underlying the heart defects reported in RCDP patients.
Thus, these data provide sufficient information to justify future detailed investigations.
KURZFASSUNG
Plasmalogene sind spezielle Ether Lipide, die sich durch eine Vinyl‐Ether‐Bindung an der
sn1‐Position unterscheiden und in lipid rafts vorkommen. Der Ausfall von Plasmalogenen
führt zu rhizomelischer Chondrodysplasie punctata (RCDP), einer seltenen vererbbaren
Krankheit die in einigen Fällen auch von Herzdefekten begleitet ist. Letztere wurden in nicht‐
RCDP Patienten mit einer Herunterregulation und falschen Lokalisation von Connexin‐43
(Cx43) in Verbindung gebracht. Dieses Protein wurde in Ether Lipid‐defizienten Mäusen in
reduzierten Mengen vorgefunden.
Das Ziel dieser Arbeit war, eine mögliche molekulare Verbindung zwischen Ether‐Lipiden
und Cx43 in RCDP Zellen sowie Ether Lipid‐defizienten Mausherzen aufzudecken.
Wir konnten in unserem System nicht‐phosphorylierte und phosphorylierte Isoformen
von Cx43 erkennen. Die nicht‐phosphorylierte Isoform stellt neu synthetisiertes Protein dar,
während phosphorylierte Cx43 Isoformen an der Zelloberfläche oder in Gap Junctions
eingebaut sind. Unsere Ergebnisse zeigen eine Dichte‐abhängige Expression von Connexin‐43.
Die Cx43 Phospho‐Isoformen waren in humanen primären Kontrollfibroblasten mit der
Dichte erhöht. Jedoch wurde dieser Effekt in Ether Lipid‐defizienten Zellen nicht beobachtet.
Zusätzlich waren in dieser Zelllinie die Proteinmengen von Cx43 im Vergleich zu den
Kontrollzellen signifikant reduziert. Interessanterweise war diese Reduktion vor allem in den
Phospho‐Isoformen prominent. Zudem zeigten Immunfluoreszenzfärbungen, dass Cx43 an
Stellen von Zell‐Zellkontakten lokalisiert, sodass ein kontinuierliches Signal entsteht,
während diese Färbung in den primären Fibroblasten ohne Ether Lipide nicht zu finden war.
Wir untersuchten auch die Raft‐Lokalisation von Cx43 durch die Isolation von Detergenz‐
resistenten Membranen der beiden Zelllinien und fanden in Kontrollzellen den Großteil der
Cx43‐Phosphoisoformen in den Raft‐Fraktionen, während in mutanten Zellen kaum welche
anwesend waren. Die berichteten RCDP‐Fälle mit Herzanomalien veranlassten uns zur
Überprüfung von Cx43 in Herzgeweben von Mäusen. Verglichen mit Wildtyp‐Mäusen, waren
Cx43 Proteinmengen in den Herzen der Ether Lipid‐defizienten Mäuse signifikant reduziert.
Zusammengefasst deutet diese Arbeit auf eine mögliche Beteiligung von Cx43 im
pathologischen Ablauf des RCDP an. Damit ist es naheliegend zu vermuten, dass Cx43 in den
zugrunde liegenden molekularen Mechanismen der Herzphänotypen von RCDP‐Patienten
beteiligt sein kann. Diese Daten beschaffen genügend Information, um detaillierte
Untersuchungen zu rechtfertigen.
7
2 INTRODUCTION
Cells are the smallest units forming the whole organism and thus crucial for its appropriate
function. Membranes allow their existence and are a barrier to help control passage of
metabolites, ions, substrates. By doing so, they automatically serve as a first platform in
initiating signaling into and out of the cell. Therefore, their composition is essential to clearly
define each task.
2.1 Membranes and Lipids
Plasma membranes of mammalian cells are bilayers composed of phospholipids. Their
chemical, amphiphilic composition renders them bipolar, with a polar hydrophilic head
group and a nonpolar hydrophobic tail bearing fatty acid chains. This allows a spontaneous
attraction of the tails to each other and the polar heads to be exposed to the aqueous face,
leading to a typical bilayer structure (Figure 2‐1) (Alberts, 2008).
However, the leaflets of the bilayer are by far not identical: while the outer part has been
reported to contain more choline‐containing phospholipids, the inner part has
predominantly aminophospholipids (Fadeel and Xue, 2009; Quinn and Kagan, 2002) (Figures
2‐1, 2‐2). This asymmetry is maintained and used deliberately for signaling and for achieving
specific domains in the membrane, which is also the reason for the apical‐basal polarity of
epithelial cells (Cooper, 2000; Simons and van Meer, 1988).
Figure 2‐1. Schematic illustration of the membrane bilayer
depicting its typical lipids. Note the asymmetry between the
leaflets. (modified from The Cell: A Molecular Approach 2nd ed.)
Introduction
In addition to phospholipids that can be divided further into glycerophospholipids and
sphingolipids (Figure 2‐3), mammalian membranes contain glycolipids and cholesterol. Each
lipid class will be briefly discussed here, with a stronger emphasis on glycerophospholipids.
Glycerophospholipids are the major structural lipids and consist of a glycerol backbone
that offers three hydroxyl moieties which are defined with sn (stereospecific numbering)
positions1. Two of these, sn1 and sn2, are generally esterified to fatty acids while the “head”
1 Lipidmaps.org
Figure 2‐2. Percentage of major membrane phospholipids in the cytoplasmic and outer leaflets
as reported in the human erythrocyte membrane.
PC‐phosphatidylcholine, PE‐phostphatidyl ethanolamine, SM‐sphinghomyelin, PI‐phosphatidylinositol, PS‐
phosphatidylserine (Quinn and Kagan, 2002)
Cytoplasmic Leaflet Outer Leaflet
Figure 2‐3. Overview of membrane lipids illustrated as building blocks
(from lipidlibrary.aocs.org)
Introduction
9
is attached to a phosphate group bearing an alcohol such as choline, ethanolamine or serine
(Figures 2‐3, 2‐4) (Alberts, 2008; Sprong et al., 2001).
Phosphatidylcholine (PC) is the main lipid accounting for about 50% or more of the
phospholipids. Another phospholipid is phosphatidylethanolamine (PE) with a smaller head
group and a conical shape leading to curvature stress in the membrane that causes events
like budding, fission and fusion. Phosphatidylserine is normally kept in the inner leaflet but
switched to the outer side if the cell undergoes apoptosis (Fahy et al., 2005; Marsh, 2007;
van Meer, 2005; van Meer et al., 2008).
Sphingolipids comprise the second category, differing in their backbone containing
sphingosine instead of glycerol. The main representative is sphingomyelin (SM) with a
phosphocholine head group (Figure 2‐5), and is mainly located in the outer leaflet of the
membrane. Sphingomyelin is able to form a solid membrane on its own due to its saturated
tails, leading to a separate, less fluid phase in the membrane and thus making a tighter
packing possible (van Meer, 2005; van Meer and Lisman, 2002).
Figure 2‐4. Schematic illustration of a glycerophospholipid with its basic structure found in
mammalian membranes. Structure of a bilayer (A) composed of phospholipids which consist of
a hydrophilic head (green) and two hydrophobic tails (purple) attached to the three moieties of
a glycerol molecule (B and C). (modified from Nature Scitable)
Introduction
10
Cholesterol is the only non‐polar lipid constituent of mammalian membranes, accounting
for about 25% of lipids, being responsible for its fluidity and packing (Alberts, 2008; Ikonen,
2008). Cholesterol has been shown to especially associate with sphingomyelin, for which
models were raised to explain the reason (reviewed in Ikonen, 2008). Nevertheless, this
tendency allows special domains in the membrane to form, leading to dynamic platforms,
termed membrane rafts (Pralle et al., 2000).
Other lipid species occur as minor components of the membrane, such as glycolipids
containing sugar units, phosphoinositides, and ether lipids, which differ in their sn1 position
carrying an ether bond.
2.2 Membrane Rafts
The early view of the cell membrane to solely be an inert “solvent” for membrane
proteins (Singer and Nicolson, 1972) was shown to be wrong through the emergence of
studies reporting domains to be present in the membrane (Spector and Yorek, 1985).
Eventually, the existence of such domains was generally accepted, leading to the term
“membrane rafts” suggested by Simons and van Meer (Simons and van Meer, 1988).
According to the raft concept that was revised at the Keystone symposium (Pike, 2006), rafts
are floating microdomains enriched in sterol and sphingolipids with highly dynamic and
heterogenous features and can be stabilized to result in larger platforms (Jacobson et al.,
2007) (Figure 2‐6).
Figure 2‐5. Basic structure of a
sphingolipid. The head group (“R”) is
commonly a phosphocholine or a
phosphoethanolamine. (modified from themedicalbiochemistrypage.org)
Introduction
According to Simons and Toomre (2000) these membrane rafts “form distinct liquid‐
ordered phases in the lipid bilayer, dispersed in a liquid‐disordered matrix of unsaturated
glycerolipids”. Each of these detergent‐resistant domains (DRMs), as they are isolated
biochemically (Coskun and Simons, 2010), is unique on its own as a result of specific lipid‐
lipid, lipid‐protein as well as protein‐protein interactions. Thus, it is possible to actively
exclude and/or include proteins (Pike, 2004, 2009; Simons and Toomre, 2000) and certain
proteins have been found to preferentially associate into rafts. The best example would be
glycosyl‐phosphatidyl‐inositol (GPI)‐anchored proteins that are localized at the outer leaflet
(Chatterjee and Mayor, 2001). This anchor is a complex compound consisting of
phosphatidylinositol, sugar residues and a lipid part that bears an ether bond and is linked to
the protein (Mayor and Riezman, 2004). Also double‐acylated, palmitoylated or cholesterol‐
binding proteins have been shown in rafts (Chatterjee and Mayor, 2001; Levental et al., 2010;
Pike, 2004).
The functions of rafts are manifold, but most importantly, they serve as platforms to
cluster proteins for their interaction or initiation of subsequent signaling events (Brown and
London, 2000; Simons and Toomre, 2000; Thomas et al., 2004), to give rise to cell‐cell
interactions, trafficking and polarization (Bretscher and Munro, 1993; Brown and London,
1998; Mayor and Riezman, 2004; Rajendran and Simons, 2005).
Figure 2‐6. Raft model. Cholesterol and sphingolipid‐enriched domains are present in the
glycerophospholipid (GPL) membrane, bearing raft proteins and thus excluding non‐raft
proteins. (modified from Lingwood & Simons, 2010)
Introduction
12
In addition to their fundamental components sphingolipid and cholesterol, Pike and
colleagues could first show through electrospray ionization/mass spectometry (ESI/MS) that
rafts also contain a substantial amount of plasmalogens, members of the ether lipid class
(Pike et al., 2002).
2.3 Ether Lipids
These special glycerophospholipids differ in their sn1 position by having an ether bond
instead of an ester. Ether lipids can be divided into two groups, contingent upon the
substituents at the sn1 position: (1) alkylacyl (often used plasmanyl as prefix) and (2)
alkenylacyl (plasmenyl) glycerophospholipids. The alkylacyl species consist of the platelet‐
activating factor (PAF), seminolipids, and the lipid moiety of GPI‐anchors (Farooqui et al.,
2008; Kanzawa et al., 2009). The alkenylacyl class, also known as plasmalogens in mammals,
further differs slightly due to its vinyl ether bond (Figure 2‐7) at the sn1 position, which has
been found almost exclusively with 16:0, 18:0 and 18:1 fatty acids. The sn2 position normally
has a polyunsaturated fatty acid (PUFA) such as docosahexaenoic acid (DHA, ω‐3) or
arachidonic acid (AA, ω‐6), while the head group at sn3 can be either a conventional
phosphoethanolamine or phosphocholine (Nagan and Zoeller, 2001).
Although these lipids have been neglected for many years, they are of particular
importance, since they comprise 18% of the total phospholipid mass in humans. This value is
much higher in some tissues including brain, skeletal muscle, lymphocytes, macrophages and
heart (Nagan and Zoeller, 2001). Many functions have been found for plasmalogens that are
now being increasingly studied. They are thought to quickly respond to different
Figure 2‐7. Structure of a plasmalogen. Plasmalogens bear the typical double bond at their sn1
positions. R1 is either 16:0, 18:0 and 18:1, R2 either arachidonic acid or docosahexaenoic acid; the
sn3 position harbors the conventional head groups (phosphatidylcholine,
phosphatidylethanolamine). (modified from Wallner and Schmitz, 2011)
Introduction
environmental conditions due to their short half‐lives (Wallner and Schmitz, 2011), with 30
minutes for plasmenylcholine and about 3 hours for plasmenylethanolamine (Rintala et al.,
1999). Glaser and Gross could show that plasmenylethanolamine can increase the kinetics of
vesicle fusion (Glaser and Gross, 1994), while a plasmalogen‐deficient murine cell line has
been reported with a reduction in HDL‐mediated cholesterol efflux that could be restored to
control levels by treatment with a precursor substance (Mandel et al., 1998). This can be
explained by plasmalogens leading to a tighter packing of the membrane (Gorgas et al.,
2006), which could also be a prerequisite for a correct membrane trafficking (Thai et al.,
2001). Another function that was proposed for plasmalogens is to act as a storage depot for
PUFAs and thus, for second messengers, due to the possibility of arachidonic acid (AA) being
metabolized to such (prostaglandins etc.). Additionally, the double bond is thought to
protect against radicals (Farooqui and Horrocks, 2001). Moreover, plasmalogens are thought
to play a role in the process of myelination as they occur in high concentrations in myelin
(Gorgas et al., 2006).
Interestingly, plasmenyl ethanolamine was shown to be enriched in rafts of, for example,
KB cells2 (Pike et al., 2002) and also in detergent‐resistant membranes isolated from brain
myelin (Rodemer et al., 2003) as well as in plasma membrane fractions of T‐cells (Zech et al.,
2009). In our laboratory, it could be shown by sucrose gradient centrifugation that
plasmalogen deficiency specifically leads to alterations of raft proteins such as Flotillin (Flot)
and the GPI‐anchored protein Thy‐1, which shift to non‐raft fractions (Fabian Dorninger,
2011, Diploma Thesis). Thus, it is possible that these lipid species contribute to or even
enable rafts to accomplish the various functions described above, emphasizing their
importance for cell membranes.
2 epidermal carcinoma cells derived from Hela cells (ATCC: CCL‐17)
Introduction
14
2.3.1 Biosynthesis of Plasmalogens
The generation of plasmalogens is a multi‐step process involving the peroxisomes and the
ER membrane (Figure 2‐8). Long‐chain fatty alcohols and dihydroxyacetone phosphate
(DHAP) are the starting substrates. Peroxisomes offer an environment for the first two steps:
DHAP‐acyltransferase (DHAPAT) catalyzes the esterification of DHAP with an acyl‐CoA, which
is then converted into alkyl‐DHAP by alkyl‐DHAP‐synthase (ADHAPS). Thus, ADHAPS inserts
the typical ether bond by incorporating a long‐chain fatty alcohol, derived from the diet or
produced by the enzyme fatty acyl‐CoA reductase (FAR), at the sn1 position. The remaining
steps are then carried out at the cytosolic side of the ER, as is the case for diacylglycerol
biosynthesis: reduction to alkyl‐glycero‐3‐phosphate (alkyl‐G3P), which is converted to 1‐
alkyl‐2‐acyl‐G3P and finally 1‐alkyl‐2‐acyl‐glycerol that eventually obtains its head group via
the phosphotransferases (Brites et al., 2004; Nagan and Zoeller, 2001; Wallner and Schmitz,
2011).
It is clear that, to ensure a functional biosynthetic pathway, all respective enzymes have
to be present at their right places. Therefore, a functional transport system is required to
fulfill this task. For the enzymes at the ER membrane, this will not be discussed here, as
attachment to the ER is a common event for the cell and has been intensively studied
(Rapoport, 2007). However, the peroxisomal location of DHAPAT and ADHAPS is crucial for
their proper enzymatic activity and stability. Furthermore, co‐immunoprecipitation (CoIP)
revealed a heterotrimeric protein complex including a DHAPAT isomer in a different
conformation (Biermann et al., 1999). It is also known that proper activity of DHAPAT is
dependent upon this interaction (Nagan and Zoeller, 2001), which was also reflected as a
reduction in ADAPS‐deficient human skin fibroblasts (Thai et al., 2001). Thus, both enzymes
have to be imported into peroxisomes, for which they harbor a peroxisome targeting signal
(PTS): ADHAPS is a PTS2 cargo protein and DHAPAT carries a PTS1 sequence.
Introduction
15
2.3.2 Peroxisomes and the Peroxisomal Import
Peroxisomes are ubiquitous organelles surrounded by a single membrane. As described
above, peroxisomes are the site for the first two steps of ether lipid biosynthesis. However,
they are also responsible for a variety of metabolic reactions such as β‐oxidation of very
long‐chain fatty acids (VLCFA), fatty acid (FA) α‐oxidation, elongation of Fas and degradation
of amino acids as well as of hydrogen peroxide (Wanders and Waterham, 2006). Thus, also
various transporters have to be present in the membrane to make the import of the
substrates possible.
Figure 2‐8. Biosynthesis of alkenylacyl ether lipids. In the peroxisomal compartment, DHAP
originating from the glycolytic pathway is converted to acyl‐DHAP by the enzyme DHAPAT and
subsequently a long‐chain fatty alcohol is introduced by the synthase ADHAPS. The resulting
compound alkyl‐DHAP is a substrate for the reductase at the ER membrane and thus is exported
and used for the final synthesis of plasmalogens. DHAP = dihydroxyacetone phosphate; Far1 =
fatty acyl‐CoA reductase1; G3PDH = glyceraldehyde‐3‐phosphate dehydrogenase; DHAP‐AT =
DHAP acyltransferase; ADHAP‐S = alkyl‐DHAP phosphate synthase; AADHAP‐R = acyl/alkyl‐DHAP
reductase; AAG3P‐AT = acyl/alkyl‐glycero‐3‐phosphate‐acyltransferase; PH = phosphohydrolase;
C‐PT, E‐PT = choline or ethanolamine phosphotransferase; GPC, GPE = glycerophospho‐ choline
or ‐ ethanolamine, respectively. (modified from Wallner and Schmitz, 2011)
Introduction
16
For the biogenesis, the peroxisomal membrane is derived from the ER followed by the
peroxisomal membrane proteins (PMPs) being integrated through the specific Peroxin (Pex),
Pex19. Dysfunction of Pex proteins involved in this process can cause lethal peroxisomal
biogenesis disorders (PBD), such as the Zellweger syndrome, where no peroxisomes are
present.
The organelle is then completed when all the needed proteins are imported via the
existing soluble receptors PEX5 and PEX7, which recognize their respective PTS located in the
cargo proteins. PEX5 binds PTS1, a short peptide sequence (‐SKL or variants) at the C‐
terminal end, while Pex7 associates with the nonapeptide PTS2 near the N‐terminus.
The delivery is thought to be initiated by the binding of the PEX5 receptor to the PTS1
sequence of a protein in the cytosol (Figure 2‐9). This pair then associates to a docking
complex at the peroxisomal membrane to be integrated. Consequently, substrate release
occurs through the help of various Pex proteins. Finally, the receptor is either ubiquitinylated
for degradation or recycled back into the cytosol. For PEX7 and PTS2, the mechanism is
thought to be similar (Erdmann and Schliebs, 2005).
So far, these two receptors with the associated protein complexes seem to be the only
transport machineries responsible for translocating matrix proteins into the peroxisomes. Of
course, transporters for substrates that are needed for various metabolic pathways also
have to be considered. Thus, mutations in the respective PEX genes can lead to empty
organelles which are then called “ghosts”, consequently leading to non‐functional metabolic
pathways (Ma et al., 2011). Such a condition would be detrimental in humans but also single
peroxisomal enzyme deficiencies can lead to severe disorders such as X‐linked
Figure 2‐9. Peroxisomal matrix protein import. Transport of matrix proteins into the peroxisome
principally occurs in four steps: cytosolic receptor
Pex5 binds a PTS1‐carrying protein, directing it to the
peroxisomal membrane where docking to a complex
occurs followed by the release of the substrate to
the matrix and subsequently of the receptor back to
the cytosol. (modified from Erdmann and Schliebs, 2005)
Introduction
17
adrenoleukodystrophy with a deficient VLCFA transporter, Refsum disease where the
alanine:glyoxylate aminotransferase is mutated and rhizomelic chondrodysplasia punctata
(RCDP) that manifests through mutations in PEX7, DHAPAT or ADHAPS (Wanders and
Waterham, 2006). RCDP will be described in detail as it will be relevant for this manuscript.
2.4 Rhizomelic Chondrodysplasia Punctata (RCDP)
RCDP is a deleterious autosomal recessive peroxisomal disorder characterized by skeletal
abnormalities (shortening of the proximal bones, rhizomelia), mental retardation,
developmental delay, cataracts and facial dysmorphisms (Figure 2‐10), with a prevalence of
1 in 100,000 individuals (Stoll et al., 1989). Psychomotoric abilities are impaired and seizures
are common. Respiratory problems additionally impede the lives of the patients. However,
RCDP may also show up in milder forms (Steinberg et al., 2006). Around 60% of the affected
children survive the first year after birth (Shanske et al., 2007).
There are three types of RCDP: in the classical form (type 1) which is the most common
with more than 90%, the gene encoding for PEX7 is mutated (Braverman et al., 1997; Motley
et al., 1997; Purdue et al., 1997) while type 2 and 3 are caused by mutations in DHAPAT and
ADHAPS with less than 10% affected patients (de Vet et al., 1998; Itzkovitz et al., 2011; Thai
Figure 2‐10. Overview of phenotypes in RCDP. Depending on the affected gene, RCDP is
characterized into three types, manifesting itself in anomalies such as skeletal abnormalities,
mental retardation and cataracts.
Introduction
18
et al., 1997; Wanders et al., 1994). Although the progression of RCDP is quite similar in all
patients, there have been reports on cases with additional anomalies, especially such
regarding the heart.
2.4.1 Cases of RCDP associated with heart abnormalities
Cardiac complications described in RCDP cases are mostly congenital heart lesions.
Already Schönenberg and Schallock (Sastrowijoto et al., 1994) informed about RCDP cases
with cardiac abnormalities in 1953, but did not give any details. Through literature research
we found 47 RCDP case reports, of which 11 were described to be associated with congenital
heart lesions. The most common described phenotypes include the following:
1) Ventricular septal defect (VSD)
The wall (septum) which separates the ventricles from each other contains an opening,
leading to a transport of deoxygenated blood to the lungs. Fourie reported a case with a
large VSD resulting from the complete absence of the infundibular septum. The case report
of Pascolat described a specific VSD called “subaortic perimembranous intraventricular
communication” (see Table 2‐1).
2) Pulmonary atresia (PA) and pulmonary stenosis (PS)
While in PA the pulmonary valve is underdeveloped, it is defective in PS. In both cases,
blood partially cannot flow out to the lungs.
3) Tetralogy of Fallot (TOF)
A heart disorder commonly associated with RCDP is tetralogy of Fallot which consists of
four components: ventricular septal defect, pulmonary stenosis, an aorta that is directly
placed above the VSD (overriding aorta) and right ventricular hypertrophy (RVH) in which the
right ventricle thickens as a cause of the heart pumping harder due to the narrowed
pulmonary valve (Figure 2‐11).
Introduction
19
4) Atrial septal defects (ASD)
Atria are not completely restricted from each other through the septum and thus lead to
the same effect as VSD. Yalin and colleagues (2003) reported specific ASD types called
“patent foramen ovale”, a remnant of the fetal septal connection, which was also the case in
Dilli et al. and twice in Fourie’s literature review (Fourie, 1995). The patient in Pascolat’s case
showed a moderate interatrial communication along with repercussion (see Table 2‐1).
5) Patent ductus arteriosus (PDA)
Before birth, the pulmonary artery and the aorta have a small connection to each other,
allowing the blood of the mother to bypass the lungs. This connection is normally closed
after birth; if PDA is present, this event cannot occur.
Additional conditions are listed in Table 2‐1 that summarizes our literature findings. It is
noteworthy that some of these heart complications were also linked to the reduced levels of
a special protein, Connexin‐43 (Cx43), which will be covered in its own section.
Figure 2‐11. Pathologies in TOF compared to healthy heart. Deoxygenated blood is not able
to flow to the lungs due to closed or narrowed pulmonary valves, leading to a stronger
pumping of the right ventricle that will thicken itself. Additionaly, oxygen‐poor blood will mix
with oxygen‐richblood as a result of a ventricular septal defect and an aorta located between
the ventricles. (modified from my.clevelandclinic.org)
Normal TOF
Introduction
20
2.4.2 Mouse Models
Plasmalogen studies were also performed in several mouse models. The group of Wilhelm
Just was first to characterize the role of ether lipids by disrupting the Dhapat gene in mice,
of which about 40% died within 4‐6 weeks. Living homozygous mice displayed ocular
anomalies (Rodemer et al., 2003), besides an affected fertility in females and a complete
infertility in males due to spermatogenetic arrest. More detailed analyses revealed defects
including impaired CNS myelination with a reduction in myelin basic protein, migrational
delay of precursor granule cells and a decrease in the conduction velocity of axons in the
corpus callosum, a region connecting the two hemispheres and thus allowing their
coordination (Teigler et al., 2009). Additionally, the reduction of Cx43, a protein shown to be
present in rafts, has been documented by Rodemer et al. in cultured fibroblasts obtained
from these mice (Rodemer et al., 2003). Interestingly, skeletal abnormalities were not noted
in this mouse model. Behavioral studies recently performed by our group3 demonstrated
sensomotoric abnormalities in these mice, proportionally increasing with age. The animals
3 By Fabian Dorninger, 2011, diploma thesis
Year Publication Details
1994 Sastrowijoto et al. Abortion, DiGeorge anomaly
2002 Castro et al. AS
2003 Pascolat et al. subaortic perimembranous IVC with moderate repercussion and IAC
2003 Yalin et al. PFO, membranous VSD
2007 Figueiredo et al. Mild mid‐bibasal crepitation and absence of abdominal alterations
2008 Dilli et al. Aberrant intracardiac band, mild PS, PFO and PDA; fetal arrhythmia
2008 Kazemian et al. TOF
2010 Akgun et al. TOF
2010 Naher et al. Small membranous VSD
2010 Nimmo et al. TOF
2011 Oswald et al. Moderate to severe biventricular dysfunction and tricuspid regurgitation compatible with persistent pulmonary hypertension
Total 11 out of 47 RCDP cases
Table 2‐1. RCDP cases associated with heart complications.
AS, aortic stenosis; IVC, intraventricular communication; IAC, interatrial communication; PFO,
patent foramen ovale; VSD, ventricular septal defect; PS, pulmonary stenosis; PDA, patent ductus
arteriosus; TOF, tetralogy‐of‐Fallot
Introduction
21
also exhibited a clamping reflex with a poor performance on the balance beam and the
rotarod.
Mice lacking the peroxisomal transporter Pex7 have been reported to be severely
hypotonic at birth having a high mortality rate of 70% before weaning (Brites et al., 2003).
Surviving Pex7‐/‐ mice were infertile and displayed decreased motility along with cataracts.
Furthermore, endochondral ossification, which is one of the essential processes in the
skeletal development, was severely impaired. The authors proposed this characteristic to be
the origin of the skeletal hallmarks seen in patients. Additional investigations were
performed on coronal sections of the cortex of embryonic Pex7‐/‐ mice which revealed
defective neuronal migration. Consequently, authors suggested this to be due to deficient
ether lipids and VLCFA accumulation. Indeed, a later publication by the same group justified
this view through a mouse model deficient in both ether lipids and a transporter for VLCFAs,
indicating a possible modulatory role of plasmalogens in VLCFA‐induced pathology (Brites et
al., 2009). Despite all these findings, adult Pex7‐/‐ did not have elevated VLCFA levels, in
contrast to their high accumulation in RCDP type 1 patients.
A Pex7 hypomorphic mouse model was recently documented, as having a reduction in
Pex7 transcript levels to less than 5% of wildtype (Braverman et al., 2010) which
nevertheless caused moderate defects in the plasmalogen synthesis. The mice were fertile
and had a normal life span, however, their skeleton was smaller and cataracts were visible.
Braverman and colleagues suggested this model to reflect the milder RCDP phenotypes.
Very recently, an Adhaps mouse model has been described by Liegel et al., arising from a
hypomorphic point mutation that resulted in high levels of incomplete and unfunctional
transcript. Also here, a certain peri/prenatal lethality, infertility and cataracts were observed.
Remarkably, in these mice symptoms of hypotonia or delayed growth were missing, along
with a lack of defects in neuronal migration, bone development or myelination. The authors
supposed the reason to be the residual amounts in plasmalogen.
2.5 Connexins
Cells have different ways to communicate with each other, be it indirectly through signals
or in a direct way. The most direct communication is probably made possible by gap
junctions, used to coordinate cellular events in tissues in a most efficient way. Here, two
cells are connected to each other by a channel spanning from one to the other membrane,
Introduction
22
leaving a gap of about 2‐3 nm. This gap junction (GJ) is composed of two hemichannels
provided by each of the contacting cells. Such a hemichannel or connexon is a hexamer of
connexins, which have four transmembrane domains with one intracellular and two
extracellular loops, N‐ and C‐terminal ends being cytosolic (Figure 2‐12). Docking is possible
through the cystein residues in the extracellular loops (Martin and Evans, 2004).
connexins are a whole family of gap‐junctional proteins arising from 21 different Connexin
genes in humans that differ mainly in the carboxy‐terminal domain and are named according
to their molecular weight with the prefix “Cx” (Willecke et al., 2002). An alternative
nomenclature classifies the proteins according to their sequence similarity and the length of
the cytoplasmic loop, with α and β subgroups and the prefix “Gj”. Accordingly, Cx43 is Gjα1
or Gja1. Currently, the latter system is often used for the gene names, while the Cx
nomenclature is common for the protein (Harris and Locke, 2009).
One tissue or cell‐type can express many Connexin isoforms, making possible to have
homo‐ or hetero‐oligomeric connexons. However, it has been found that not all Connexins
are “compatible” with each other but generally within a subgroup (Segretain and Falk, 2004).
The oligomerization occurs already at the ER membrane for most of the connexins and,
after being transported to the plasma membrane, they can serve as functional units for ATP
uptake, NAD+ release, kinase activation and important cellular events such as apoptosis
(Goodenough and Paul, 2003), forming a non‐junctional pool of hemichannels. These
connexons can then group together and are able to dock to other connexons of an apposing
cell, yielding gap junction channels. Also here, it is possible to assemble with connexons of
Figure 2‐12. Connexins and gap junctions. A) Topological organization of a Connexin in the
membrane with its extracellular loops (E1 and E2) and 4 transmembrane domains (M); B)
Illustration of a gap junction plaque with the two cell membranes contributing connexons. E1, E2:
extracellular loop 1, 2; M1‐4: transmembrane domains 1‐4; ©: Cystein residues. (modified from Söhl and Willecke, 2004)
Introduction
23
either the same or different types, resulting in homo‐ or heterotypic channels which
determines the specific permeability of each channel (Figure 2‐13) (Segretain and Falk, 2004).
Further aggregation into tight clusters results in so‐called gap junction plaques. How
these stages are achieved has not been clarified yet, however, results from electron‐
microscopic and electro‐physiological studies indicated undocked connexons to group in a
loose manner and, after forming full intercellular channels, to aggregate. Additionally, new
channels can join the cluster, rendering the plaque to grow (Johnson et al., 1974). In contrast
to the last point, fluorescence recovery after photobleaching (FRAP) of transfected HeLa cells
suggested that not channels but new connexons enter the clusters at their outer margins
(Lauf et al., 2002). Also, it is not clear yet whether connexons dock first and then aggregate
or vice versa, along with the exact mechanism. Gap junction plaques are highly dynamic:
they can grow or shrink, probably reacting to changes in intercellular interaction (Jordan et
al., 1999; Lopez et al., 2001) resulting in a turnover of about 2 to 4 hours (Harris and Locke,
2009).
This docking establishes a direct and functional cell‐cell communication that is termed
"gap‐junctional intercellular communication" (GJIC), as the formed channel can convey
molecules of up to 1 kDa, including ions, ATP, cAMP and small metabolites such as glucose.
In addition to this metabolic coupling, gap junctions also relay electrical currents that are
fundamental for the electrical coupling of cardiomyocytes, interneurons and smooth muscle
cells (Harris and Locke, 2009; Kumar and Gilula, 1996). Furthermore, these structures can
Figure 2‐13. Differential assembly options of Connexins in hemichannels and gap junctions.
Connexins of the same isoform assemble into homomeric connexons, while heteromeric
hemichannels are composed of different Cx types. A further combination can happen with
different connexons resulting in heterotypic or same connexon types giving rise to homotypic
channels. (from Kumar and Gilula, 1996)
Introduction
24
open or close depending on signals such as voltage, pH, intracellular Ca2+ or phosphorylation
at their C‐terminal domains (Spray et al., 1984). Each Connexin isoform differs from the
other, thus leading to connexons and gap junctions to have unique conductive, gating and
permeability properties (Goldberg et al., 2004). (Naus and Laird, 2010)
As gap junctions are almost ubiquitously expressed and have been intensively studied
since their discovery, a variety of functions has been and is still being identified. By allowing
coordinated responses of tissues to external signals through metabolic cooperation to
maintain tissue homeostasis or through electrical propagation (Mese et al., 2007) they play a
role in essential cellular events such as proliferation, migration, differentiation and apoptosis
(Gilleron et al., 2009; Laird, 2006). Many publications could show that cell death can be
propagated to living cells, as shown in many cancer types like lung and brain cancer, which
display a reduced gap‐junctional coupling (reviewed in Naus and Laird, 2010). Gap junctions
have long been implicated in growth control, which was unambiguously shown with the help
of mice lacking specific connexins such as Cx43, leading to lung neoplasms (Cronier et al.,
2009).
2.6 The role of lipid rafts in gap junctions
It is obvious that gap junctions and especially the formation of gap junction plaques must
require a special lipid environment to allow such a tight aggregation. Hence, studies have
been performed to determine the lipid surroundings of gap junctions. Gap junction
preparations after detergent extraction displayed high amounts in sphingomyelin and
cholesterol compared with the remaining plasma membrane (Malewicz et al., 1990). When
applied exogenously, cholesterol increased gap junction assembly by de novo protein
translation (Meyer et al., 1990). Several connexins, including Cx43, have been shown by
immunofluorescence to colocalize with Caveolin‐1 (Cav‐1) at sites of cell‐cell contact,
indicating association with rafts in junctional areas. This was also confirmed by CoIP and raft
isolates obtained by sucrose density gradient after detergent extraction, revealing the
presence of Cx43 in DRMs and a possible interaction with Cav‐1 (Schubert et al., 2002).
However, it seems that not all connexins behave similarly: Cx26 was present in rafts only
with Cav‐1, while Cx50 was not found in rafts at all. Hesketh and coworkers also reported
the presence of Cx43 in raft isolates of canine heart (Hesketh et al., 2010). These and other
Introduction
25
strong findings point towards an association of Connexins with rafts (Figure 2‐14) (Defamie
and Mesnil, 2011).
2.7 Connexin‐43
One of the best studied representatives of the Connexin family is Cx43. This particular
Connexin shows widespread expression in lungs, developing skeleton and lens, vasculature,
the ear in low levels, reproductive systems of both male and female, secretory system, in
keratinocyte development and dermal fibroblasts of the skin, astrocytes in the nervous
system and the heart (Harris and Locke, 2009).
Cx43 is assembled into connexons and transported to the cell surface just like other
connexins, however, the oligomerization likely occurs after the ER, probably at the trans‐
golgi network (Das Sarma et al., 2002; Koval et al., 1997; Musil and Goodenough, 1993).
Another important feature of Cx43 is its hyperphosphorylation that gives rise to different
conformational states which are also visible as distinct bands after immunoblotting.
Particularly, some of the 21 serine and two threonine residues at the C‐terminal domain are
thought to be the main sites of modification (Martin and Evans, 2004). To date, at least two
different phospho‐specific isoforms have been reported (denoted as P1 and P2) along with
Figure 2‐14. Gap Junctions in lipid rafts. Membrane domains possibly offer a platform for gap
junction plaques due to the tight packing through cholesterol and sphingolipid‐enrichment. (modified from Defamie, 2011)
Introduction
26
the non and/or mildly phosphorylated form P0 (Figure 2‐15). This profile probably depends
on the cell type (Musil et al., 1990b).
Mainly serine residues are being phosphorylated by various kinases such as the mitogen‐
activated protein kinase (MAPK), protein kinase c (PKC) and PKA in inhibition of GJIC, the
casein kinases 1 and 2 (CK1 and 2) in gap junction assembly and even the cyclin‐dependent
kinase Cdc2 for regulation during the cell cycle. In addition, the tyrosine kinase Src has been
implicated in phosphorylation of Cx43 (Giepmans, 2004; Solan and Lampe, 2009).
Recently, Solan and Lampe could assign these phosphorylation states to some serine
residues in the life cycle of Cx43 by using both immunocytochemistry and western blot
analysis with phosphospecific antibodies in several cell lines (Solan and Lampe, 2007).
Although not totally similar in all used cell lines, their findings support previous reports that
generally the P2 isoform occurs exclusively in the Triton X‐100‐insoluble gap junction
plaques, while P1 may represent the state of being transported to or within the plasma
membrane (Figure 2‐16) and P0 to represent newly synthesized protein (Koval et al., 1997;
Musil et al., 1990a; Musil and Goodenough, 1991).
Figure 2‐15. Phospho‐specific isoforms of Connexin‐43 as detected by immunoblotting in
dermal fibroblasts. Hyperphosphorylation of Cx43 results in characteristic bands in immunoblots,
termed P0 to P2. These bands are caused by conformational isoforms with different
electrophoretic mobilities. (from doctoral thesis of Jared M Churko , 2011 – modified for illustration purposes) (Churko et al., 2011)
Introduction
27
Mutations in the gene coding for Connexin‐43 (GJA1) in humans have recently been found
to be the genetic defect in the very rare pleiotropic, congenital and autosomal dominant
disorder Oculodentodigital dysplasia (ODDD) which causes craniofacial anomalies, eye
problems including cataracts, abnormal dentition, syndactyly or other malformations in
hands or feet with further skeletal abnormalities as well as conductive hearing loss and
neurologic symptoms such as ataxia and seizures, often accompanied by a mild mental
retardation (Paznekas et al., 2003). Anomalies in skin, hair and nails are also common. The
incidence is thought to be in the range of one in ten‐million individuals (Loddenkemper et al.,
2002). In 3% of cases, congenital heart diseases have been recorded that include ASD, VSD,
PS and right bundle branch block. However, also ODDD cases without any mutations have
been reported (Paznekas et al., 2003; Paznekas et al., 2009).
Figure 2‐16. Model depicting phosphorylation states in the Connexin life cycle. Certain serine
residues are phosphorylated at different time points in the course of Cx43 trafficking to achieve
distinct conformational states, as shown in the inset immunoblot image. (modified from Solan and Lampe, 2007)
Introduction
28
2.7.1 The role of Cx43 in cardiac function
It is well known that the contraction of the heart is facilitated by gap junctions conveying
electrical signals. Cx43 is the dominating gap‐junctional protein expressed by
cardiomyocytes in ventricles and atria, together with Cx40 in the latter chambers (Figure
2‐17A). Also the intrinsic conduction system where the electrical impulses are generated and
conveyed to allow a coordinated contraction contains Cx43, mainly in the branches that
submit the currents to the right and left ventricles. On the cellular level, it is responsible for
the electrical conduction from cell to cell by being confined to the intercalated discs, special
connections allowing for a synchronized contraction of the cardiac tissue (Figure 2‐17B).
Thus, Cx43 is essential for the proper functioning of the heart (Severs et al., 2008).
Interestingly, although mutations in GJA1 were later attributed to cause ODDD (see
above), heart phenotypes arising from mutant Cx43 have been reported. Six children with
visceroatrial heterotaxia (defect in establishing the left‐right asymmetry) had mutations in
the C‐terminal domain, five of which had a Ser364Pro mutation that is the phosphorylation
site attributed to lead to P1 (Britz‐Cunningham et al., 1995). Furthermore, eight hypoplastic
left heart (HLH) patients were also found to have mutations in GJA1, which were close to the
serine phosphorylation site S368 (Dasgupta et al., 2001) that has been associated with P2
and decreased dye transfer when phosphorylated (Lampe and Lau, 2000).
Figure 2‐17. Connexins in the heart. A) Overview of the Connexin expression pattern in adult
mammalian heart. B) Immunocytochemical labeling of Cx43 in longitudinal sections of human left
ventricle samples. Cx43 is concentrated at sites of intercalated discs (arrow) to allow a directional
flow of currents. (from Severs et al., 2008; Kostin et al., 2004)
Introduction
29
Thus, it is well accepted that Cx43 is associated with heart abnormalities, mostly in the
form of arrhythmias, rather in a functional context by changes in distribution and protein
levels. Immunohistochemical studies in ventricular samples of ischemic patients and patients
affected with aortic stenosis revealed a reduction in gap junction surface area per unit
volume of about 40% compared to control heart tissues (Peters et al., 1993). This finding was
roughly confirmed in ischemic and dilated cardiomyopathy human hearts (Dupont et al.,
2001). Interestingly, Kostin and colleagues could show an initial increase of 44% in Cx43
protein levels relative to controls followed, by a decrease with the hypertrophy stage,
categorized according to the ejection fraction (Kostin et al., 2004). In the advanced stage, the
reduction was accompanied by regions of low Cx43 signal whereas in the stage of Cx43
increase, an additional localization at the lateral membrane of the cardiomyocytes was
detected, a finding also reported in tetralogy of Fallot‐patients (Kolcz et al., 2005).
Heterogenous expression of Cx43 was also observed in patients with congestive heart failure
and ventricular arrhythmia who had a decreased ejection fraction upon electrocardiographic
assessment (Boulaksil et al., 2010). These data corroborate findings in rat hypertension
models (Haefliger and Meda, 2000) and canine model of heart failure, where also Cx43
interaction with ZO‐1 at intercalated discs were disrupted and changes in phosphorylation
states were indicated (Hesketh et al., 2010; Poelzing and Rosenbaum, 2004). In another
canine study, infarct size was significantly reduced when hearts were pre‐treated with the
gap‐junction uncoupler substance heptanol before conditioning for ischemia, indicating the
propagation of signals through gap junctions (Saltman et al., 2002). In contrast, mice
engrafted with embryonic cardiomyocytes have been reported to be less vulnerable to post‐
infarct arrhythmias (Roell et al., 2007) implying that Cx43 might have a function that varies
depending on the species. Left‐right asymmetry was also found in Xenopus studies with
abnormally expressed Cx43 were also documented (Levin and Mercola, 1998).
Reaume and coworkers established the first targeted deletion of the Gja1 gene in mice
most of which could be born without complications, implying a backup for the function of
Cx43 in murine development (Reaume et al., 1995). However, the pups died already after 5
hours due to obstructions in the right ventricular outflow tract of the heart. Nevertheless,
cardiac‐restricted Cx43 inactivation prolonged their lifespan by 2 months after which
spontaneous ventricular arrhythmias and subsequent cardiac death occurred in all animals
(Gutstein et al., 2001a). Chimeric mice generated by Cx43‐deficient embryonic stem cells
Introduction
30
were shown to have reduced fractional shortening (Gutstein et al., 2001b) and Cx43+/‐
heterozygote mice revealed a reduction in the ventricular conduction velocity by 38%
compared to wildtypes whereas the same parameter of the atrium was not affected at all. In
the atria, Cx40 is additionally expressed, suggesting that this protein can prevent the
emergence of phenotypes in these chambers (Thomas et al., 1998). Therefore, Cx43 is
indeed a very important component for the cardiac tissue.
31
3 AIM OF THE STUDY
The aim of the thesis was to clarify whether Connexin‐43 is altered under conditions of
ether lipid deficiency.
Thus, by using immunoblot and immunofluorescence techniques on ether lipid‐deficient
mice and human primary fibroblasts of a patient with rhizomelic chondrodysplasia punctata,
we wanted to answer following questions:
1) Is there a difference in Cx43 protein amounts and phosphorylation states in ether
lipid‐deficient cells compared to normal cells?
2) Are confluency conditions able to influence the expression levels of this protein and,
if so, does the loss of ether lipids change this response?
3) Does the subcellular localization of Cx43 in ether lipid‐deficient cells differ from that
of normal cells?
4) Does Cx43 differ in its presence in raft isolates when ether lipids are not present?
5) Are alterations in Cx43 protein amounts induced in mouse hearts lacking ether lipids?
32
4 MATERIALS AND METHODS
Materials
Cell Culture
Complete Medium
Human primary fibroblasts: RPMI‐1640 (Lonza)
Mouse fibroblasts: DMEM (Lonza)
Both supplemented with 10% heat‐inactivated fetal‐
bovine serum, 1% Penicilline‐Streptomycine, 2 mM L‐
Glutamine and 0.5% Fungizone
PBS Without Mg2+ and Ca2+, sterile, Lonza
Trypsin 0.25% Lonza
BA (DL‐Batyl alcohol)
HDG (Hexadecyl‐sn‐gylcerol)
Working concentration: 20 µM
stock solution of 20mM in EtOH abs. was diluted into
complete medium
Batyl Alcohol – Sigma Aldrich (B402)
1‐o‐Hexadecyl‐sn‐glycerol – Santa Cruz (202394)
PCR
Materials for PCR
GoTaq Pol and 5x GoTaq Buffer – Promega
dNTPs – Peqlab
Oligonucleotides custom‐made by Eurofins MWG
Operon
1x TAE‐Buffer
40mM Tris‐Acetate, 1mM EDTA
pH 8.0
Primers OLI 1626: 5’‐GATACCTACTTTGTCCCAATTAGC‐3’
OLI 1627: 5’‐GCTGGTCTCAAACAGCTACGTAGCTGA‐3’
OLI 1628: 5’‐CGCATCGCCTTCTATCGCCTTCTTG‐3’
Materials and Methods
33
Lysis/Homogenization
RIPA‐Buffer
50mM Tris, 150mM NaCl,
1mM EDTA, 1mM EGTA
1% NP40, 1% Sodium deoxycholic acid, 0.1% SDS
pH 7.5
Lysis Buffer
RIPA containing 1x protease inhibitor cocktail and
phosphatase inhibitors (2mM Na3VO4, 14mM NaF)
In case of hearts, additional ATP (final conc 2mM) was
added.
Protease inhibitor cocktail
(PI)
Complete protease inhibitor tablets (Roche). One
tablet was dissolved in 2ml dH2O to yield a 25x stock
solution which was either used directly or frozen for
later use.
Phosphatase inhibitors
Sodium orthovanadate (Na3VO4), an inhibitor of Tyr‐
phosphatases, was prepared as a 100mM stock
solution (storage at room temperature)
Sodium fluoride (NaF, inhibitor of Ser/Thr‐
Phosphatases) was prepared as 700mM aliquots and
stored at ‐20 °C.
DRM isolation
5xTNE
250 mM Tris‐HCl, 750 mM NaCl, 10 mM EDTA
pH 7.4
Sucrose solutions
(56%, 35%, 5% w/v) All prepared in 1xTNE
2%Triton/TNE‐PI 2% Triton X‐100 in 1xTNE supplied with Protease‐
inhibitor cocktail
SDS‐PAGE/Immunoblotting
4x Loading buffer 250 mM (w/v) Tris‐Cl (pH 6.8), 40% (v/v) Glycerin, 20%
(v/v) β‐Mercaptoethanol, 8% (w/v) SDS, 0.008% (w/v)
34
Bromophenol blue
10x Electrophoresis Buffer 250 mM Tris‐Cl, 1.92 mM Glycine, 1% SDS
Transfer Buffer
48 mM Tris‐Cl, 39 mM Glycine
0.0375% SDS, 20% Methanol
5xTBST
749.5 mM NaCl, 124.7 mM Tris, 0.0025% (v/v) Tween
pH adjusted to 7.5, then 2.5ml Tween added
5x Stripping Buffer 2.5M NaCl, 1 M Glycine, pH 2.5
Marker
PageRuler Prestained Protein Ladder
(Fermentas #26616)
Antibody dilutions
Primary antibodies 1:25,000 in 2% BSA/TBST
Secondary antibodies 1:40,000 in TBST
Miscellaneous
Immobilon™ Western Chemiluminescent Substrate
(Millipore)
Protran® Nitrocellulose Transfer Membrane and
Whatman Filter Papers (3mm, Whatman)
Immunocytochemistry
10x PBS
101 mM Na2HPO4, 27mM KCl, , 18mM KH2HPO4, 1.4M
NaCl; pH 7.4 adjusted with NaOH
autoclaved before use
Blocking Buffer 10% FBS and 1% BSA, in 1xPBS
Geltol
24mM Tris‐Cl (pH 8.5), 6% Glycerine, 2.4% (v/v)
Mowiol; mixed at 50 °C for 10 minutes and centrifuged
at 5,000 g for 15 minutes
Antibodies
α‐Connexin‐43, polyclonal, rabbit (Abcam, Cat# 11370)
α‐Transferrin Receptor, monoclonal, mouse (Zymed)
α‐Actin – monoclonal, mouse (Chemicon)
α‐rabbit – Cy2‐conjugated, donkey (Jackson IR)
α‐mouse – Cy3‐conjugated, goat (Jackson IR)
Materials and Methods
35
Chemicals
Standard chemicals were purchased from Merck or Sigma‐Aldrich.
Acrylamide 4x
BisacrylamideGerbu Biochemicals
Bovine Serum Albumin (BSA)
Ethylene glycol tetraacetic acid (EGTA)
Gelatine from porcine skin type A
Sodium dodecyl sulfate (SDS)
Sucrose
Sigma‐Aldrich
Etylene diamine tetraacetic acid (EDTA)
β‐MercaptoethanolAppliChem
Ethidiumbromide BioRad
Formaldehyde, 37%
Sodium deoxycholate
N,N,N’,N’‐Tetramethylethylendiamine (TEMED)
Tris‐hydroxymethyl‐aminomethane (Tris)
Tween®20
Merck
Mowiol Carl Roth
NP‐40 Calbiochem
Ponceau S Fluka
Triton®X‐100 Promega
DAPI (Cat# 10236276001) Roche
36
Equipment
Tool Company
Cell Culture Incubators Heraeus
Cell Culture Lamina Sterile VBH Compact
Centrifuges Eppendorf 5415D, 5415R
Refrigerated Centrifuge 2K15, 4K15 (Sigma)
Electrophoresis Power Supply E425, Consort
Fluor‐S‐MaxImager BioRad
Gel Doc™ 2000 BioRad
IX71 Inverse Fluorescence Microscope Olympus
Mini‐PROTEAN® 3 Electrophoresis System BioRad
MyCycler™ Thermal Cycler BioRad
Optima™ LE‐80k Ultracentrifuge Beckman
PHM92 Lab pH Meter Radiometer Analytical
Polytron rotor PT‐3100
PowerPac™ 3000 Power Supply BioRad
Spectrophotometer Hitachi U‐2001
Thermomixer comfort Eppendorf
Transfer Cell Trans‐Blot® Semi‐dry Electrophoretic Transfer Cell (BioRad)
Ultracentrifuge tube Ultra‐Clear Tube 14x95 mm (Beckman)
Vortex‐Genie™ Scientific Industries
Water Bath GFL Water Bath No. 1003
Cell lines
All cell lines were available in the laboratory at the beginning of the study. The human
RCDP primary fibroblast cell line was originally provided by Prof. Dr. Nancy Braverman
(Children’s Hospital Research Institute, McGill University, Montreal) while controls were
obtained from the general hospital of Vienna (AKH). Studies involving primary human
fibroblasts were already approved by the Ethical Review Board of the Medical University of
Vienna (App# 729/2010).
The human RCDP primary fibroblast cell line was derived from a patient bearing a
deletion of a single base pair in DHAPAT (c.1428delC/1428delC), leading to a premature stop
codon and probably nonsense‐mediated decay of the transcript (Nimmo et al., 2010). Mass
spectrometric analyses done in our lab (Fabian Dorninger, 2011, Diploma Thesis) in
Materials and Methods
37
collaboration with Alexander Brodde and Britta Brügger (University of Heidelberg) revealed
very low plasmalogen amounts in these cells (less than 2%).
All cell lines were cultured in appropriate dishes (10cm) at 37 °C with 5% CO2. Plates were
split (1:2‐1:20) by incubation with 0.25% (v/v) trypsin at 37 °C for 5‐40 min (depending on
cell line) after washing with PBS. Complete medium was used to inactivate trypsin and
distribute cells onto additional plates. For analysis, cells at passages 4 to 30 were used.
Treatments with ether lipid precursors BA and HDG were done at a working
concentration of 20 µM in complete medium for three consecutive days, with new medium
added every 24 hours. On the fourth day, cells were harvested for analysis.
Mice
Dhapat‐deficient mice (outbred C57/Bl6 x CD1) were available and originally provided by
the laboratory of Wilhelm Just (Heidelberg University), where they have been breeded
(Rodemer et al., 2003). All animals received human care according to the “Principles of
Laboratory Animal Care” (National Society for Medical Research) and the “Guide for the Care
and Use of Laboratory Animals” (National Academy of Sciences) (NIH Publication No. 86‐23,
revised 1985).
The animals were housed at the animal facility of the Medical University of Vienna in a
temperature‐ and humidity‐regulated environment with 12:12 hour light‐dark cycle and
constant acoustic background. Standard mouse chow and water was supplied ad libitum.
Methods
Genotyping
DNA was isolated from cells in culture (up to 106) by using the “Blood and Tissue Kit” (Qiagen)
according to the manufacturer’s protocol. PCR was done by amplifying exon 7 of the wild
type Dhapat gene (primers OLI1626, 1627), and the neomycin cassette‐DHAPAT junction of
the DHAPAT knockout allele (OLI1627, 1628). PCR products were either loaded directly onto
a Agarose gel or stored at 4 °C until further analysis.
38
Agarose gels were made in TAE buffer by boiling for about 3‐5 minutes until fully dissolved.
After cooling to ~60 °C, ethidium bromide was added to a final concentration of 0.5µg/ml
and the solution poured into appropriate trays with combs. The solidified gel was put into a
chamber filled up with TAE buffer and, after loading the samples next to a size marker, run
at 90 V (const.) for one hour. DNA bands were visualized through UV‐light using a GelDoc
2000 (BioRad) with its own software.
Cell Lysis and Isolation of Proteins
Cells were grown to around 100% confluency prior to lysis. After washing once with PBS
and addition of cold lysis buffer (0.7 ‐ 1 ml), dishes were scraped off on ice with a rubber
policeman into tubes and frozen. On the following day, the thawed lysates were passed
through 25‐ and 27‐gauge needles 3 times each to disrupt cellular membranes and
incubated on ice for 20 minutes. Eventually, centrifugation at 16,100 g at 4 °C for 20 minutes
ensured pelleting of DNA and lipids. The supernatants containing proteins were collected
and either frozen at ‐20 °C or further used for concentration measurements.
Tissue homogenization
Wildtype and Dhapat‐deficient fetal mice at embryonic day 18.5 and adult mice at 16.5
months were sacrificed using CO2 inhalation and tissues dissected, being immediately shock‐
frozen in liquid nitrogen and stored at ‐20 °C until use.
For homogenization, frozen tissues were thawed and weighed. Heart homogenates were
achieved with 10 vol lysis buffer (containing 2mM ATP) using a rotor. Homogenates were
incubated on ice for 20 minutes before centrifugation at 4 °C for 20min at 16,100 g.
Supernatants were collected and either frozen at ‐20 °C or used further for concentration
measurement.
Mastermix (MM) per sample
4.0 µl 5x GoTaq Buffer0.4 µl 10mM dNTPs1.0 µl OLI16261.0 µl OLI16271.0 µl OLI162811.5 µl H2O 0.1 µl GoTaq Pol1 µl DNA
PCR program
94 °C 1 min
94 °C 20 sec 35x 60 °C 20 sec
72 °C 50 sec
72 °C 7 min 4 °C
Materials and Methods
39
Isolation of Detergent‐Resistant Membranes
The method by Lingwood & Simons was used to isolate DRMs from cells (Lingwood and
Simons, 2007). Briefly, around 20 culture dishes (approximately 20x 5*106) were washed
with cold PBS once and lysed on ice by scraping in cold 1x TNE buffer supplemented with
protease inhibitors (TNE‐PI). The lysate was transferred into a tube and centrifuged at 400 g
at 4 °C for 5 minutes, followed by resuspension of the pellet in 550 µl TNE‐PI. After
subsequent homogenization steps with 25g and 27g needles (25 strokes each), 2%
Triton/TNE‐PI was added to 500 µl homogenate and mixed. After incubation for 30 min on
ice, the sucrose gradient was prepared in an ultracentrifuge tube by combining the whole
mixture with 2 ml of 56% sucrose at the bottom of an ultracentrifuge tube (yielding 40%
sucrose). Further sucrose solutions (35% and 5%) were layered on top (to cover the solution).
A final centrifugation at 271,000 g at 4 °C for 18 hrs allowed separation of DRM fractions that
were collected in 1 ml aliquots and analyzed by immunoblotting for raft markers.
Protein concentration measurement
The amount of protein contained in each lysate or homogenate was determined in
triplicates by using the Bradford Assay (BioRad). Briefly, a 1:4 dilution of Bradford reagent
was prepared and used with 200 µl total volume of a mixture of water and either sample or
BSA of known concentrations for the standard curve and buffer as blank.
Protein standards were prepared with different BSA amounts (like 0, 2, 3, 4, 5 µg) out of a
stock (0.5 µg/µl) into plastic cuvettes. After adding buffer (amount depending on sample
volume to be used in the measurements), the mixtures were filled up with water to a total
volume of 200 µl and incubated for 8‐10 minutes with 800 µl of the prediluted Bradford
reagent (time was equal in one series of measurements) prior to measuring absorbance at
595nm in a spectrophotometer. In order to stay within an appropriate detection range
(absorption values 0.2 to 0.5), dilutions of the samples were prepared accordingly. The data
was analyzed using the Excel program to plot a standard curve and calculate the amount of
protein and concentration in each sample.
Western Blotting
SDS‐Polyacrylamide Gel Electrophoresis. For a clear separation of Connexin‐43, two 9%
polyacrylamide gels with a gel thickness of 0.75 or 1.5mm were prepared (30% wt/vol
acrylamide, 0.8% bisacrylamide) in an electrophoretic chamber of the Miniprotean® 3
40
system (BioRad). Loading buffer was added to each sample and heated for 10 minutes at
85 °C (tissue homogenates were treated at 95 °C). After pelleting at 12,000 g for 10 minutes,
the supernatant of the samples and molecular weight marker were loaded onto gels and run
at 60 mA (250 V) for about 1 hour.
Semi‐Dry Transfer and Blocking. Proteins were transferred onto a nitrocellulose membrane.
Therefore, the membrane was sandwiched with the gel on top between 6 Whatman papers
(3 on top, 3 below), all equilibrated in transfer buffer and eventually transferred at 260 mA
(25 V max) for 25 to 27 minutes in a semi‐dry blot transfer chamber. Membranes were
washed with distilled water and transfer quality monitored by staining with Ponceau which
was subsequently washed off with TBST. Blocking was done with 4% (w/v) non‐fat dried
milk/TBST twice in total of 1 hour.
Primary and Secondary Antibody incubations. After blocking, the membranes were washed
3x with TBST prior to addition of the primary antibody dilution o/n at 4 °C. On the next day,
membranes were washed and incubated at RT with the according secondary antibody.
Specificity was confirmed for each antibody.
Detection. Enhanced chemiluminescence (ECL) substrate was prepared (1:1 mixture of
Peroxide and Luminol reagents) enough to cover the membrane with which they were
incubated by shaking for 2 minutes in boxes. Membranes were put between two layers of
plastic foil to maintain wetness and developed in a BioRad Fluor‐S MAX MultiImager. The
software Quantity One (BioRad) allowed to detect bands and acquire images. Parameters
were adjusted to “Ultrasensitivity Chemiluminiscence” with an Imaging Area of 32x32 cm
and Normal Dark Subtraction.
Stripping. For detection of further proteins on the same membrane, stripping buffer was
added for 3x10min before incubation with the new primary antibody o/n.
Densitometric Analysis. In SDS‐PAGE, Cx43 migrates in at least three isoforms (see according
chapter in the introduction); one mildly phosphorylated that is detected around 43 kDa and
two phospho‐isoforms at 45 and 48 kDa, respectively. In our case, the two phosphorylated
forms were not clearly separated (cf. Figure 5‐1), which was the reason for us to quantify
and illustrate them as one in our figures.
Pixel intensities of each band on the membrane were obtained using the Volume
Rectangle Tool in Quantity One® (BioRad). Briefly, each band was enclosed with a rectangle
Materials and Methods
41
of an appropriate size. Two copies of each rectangle were placed in the lane above and
below the rectangle to obtain the background intensity for each band. The data containing
the total intensities within each rectangle (“volume”) and the area of the rectangle were
exported for analysis into Microsoft Office Excel where the background values were
subtracted from the corresponding intensity of the bands. This was done for both Cx43 and
β‐actin (loading control). The value of Cx43 was divided by the one of β‐actin to normalize,
and the results were plotted in diagrams.
Immunocytochemistry
Cells were seeded in 6‐well plates containing coverslips and cultivated to needed
densities. For staining, following steps were performed (each followed by washes with PBS
3x for 5 minutes):
Fixation. Coverslips were washed with PBS and fixed with 3.7% formaldehyde in PBS for 15
minutes at room temperature.
Permeabilization. To make the cytosol accessible for the antibodies, the fixed cells on
coverslips were incubated with 2 ml 0.5% Triton X‐100 in PBS for 5 minutes.
Blocking. Each coverslip was placed upside‐down on 90 µl of blocking buffer on parafilm,
prepared in a humid glass chamber and incubated for 90 minutes at room temperature.
Primary and Secondary Antibody incubations. Primary antibodies were diluted 1:1000 in PBS
containing 10% FBS and used to incubate coverslips for 2 hours at room temperature.
Incubation with secondary antibodies (1:400 in 10% FBS/PBS) was done overnight at 4 °C in
dark. Next day, coverslips were incubated with DAPI to visualize nuclei and finally mounted
in Geltol onto labeled glass slides which were dried in the dark at room temperature for a
couple of days. Slides were stored in the dark at 4°C.
Microscopy. Images of the stained cells were obtained with a Fluorescence Microscope
through a 20x objective using the software M^cell (Olympus) and imported to Photoshop
(Adobe) for subsequent analysis.
Statistical analysis
Statistical significance was determined using two‐tailed student’s t‐test assuming equal
variance of the two samples. Error Bars represent standard deviation (s.d.).
42
5 RESULTS
5.1 Cx43 from dermal fibroblasts is detected as several bands in immunoblot
analysis
As mentioned before, Connexin‐43 is phosphorylated on serine residues in its C‐terminal
domain which leads to conformational changes and gives rise to phospho‐isoforms migrating
differently in SDS‐Polyacrylamide gel electrophoresis (PAGE). In our gel system, we could
detect two bands in total homogenates of human primary fibroblasts with the commercial
antibody recognizing total Cx43 (Figure 5‐1). We defined the lower bands migrating at 43
kDa as P0 and the upper, diffuse band probably represents P1 and P2 migrating together.
Therefore, this denotation was used in all figures of the present thesis showing such blots.
5.2 Amount of expressed Connexin‐43 depends on the cell confluency
Cx43 is a protein facilitating intercellular communication and for this reason cells are
connected with each other in a huge network in tissues of living organisms. In culture, these
conditions can vary by the density of the cells. Hence, we wanted to elucidate the
relationship between Cx43 expression levels and the confluency of the cells by culturing
human control fibroblasts at different densities. Low densities represent single cells with no
contact to each other, whereas at high densities cells were growing onto each other, leaving
almost no free space in the plate and thus resulting in many contacts. We analyzed three
independent lysates of one control cell line by immunoblot analysis and could observe a
density‐dependent expression pattern. According to the densitometric analysis of the signal
intensities and normalization to the β‐actin levels (Figure 5‐2), the upper band reflecting P1
and P2 was about 10‐fold more intense in high‐density cultures than in low‐density ones.
Figure 5‐1. In western blot analysis Connexin‐43 migrates as at least two isoforms. Detection of
Cx43 in total lysates of human primary fibroblasts of a healthy control with an antibody raised
against the amino acids 362‐382 of human protein, as seen in our gel system. P0 migrated as a
distinct band at around 43 kDa while P1 and P2 migrated together at approximately 45 kDa.
P1+P2
P0
Cx43
43
Although also statistically significant in the low‐density cultures, the difference in P0
representing unphosphorylated, intracellular Cx43, was much lower (less than 2‐fold).
5.3 Human primary fibroblasts deficient in ether lipids show a clear
reduction in Cx43
As the expression of Cx43 was upregulated in cells cultured at high densities, we collected
total protein isolates of control and DHAPAT‐deficient human primary fibroblasts cultured at
high densities in triplicates and loaded these next to each other. Our results showed a
striking quantitative difference in P1 and P2 in the mutant cell line with a statistically
significant reduction of mean value (p<0.05) in comparison with that of the control (Figure
5‐3). In contrast, the amount of newly synthesized Cx43 (P0 band) was not substantially
altered by cell density.
Figure 5‐2. Connexin‐43 expression is dependent on the cell confluency. (A) Immunoblot
analysis of Cx43 in 2.5 µg total lysates of primary human fibroblasts harvested at high and low
densities as indicated. (B) Quantification of the signal intensities of P0 and P1+P2 after
normalization to β‐actin is shown as mean value ±s.d. * p<0.05; *** p<0.001; n=3/group
44
5.4 In ether‐lipid deficient cells Cx43 expression is not increased upon
confluency
We were curious about the density response in the ether lipid‐deficient cells and
performed the same analysis to determine whether a similar relationship exists as in control.
(Figure 5‐4). The difference between Cx43 levels at low and high densities was not present in
the mutant cells. In comparison with control cells, the phospho‐isoforms were significantly
lower in DHAPAT‐deficient cells. P0, in contrast, showed no statistically significant
differences between mutant and control cells, or between high‐ and low‐densitiy culture
conditions.
Figure 5‐3. Connexin‐43 amounts in dense control and DHAPAT‐deficient human primary
fibroblasts. (A) Immunoblot analysis of Cx43 isoforms in 10 µg total protein isolates from
DHAPAT‐deficient and control fibroblasts. (B) Signal intensities of P0 and P1+P2 after
normalization to β‐actin plotted as mean value ±s.d. * p<0.05; n=3/group
Results
45
5.5 Three‐day‐treatment with ether lipid precursors is not sufficient to
restore Cx43 levels
Based on the findings that cells lacking ether lipids had a significant reduction in Cx43
levels and did not exert the same confluency‐dependent response as controls, we asked
whether this alteration was a direct cause of plasmalogen deficiency and, hence, might be
restored by addition of precursor substances into the culture medium. Data from previous
lipid profile studies performed in our laboratory (Fabian Dorninger, Diploma Thesis) in
collaboration with Alexander Brodde and Britta Brügger (University of Heidelberg) showed
that in cultured fibroblasts derived from a patient affected by mild RCDP, the levels of
plasmenyl‐ethanolamine were increased to control values after three days of treatment with
batyl alcohol (BA) or hexadecylglycerol (HDG). Thus, we treated the DHAPAT‐deficient
fibroblasts (derived from a severe RCDP patient) with both plasmalogen precursor
substances for three consecutive days to finally obtain lysates and determine the amounts of
the various Cx43 isoforms by immunoblot analysis.
Figure 5‐4. Connexin‐43 amounts in confluent and non‐confluent control and DHAPAT cells.
(A) Analysis of Cx43 in 2.5 µg total protein lysates of both control and ether‐lipid deficient
human fibroblasts by Western Blot and its (B) quantification after normalization to β‐actin
with mean value ±s.d. * p<0.05; *** p<0.001; n=3/group
46
Our findings are shown in Figure 5‐5 for two different lysates each for untreated, ethanol‐
and BA‐treated cells. Quantification by densitometric analysis showed that the amount of
Cx43 protein was not restored or markedly affected after treatment with batyl alcohol for
three days. We also tried to supplement with hexadecylglycerol in the very same cell lines,
however, also this treatment was insufficient (Figure 5‐6).
Figure 5‐5. Immunoblot of normal and DHAPAT‐deficient human fibroblasts after treatment with
batyl alcohol. (A) Cx43 in 10 µg total protein isolates of control and mutant cells after being treated
for three consecutive days with 20 µM batyl alcohol (BA), ethanol (EtOH) or medium (Ctrl). Two
independent cultures were analyzed for each condition. (B) Densitometric analysis of the signal
intensities after normalizing to β‐actin.
Figure 5‐6. Immunoblot of normal and DHAPAT‐deficient human fibroblasts after treatment
with hexadecylglycerol. (A) Cx43 in 10 µg total protein isolates of control and mutant cells after
being treated for three consecutive days with 20 µM hexadecylglycerol (HDG), ethanol (EtOH) or
medium (Ctrl). Two independent cultures were analyzed for each condition. (B) Signal intensities
were normalized to β‐actin and plotted in bars.
Results
47
5.6 Cx43 is concentrated at sites of cell‐cell contact
As it is thought that gap junction plaques arise through the support of lipid rafts, we set
out to investigate the subcellular localization of the gap‐junctional protein Cx43. Thus, we
first looked by direct immunofluorescence microscopy in control primary fibroblasts cultured
at high densities and stained for Cx43 and in parallel double stained for the transferrin
receptor (TfR) to visualize the membrane boundaries (Figure 5‐7).
Cx43 immunofluorescence clearly showed a typical membrane‐staining and was more
concentrated in areas of the membrane where the cell contacted another cell. Importantly,
in these areas Cx43 frequently showed strong extended stretches of fluorescence, probably
arising from many gap junctions continuously lining the contact sites and amplifying the
signal intensity. Weak fluorescence signals of Cx43 were also visible close to the nucleus,
indicating trafficking intermediates in the ER or Golgi. TfR staining was weaker but also
localized to the membrane although not as apparent as Cx43. A cell group with extensive
Figure 5‐7. Cx43 localization in normal human fibroblasts is confined to sites of cell‐cell contact.
Primary human fibroblasts were immunostained for Cx43 and TfR being imaged by fluorescence
microscopy at 20x magnification: Cx43 (green, left panel), TfR (red, central panel), merge (right
panel). Nuclear staining with DAPI (blue) is shown in the merged panel only. Cx43 was observed at
cell‐cell contacts and was not present at areas where no neighboring cell was present. Frequently,
it also appeared as stretches (arrowheads) in these contact sites. Such a region (box) has been
magnified in an inset image in the merged panel (A). Another group of three control cells
contacting each other (B). Also here, the characteristic stretch pattern was observed (arrowheads).
Such an area (boxed region) has been magnified in the inset.
48
cell‐cell contacts is depicted in Figure 5‐7B. Note the membrane areas devoid of contact,
which also lack Cx43 immunoreactivity, indicating that Cx43 is specifically recruited to
contact sites.
5.7 Cx43 localization is affected by ether lipid‐deficiency
The localization of Cx43 was also examined in ether lipid‐deficient cells and most of the
cells showed reduced Cx43 staining at the cell surface (Figure 5‐8). Although the staining at
the membrane was visibly lower than for controls, their plasma membrane featured sites
with strong staining; however, contrary to the characteristic stretches, Cx43 appeared as
punctae in the membrane. Apparently, there were no similar compact aggregations of Cx43
at sites of cell‐cell contact. We could rarely spot a staining similar to that in controls and this
was usually at sites devoid of contact zones. TfR showed a slightly stronger intracellular
staining compared to controls. These results suggest that Cx43 trafficking within the
membrane, possibly to lipid rafts, cannot be accomplished when cells lack ether lipids.
Figure 5‐8. Ether lipid‐deficient cells show impaired Cx43 localization.
Immunostaining of fixed ether lipid‐deficient pimary human fibroblasts for Cx43 and TfR at 20x
magnification: Cx43 (green, left panel), TfR (red, central panel), merge (right panel). Nuclear
staining with DAPI (blue) is shown in the merged panel only. (A and B) Cx43 staining was much
lower at the plasma membrane where it appeared as punctae (boxed regions and insets). The
typical line pattern seen in controls was rarely present and not confined to cell‐cell contacts.
Results
49
5.8 Ether lipid deficiency leads to a mislocalization of Cx43 phospho‐
isoforms in rafts
Next, we isolated detergent‐resistant membranes (DRM) from both control and DHAPAT‐
deficient fibroblasts and loaded equal volumes of density gradient fractions to detect Cx43
along with the raft proteins Flotillin (Flot) and Thy‐1 as well as the non‐raft membrane
protein TfR in detergent‐resistant and –soluble fractions. Flot and Thy‐1 were no more
localized as in the control cell line in raft fractions only, and TfR showed a shift towards
detergent‐soluble fractions (Figure 5‐9). Total Cx43 amounts were lower in the mutant cells
and, in particular, it was hardly detectable in raft fractions. Also the Cx43 amounts in non‐
raft fractions were decreased. Interestingly, the intensity of Cx43 bands in the middle‐dense
fraction was similar to that in raft fractions of controls and comparable to the level in
DHAPAT‐deficient cells.
Figure 5‐9. Immunoblot analysis of several proteins in detergent‐resistant membranes of both
control and DHAPAT‐deficient cells. A) Immunoblots with equal volumes of protein (18 µl) from
fractions 1‐4, 7, 10‐12 collected after density‐gradient centrifugation of control and DHAPAT‐
deficient human primary fibroblast‐lysates, loaded and probed for Flotillin (Flot), Thy‐1,
Transferrin receptor (TfR) and Cx43. Proteins are separated according to their solubility with the
detergent and density, floating from dense (10‐12) to lighter fractions (1‐4) with the decreasing
sucrose concentration. Therefore, raft proteins such as Thy‐1 and Flot will appear in the first
fractions due to the detergent‐resistant properties of rafts (B).
A
B
50
5.9 Adult Dhapat‐deficient mice show reduced amounts of Connexin‐43 in
heart
Since in the literature a significant incidence of heart anomalies in RCDP patients has
been reported and such heart defects were linked to a reduction in Cx43, we asked whether
hearts of Dhapat‐deficient mice were also affected. We approached this question in two
ways: 1) biochemically, by comparing the amounts of Cx43 in homogenized heart tissue of
wildtype and Dhapat‐/‐ mice and 2) functionally through electrocardiographic assessment of
the hearts in vivo (ongoing work by Fabian Dorninger and Gerhard Zeitler from our
laboratory in collaboration with Reginald Bittner from the Institute of Anatomy, Medical
University of Vienna). The biochemical analysis was done using hearts of late‐stage fetal
mice (E18.5) and 14‐16.5‐months old mice. Therefore, heart tissues were homogenized and
protein extracts separated for immunoblot analysis of Cx43 and β‐actin. Mutant embryonic
hearts did not show any differences in Cx43 amounts (Figure 5‐10); all Cx43 isoforms were
detected at similar levels in wildtype and Dhapat‐KO mice. Thus, the amounts of Cx43 in
hearts of developing mice lacking ether lipids do not appear to be affected.
Figure 5‐10. Immunoblot analysis of Cx43 in fetal heart homogenates.
Cx43 and β‐actin in heart homogenates of wildtype and Dhapat‐KO
mice (n=3 each).
Results
51
In contrast, cardiac levels of Cx43 in adult Dhapat‐/‐ mice indeed showed a difference
when compared with wildtype levels; while the band depicting P0 was of similar intensity,
we detected a statistically significant reduction (p<0.01) in the mean value of Cx43 phospho‐
isoforms normalized to β‐actin levels (Figure 5‐11). Taken together, these results show that
ether lipid deficiency affects Cx43 at older ages but not in developing mice.
Figure 5‐11. Cx43 is reduced in its protein amounts in adult heart homogenates of Dhapat‐
deficient mice. A) Immunoblot analysis of Cx43 and Actin in heart homogenates of adult control
and DHAPAT‐KO mice (n=3 each, ages 14‐16.5 months). B) Densitometric quantification displayed
of mean value ± s.d. of Cx43 signal intensities after normalization to β‐actin. * p<0.05; ** p<0.01
52
6 DISCUSSION
Our objective was to find out whether ether lipids in general might have an effect on Cx43
in terms of protein levels, phosphorylation states and localization in cells as well as in heart
tissue. This gap‐junctional protein, responsible for intercellular communication in many
tissues of mice and humans, was shown to be reduced in ether lipid‐deficient mouse
embryonic fibroblasts (Rodemer et al., 2003) and to be additionally mislocalized in many
heart defects. Some of these heart defects such as atrioseptal defects were also found in the
human disorder of ether lipid deficiency, RCDP, implying an involvement of these lipids in
heart phenotypes. Ether lipids are present in lipid rafts which serve as platforms to
concentrate protein complexes such as Cx43 gap junctions into plaques.
Thus, we wanted to find out whether, under conditions of ether lipid deficiency; 1) Cx43 is
altered in amounts and phosphorylation states; 2) confluency state of the cells might
influence the expression of this protein as in control; 3) Cx43 is localized at similar sites
compared to normal cells; 4) a change is induced in the phosphorylated isoforms being
distributed in raft and non‐raft areas of the membrane; and 5) heart tissues might react to
the absence of ether lipids with a change in Cx43 protein amounts.
We could show that dermal fibroblasts of a control subject express Cx43 and that this
expression was dependent upon confluency of the cell culture. By culturing cells at two
different densities, that is, one set of cells seeded at very low numbers to ensure a
surrounding of each cell with no contacts (around 10‐20% confluency) and another set with
a high cell number to achieve a culture where cells even grow onto each other (ca. 100%
confluent), we gained a comparative tool to resolve the issue whether culture density may
influence the amount of Cx43. Both sets were kept in culture at otherwise similar conditions
for at least three days after seeding. We found a striking difference between low and high‐
density control cells (cf. Figure 5‐2), especially in the slower‐migrating isoforms of Cx43 that
were attributed to the pool of protein on the way to or in the plasma membrane (P1) and
such in gap junctions (P2) at the cell surface (denoted as “P1+P2” in our figures). We could
confirm by densitometric analysis of the immunoblot that Cx43 was significantly increased in
high‐density cells; these cells had around 91% more Cx43 than low‐density cells. This finding
indicates that many contacts results in more Cx43 being trafficked to and integrated into the
plasma membrane and probably more gap junctions being formed to establish sufficient
intercellular communication. Our results are consistent with findings in cultured rat cardiac
Discussion
53
myocytes in which Cx43 amounts, especially the phosphorylated forms, increased with
culture time (Oyamada et al., 1994). This was also confirmed by immunofluorescence
microscopy in Sertoli cells in testis (Lablack et al., 1998). The lower Cx43 band (P0)
delineated to represent newly synthesized intracellular protein was also slightly stronger in
our control cells, implying that also synthesis of new proteins was induced upon contact.
Thus, it seems that new cell‐cell interactions not only give rise to protein integration into the
membrane and gap junction formation but also to the synthesis of new connexins to
replenish an existing pool. The latter is in good agreement with findings of Meyer and
colleagues, who inhibited protein synthesis with cycloheximide and could show that the gap
junction stimulation by cholesterol was abolished in Novikoff hepatoma cells (Meyer et al.,
1990).
As Cx43 has been shown by the group of Wilhelm Just to be reduced in mouse embryonic
fibroblasts (MEF) deficient in ether lipids (Rodemer et al., 2003), it was obvious to determine
whether this fact applies also to human fibroblasts or was species‐specific. Therefore, Cx43
protein levels of human primary fibroblasts from an RCDP patient having a mutation in the
DHAPAT gene were examined by Western blot analysis. Again, also here we assured similar
conditions for the culturing. We found a reduction of Cx43 in ether lipid‐deficient cells (cf.
Figure 5‐3). Particularly, this change was remarkable for the phospho‐isoforms of Cx43. As
the phosphorylated forms are mostly associated with gap junction formation (P2), surface
membrane localization and late endosome trafficking, these findings suggest a reduced
amount of functional connexons at cell‐cell contacts. Lipid rafts have been shown to contain
ether lipids and, as gap junction plaques are thought to be tightly packed through lipid rafts,
it is possible that ether lipid deficiency cannot offer the environment, in terms of rafts,
needed for Cx43 to be phosphorylated, leading to an impaired formation of gap junction and
subsequently, plaques. It is also possible that the signaling pathway that leads to
phosphorylation of Cx43 relies on arachidonic acid (AA), which can be “stored” in ether lipids
at their sn2 position. Additionally, when these lipid species are not present, it has been
shown that arachidonic acid release from (non‐plasmalogen) phospholipids was increased in
mutant macrophages (Gaposchkin et al., 2008). Furthermore, free AA reduced Cx43 amounts
and uncoupled rat myocardial cells and cultured astrocytes upon treatment (Martinez and
Saez, 1999; Massey et al., 1992). This might also be the case for dermal fibroblasts.
54
We were curious whether DHAPAT‐deficient cells were also able to respond according to
density as in controls, and performed the same analysis in these cells. Our findings revealed
a striking difference in comparison with the controls (cf. Figure 5‐4). Cultured human
primary fibroblasts when lacking ether lipids did not display the increase in Cx43 levels at
high densities compared with low‐density cells, implying that either the cells cannot
recognize or convey the signal of contact, or their ability to initiate events for gap junction
formation is impaired. In the context of ether lipids, however, it is possible that
hemichannels cannot be recognized as substrates for phosphorylation to P2 state due to
different lipid environment, resulting in an impaired gap junction and plaque formation.
Based on these findings we then supplied the ether lipid‐deficient human primary
fibroblast cell line with ether lipid precursors in order to restore the lipid profile and to
investigate the consequence on Cx43 levels. Therefore, we treated human primary
fibroblasts of a control and a DHAPAT‐deficient patient each with two different precursor
substances, to circumvent the peroxisomal steps, for three consecutive days, sufficient time
to restore plasmalogen levels in fibroblasts as we know from previous findings (Fabian
Dorninger, 2011, Diploma Thesis) and partially in lymphocytes from RCDP type I and type II
patients (Wood et al., 2011). Surprisingly, we did not observe a normalization of the amount
of phosphorylated Cx43 (cf. Figure 5‐5 and Figure 5‐6). This might have several reasons: 1)
this time span was not enough to elevate Cx43 amounts to control levels; 2) the cells were
already too dense, having already established contacts, when the supplementary treatment
started, thereby not allowing a sufficient turnover and increase of Cx43; 3) this finding might
be unique for this particular cell line; 4) the lipid profile might not reflect the endogenous
normal plasmalogen composition, as plasmalogen precursors can only recover one species
according to their chain length at the sn1 position, implying that the restored lipid
subspecies are not needed for rafts in which Cx43 gap junctions normally concentrate.
Therefore, a combination of many precursor substances may clarify the latter idea. For the
third point, we already started to cultivate further cell lines from other RCDP patients to
analyze their Cx43 levels. A time course should be done as well as similar confluency
conditions are needed for the remaining mentioned hypotheses.
Cx43 was further examined by immunofluorescence microscopy to check whether the
protein amounts are also reflected in its subcellular localization. The characteristic
membrane staining in human control fibroblasts (cf. Figure 5‐7) was exclusively confined to
Discussion
55
sites of cell‐cell contact, likely to represent gap junctions. This was also reported in rat
ventricular myocytes (Kwak et al., 1999). Additionally, we observed stretches of fluorescent
signal in some areas of these contact sites, resulting in a much stronger staining, which
might represent series of gap junction plaques. This kind of staining was also observed in
previous findings by others, however, the authors did not specifically designate these areas
to be assemblies of gap junctions (Das Sarma et al., 2002; Koval et al., 1997; Stuhlmann et al.,
2003).
In ether lipid‐deficient cells, immunofluorescent labeling of Cx43 confirmed our findings
from Western Blot analysis (cf. Figure 5‐8). First, the overall membrane staining of Cx43 was
clearly weaker than in normal controls, and the extended stretched were not present at all,
which might indicate a reduced number or even an impaired plaque formation possibly due
to altered rafts based on the absence of ether lipids. Instead, Cx43 was occasionally visible as
a punctate staining at contact sites that could result from the cell trying to restore
intercellular communication by small aggregations through different non‐plasmalogen rafts.
We also investigated Cx43 in raft fractions biochemically by isolating detergent‐resistant
membranes and noticed that, while control cells exhibited stronger P0 but low P1 and P2
isoforms in non‐raft fractions (cf. Figure 5‐9, lanes 10‐12), DHAPAT‐deficient cells had lower
amounts, especially of P0. This is in good agreement with our previous findings showing an
overall reduction in Cx43. Furthermore, raft fractions of control cells displayed the typical
isoforms of Cx43 with stronger P1 and P2 whereas the mutant cell line, in contrast, had
substantially less Cx43 in raft fractions. Previous observations from our lab showed that
several raft proteins in the same fibroblast cultures exhibited an altered floating behavior,
shifting towards non‐raft fractions (F. Dorninger, 2011, Diploma Thesis). Taken together,
these results further support our hypothesis that ether lipid‐containing rafts probably serve
as platforms for gap junction aggregation and that cell membranes lacking ether lipids
cannot accomplish this function.
Regarding our finding in control cells that some of the phospho‐isoforms of Cx43 were
additionally present in non‐raft fractions; this has also been described in NIH 3T3 cells,
immortalized mouse embryonic fibroblasts, which the authors suggested to be the result of
the dynamic modulation by kinases and phosphatases (Schubert et al., 2002). However, this
was certainly not the case with canine heart raft preparations, where only the gap‐junctional
phospho‐isoforms were found in detergent‐resistant fractions (Hesketh et al., 2010). It is
56
possible that this controversy is a result of technical differences such as the isolation method
or the usage of phosphatase inhibitors. Additionally, this behavior might be tissue‐ or
species‐specific.
There are increasing numbers of reports about RCDP cases associated with congenital
heart phenotypes and also of Cx43 being altered in both amounts and localization in similar
cardiac abnormalities. Thus, it was of interest to examine hearts of ether lipid‐deficient mice
for this gap‐junctional protein. We investigated mice of two extreme ages: either developing
or very old mice. Cx43 is first detected in the ventricles and then in atria at around
embryonic day 12.5 (E12.5). We analyzed the amounts of Cx43 in developing animals at
E18.5 and observed equal levels when WT and DHAPAT‐KO are compared (cf. Figure 5‐10). It
is likely that Cx43 can be substituted by other members of the Cx family during cardiac
development, in agreement with the observation that Cx43 KO mice develop and are born
without any complications (Reaume et al., 1995). Cardiac‐specific inactivation of Cx43 in
mice resulted in normal heart structure and most functions; however, the conduction
velocity of the ventricles was remarkably decreased and the animals died due to
spontaneous ventricular arrhythmias (Gutstein et al., 2001a). It remains to be elucidated
whether ventricular abnormalities are featured in ether‐lipid deficient mice as well. Fabian
Dorninger and Gerhard Zeitler from our lab, collaboration with the group of Reginald Bittner
from the Institute of Anatomy (Medical University of Vienna) are now functionally measuring
hearts of living mice by echocardiography to answer this question.
In contrast, adult hearts of Dhapat‐/‐ mice exhibited a striking reduction in Cx43 (cf. Figure
5‐11), implying that Cx43 expression probably decreases with age, which should be further
examined in a time course. One of the functions attributed to plasmalogens was their
protective role against oxidative stress. Cholesterol‐fed rat hearts were shown to have
reduced Cx43 content in the intercalated discs at increased superoxide levels (Gorbe et al.,
2011), which might be caused by amounts of plasmalogens insufficient to prevent this
oxidative increase. Oxidative stress was reported to be less damaging to cells when
astrocytes were coupled to each other via gap junctions (Blanc et al., 1998), which was also
shown for mouse myocytes being more resistant to H2O2 toxicity in culture (Nakamura et al.,
1994). Partial deficiency in Cx43 in heterozygous mice did not lead to the remarkable
decrease in infarct size after ischemic preconditioning as seen in wildtype mice (Schwanke et
al., 2002). The mechanism is thought to be mediated by gap junction‐coupled cells spreading
Discussion
57
protective antioxidants to areas of stressed cells (Harris and Locke, 2009). In the context of
our finding, this may also be the case: oxidative stress due to lack of plasmalogens may
downregulate Cx43 levels, leading to an uncoupling and thus accumulation of more radicals.
As the heart additionally expresses other gap‐junctional proteins, it remains to be
elucidated whether the reduction in protein amounts is unique to Cx43 and the defects arise
from decreased total protein levels, malfunctioning or possibly impaired cooperation with
other connexins.
Our results strongly suggest an impact of ether lipid‐deficiency on the gap‐junctional
protein Cx43. While the cells examined by immunoblot or immunocytochemistry methods
provide molecular insights, heart tissues of mice clearly support this finding. Nevertheless,
dye‐coupling studies may reveal the consequences of ether lipid‐deficiency on the
functionality of gap junctions.
Rhizomelic chondrodysplasia punctata and oculodentodigital dysplasia have many
features in common in clinical terms, such as skeletal (especially craniofacial) malformations,
cataracts and neurologic symptoms beside those regarding the heart. Cx43 in the skeleton is
essential for its development and constant remodeling, since it is expressed in all cells in this
tissue as the predominant gap junction protein. Cx43 null mice were reported to have
craniofacial malformations and delayed ossification (Lecanda et al., 2000), which also
occurred in the Pex7‐/‐ mice (Brites et al., 2003).
Furthermore, the developing lens expresses Cx43, especially lens epithelial cells need
them for a tight connection to each other to exchange metabolites and maintain the osmotic
balance. Accordingly, Cx43 deficiency in mice leads to a separation of the lens epithelial cells
(Gao and Spray, 1998), disturbing metabolic sharing and osmotic balance and, initiating the
cataract formation that is characteristic for ODDD but also RCDP patients. Cultured mouse
lens epithelial cells of mice have been shown to be enriched in plasmenylethanolamine (Thai
et al., 1999), while such from canine tissues contained a substantial amount of
phosphatidylcholine plasmalogens (Greiner et al., 1994).
Also neurologic symptoms, such as seizures are present in both RCDP and ODDD,
indicating a further crosstalk of ether lipids and Cx43 that is expressed in astrocytes in the
central nervous system. Mice with a targeted inactivation of Cx43 specifically in astrocytes
exhibited a poor performance on the rotarod and were found to have an increased amount
58
of acetylcholine in the frontal cortex (Frisch et al., 2003). Additionally, functional coupling of
astrocytes was decreased by around 50% (Theis et al., 2003). The myelin sheath that is
responsible for the nerve conduction was also shown to be enriched in plasmalogens as well
as connexins (Farooqui and Horrocks, 2001).
Further studies have to focus on the many interconnections of Cx43 with ether lipids to
uncover their functional importance for each other. In addition, it would be of interest to
extend the studies to the other gap‐junctional proteins. Ether lipid‐ and connexin‐deficient
mouse models as well as cell lines derived from patients with ODDD or RCDP would be useful
material for such future projects.
7 REFERENCES
General
Childrensmemorial.org
Lipidlibrary.org
My.clevelandclinic.org
Orpha.net
Mayoclinic.com
Mdmedicine.wordpress.com
Fabian Dorninger (2011), “Characterization of Cellular Membranes under Conditions of Ether Lipid
Deficiency”, Diploma Thesis.
Literature
1) Akgun, C., Akbayram, S., Tuncer, O., Taskin, G., and Ceylan, A. (2010). Chondrodysplasia punctata associated with tetralogy of Fallot in a newborn infant. Genet Couns 21, 253‐256.
2) Alberts, B. (2008). Molecular biology of the cell, 5th edn (New York: Garland Science).
3) Biermann, J., Just, W.W., Wanders, R.J., and Van Den Bosch, H. (1999). Alkyl‐dihydroxyacetone phosphate synthase and dihydroxyacetone phosphate acyltransferase form a protein complex in peroxisomes. European journal of biochemistry / FEBS 261, 492‐499.
4) Blanc, E.M., Bruce‐Keller, A.J., and Mattson, M.P. (1998). Astrocytic gap junctional communication decreases neuronal vulnerability to oxidative stress‐induced disruption of Ca2+ homeostasis and cell death. Journal of neurochemistry 70, 958‐970.
5) Boulaksil, M., Winckels, S.K., Engelen, M.A., Stein, M., van Veen, T.A., Jansen, J.A., Linnenbank, A.C., Bierhuizen, M.F., Groenewegen, W.A., van Oosterhout, M.F., et al. (2010). Heterogeneous Connexin43 distribution in heart failure is associated with dispersed conduction and enhanced susceptibility to ventricular arrhythmias. European journal of heart failure 12, 913‐921.
6) Braverman, N., Steel, G., Obie, C., Moser, A., Moser, H., Gould, S.J., and Valle, D. (1997). Human PEX7 encodes the peroxisomal PTS2 receptor and is responsible for rhizomelic chondrodysplasia punctata. Nature genetics 15, 369‐376.
7) Braverman, N., Zhang, R., Chen, L., Nimmo, G., Scheper, S., Tran, T., Chaudhury, R., Moser, A., and Steinberg, S. (2010). A Pex7 hypomorphic mouse model for plasmalogen deficiency affecting the lens and skeleton. Molecular genetics and metabolism 99, 408‐416.
8) Bretscher, M.S., and Munro, S. (1993). Cholesterol and the Golgi apparatus. Science 261, 1280‐1281.
9) Brites, P., Mooyer, P.A., El Mrabet, L., Waterham, H.R., and Wanders, R.J. (2009). Plasmalogens participate in very‐long‐chain fatty acid‐induced pathology. Brain : a journal of neurology 132, 482‐492.
10) Brites, P., Motley, A.M., Gressens, P., Mooyer, P.A., Ploegaert, I., Everts, V., Evrard, P., Carmeliet, P., Dewerchin, M., Schoonjans, L., et al. (2003). Impaired neuronal migration and endochondral ossification in Pex7 knockout mice: a model for rhizomelic chondrodysplasia punctata. Human molecular genetics 12, 2255‐2267.
11) Brites, P., Waterham, H.R., and Wanders, R.J. (2004). Functions and biosynthesis of plasmalogens in health and disease. Biochimica et biophysica acta 1636, 219‐231.
12) Britz‐Cunningham, S.H., Shah, M.M., Zuppan, C.W., and Fletcher, W.H. (1995). Mutations of the Connexin43 gap‐junction gene in patients with heart malformations and defects of laterality. The New England journal of medicine 332, 1323‐1329.
13) Brown, D.A., and London, E. (1998). Functions of lipid rafts in biological membranes. Annual review of cell and developmental biology 14, 111‐136.
14) Brown, D.A., and London, E. (2000). Structure and function of sphingolipid‐ and cholesterol‐rich membrane rafts. The Journal of biological chemistry 275, 17221‐17224.
15) Chatterjee, S., and Mayor, S. (2001). The GPI‐anchor and protein sorting. Cellular and molecular life sciences : CMLS 58, 1969‐1987.
16) Churko, J.M., Shao, Q., Gong, X.Q., Swoboda, K.J., Bai, D., Sampson, J., and Laird, D.W. (2011). Human dermal fibroblasts derived from oculodentodigital dysplasia patients suggest that patients may have wound‐healing defects. Human mutation 32, 456‐466.
17) Cooper, G.M. (2000). The cell : a molecular approach, 2nd edn (Washington, D.C., Sunderland, Mass.: ASM Press ; Sinauer Associates).
18) Coskun, U., and Simons, K. (2010). Membrane rafting: from apical sorting to phase segregation. FEBS letters 584, 1685‐1693.
19) Cronier, L., Crespin, S., Strale, P.O., Defamie, N., and Mesnil, M. (2009). Gap junctions and cancer: new functions for an old story. Antioxidants & redox signaling 11, 323‐338.
20) Das Sarma, J., Wang, F., and Koval, M. (2002). Targeted gap junction protein constructs reveal connexin‐specific differences in oligomerization. The Journal of biological chemistry 277, 20911‐20918.
21) Dasgupta, C., Martinez, A.M., Zuppan, C.W., Shah, M.M., Bailey, L.L., and Fletcher, W.H. (2001). Identification of connexin43 (alpha1) gap junction gene mutations in patients with hypoplastic left heart syndrome by denaturing gradient gel electrophoresis (DGGE). Mutation research 479, 173‐186.
22) de Vet, E.C., Ijlst, L., Oostheim, W., Wanders, R.J., and van den Bosch, H. (1998). Alkyl‐dihydroxyacetonephosphate synthase. Fate in peroxisome biogenesis disorders and identification of the point mutation underlying a single enzyme deficiency. The Journal of biological chemistry 273, 10296‐10301.
23) Defamie, N., and Mesnil, M. (2011). The modulation of gap‐junctional intercellular communication by lipid rafts. Biochimica et biophysica acta.
24) Dilli, D., Yasar, H., Baydar, Z., Dilmen, U., Ceylaner, S., Altug, N., and Karadeniz, S. (2008). A case of rhizomelic chondrodysplasia punctata complicated with fetal arrhythmia. Erc Med J.
25) Dupont, E., Matsushita, T., Kaba, R.A., Vozzi, C., Coppen, S.R., Khan, N., Kaprielian, R., Yacoub, M.H., and Severs, N.J. (2001). Altered connexin expression in human congestive heart failure. Journal of molecular and cellular cardiology 33, 359‐371.
26) Erdmann, R., and Schliebs, W. (2005). Peroxisomal matrix protein import: the transient pore model. Nature reviews Molecular cell biology 6, 738‐742.
27) Fadeel, B., and Xue, D. (2009). The ins and outs of phospholipid asymmetry in the plasma membrane: roles in health and disease. Critical reviews in biochemistry and molecular biology 44, 264‐277.
28) Fahy, E., Subramaniam, S., Brown, H.A., Glass, C.K., Merrill, A.H., Jr., Murphy, R.C., Raetz, C.R., Russell, D.W., Seyama, Y., Shaw, W., et al. (2005). A comprehensive classification system for lipids. Journal of lipid research 46, 839‐861.
29) Farooqui, A.A., Farooqui, T., and Horrocks, L.A. (2008). Metabolism and function of bioactive ether lipids in the brain (New York: Springer).
30) Farooqui, A.A., and Horrocks, L.A. (2001). Plasmalogens: workhorse lipids of membranes in normal and injured neurons and glia. The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry 7, 232‐245.
31) Figueiredo, S.d.S., Sousa de Araujo, J., Kozan, J.E.M., dos Santos, N.C.L., and Tanganeli, V. (2007). Rhizomelic Chondrodysplasia Punctata: a case report and brief literature review. Radiol Bras 40, 69‐72.
32) Fourie, D.T. (1995). Chondrodysplasia punctata: case report and literature review of patients with heart lesions. Pediatric cardiology 16, 247‐250.
33) Frisch, C., Theis, M., De Souza Silva, M.A., Dere, E., Sohl, G., Teubner, B., Namestkova, K., Willecke, K., and Huston, J.P. (2003). Mice with astrocyte‐directed inactivation of connexin43 exhibit increased exploratory behaviour, impaired motor capacities, and changes in brain acetylcholine levels. The European journal of neuroscience 18, 2313‐2318.
34) Gao, Y., and Spray, D.C. (1998). Structural changes in lenses of mice lacking the gap junction protein connexin43. Investigative ophthalmology & visual science 39, 1198‐1209.
35) Gaposchkin, D.P., Farber, H.W., and Zoeller, R.A. (2008). On the importance of plasmalogen status in stimulated arachidonic acid release in the macrophage cell line RAW 264.7. Biochimica et biophysica acta 1781, 213‐219.
36) Giepmans, B.N. (2004). Gap junctions and connexin‐interacting proteins. Cardiovascular research 62, 233‐245.
37) Gilleron, J., Carette, D., Durand, P., Pointis, G., and Segretain, D. (2009). Connexin 43 a potential regulator of cell proliferation and apoptosis within the seminiferous epithelium. The international journal of biochemistry & cell biology 41, 1381‐1390.
38) Glaser, P.E., and Gross, R.W. (1994). Plasmenylethanolamine facilitates rapid membrane fusion: a stopped‐flow kinetic investigation correlating the propensity of a major plasma membrane constituent to adopt an HII phase with its ability to promote membrane fusion. Biochemistry 33, 5805‐5812.
39) Goldberg, G.S., Valiunas, V., and Brink, P.R. (2004). Selective permeability of gap junction channels. Biochimica et biophysica acta 1662, 96‐101.
40) Goodenough, D.A., and Paul, D.L. (2003). Beyond the gap: functions of unpaired connexon channels. Nature reviews Molecular cell biology 4, 285‐294.
41) Gorbe, A., Varga, Z.V., Kupai, K., Bencsik, P., Kocsis, G.F., Csont, T., Boengler, K., Schulz, R., and Ferdinandy, P. (2011). Cholesterol diet leads to attenuation of ischemic preconditioning‐induced cardiac protection: the role of connexin 43. American journal of physiology Heart and circulatory physiology 300, H1907‐1913.
42) Gorgas, K., Teigler, A., Komljenovic, D., and Just, W.W. (2006). The ether lipid‐deficient mouse: tracking down plasmalogen functions. Biochimica et biophysica acta 1763, 1511‐1526.
43) Greiner, J.V., Auerbach, D.B., Leahy, C.D., and Glonek, T. (1994). Distribution of membrane phospholipids in the crystalline lens. Investigative ophthalmology & visual science 35, 3739‐3746.
44) Gutstein, D.E., Morley, G.E., Tamaddon, H., Vaidya, D., Schneider, M.D., Chen, J., Chien, K.R., Stuhlmann, H., and Fishman, G.I. (2001a). Conduction slowing and sudden arrhythmic death in mice with cardiac‐restricted inactivation of connexin43. Circulation research 88, 333‐339.
45) Gutstein, D.E., Morley, G.E., Vaidya, D., Liu, F., Chen, F.L., Stuhlmann, H., and Fishman, G.I. (2001b). Heterogeneous expression of Gap junction channels in the heart leads to conduction defects and ventricular dysfunction. Circulation 104, 1194‐1199.
46) Haefliger, J.A., and Meda, P. (2000). Chronic hypertension alters the expression of Cx43 in cardiovascular muscle cells. Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas / Sociedade Brasileira de Biofisica [et al] 33, 431‐438.
47) Harris, A.L., and Locke, D. (2009). Connexins : a guide (New York, N.Y.: Springer).
48) Hesketh, G.G., Shah, M.H., Halperin, V.L., Cooke, C.A., Akar, F.G., Yen, T.E., Kass, D.A., Machamer, C.E., Van Eyk, J.E., and Tomaselli, G.F. (2010). Ultrastructure and regulation of lateralized connexin43 in the failing heart. Circulation research 106, 1153‐1163.
49) Ikonen, E. (2008). Cellular cholesterol trafficking and compartmentalization. Nature reviews Molecular cell biology 9, 125‐138.
50) Itzkovitz, B., Jiralerspong, S., Nimmo, G., Loscalzo, M., Horovitz, D.D., Snowden, A., Moser, A., Steinberg, S., and Braverman, N. (2011). Functional characterization of novel mutations in GNPAT and AGPS, causing Rhizomelic Chondrodysplasia Punctata (RCDP) types 2 and 3. Human mutation.
51) Jacobson, K., Mouritsen, O.G., and Anderson, R.G. (2007). Lipid rafts: at a crossroad between cell biology and physics. Nature cell biology 9, 7‐14.
52) Johnson, R., Hammer, M., Sheridan, J., and Revel, J.P. (1974). Gap junction formation between reaggregated Novikoff hepatoma cells. Proceedings of the National Academy of Sciences of the United States of America 71, 4536‐4540.
53) Jordan, K., Solan, J.L., Dominguez, M., Sia, M., Hand, A., Lampe, P.D., and Laird, D.W. (1999). Trafficking, assembly, and function of a connexin43‐green fluorescent protein chimera in live mammalian cells. Molecular biology of the cell 10, 2033‐2050.
54) Kanzawa, N., Maeda, Y., Ogiso, H., Murakami, Y., Taguchi, R., and Kinoshita, T. (2009). Peroxisome dependency of alkyl‐containing GPI‐anchor biosynthesis in the endoplasmic reticulum. Proceedings of the National Academy of Sciences of the United States of America 106, 17711‐17716.
55) Kazemian, M., Fakhraee, S.H., Borjian, L., and Yeganeh, M.H. (2009). [A case of rhizomelic chondrodysplasia punctata with congenital heart disease]. J Bab Uni Med Sci 11.
56) Kolcz, J., Drukala, J., Bzowska, M., Rajwa, B., Korohoda, W., and Malec, E. (2005). The expression of connexin 43 in children with Tetralogy of Fallot. Cellular & molecular biology letters 10, 287‐303.
57) Kostin, S., Dammer, S., Hein, S., Klovekorn, W.P., Bauer, E.P., and Schaper, J. (2004). Connexin 43 expression and distribution in compensated and decompensated cardiac hypertrophy in patients with aortic stenosis. Cardiovascular research 62, 426‐436.
58) Koval, M., Harley, J.E., Hick, E., and Steinberg, T.H. (1997). Connexin46 is retained as monomers in a trans‐Golgi compartment of osteoblastic cells. The Journal of cell biology 137, 847‐857.
59) Kumar, N.M., and Gilula, N.B. (1996). The gap junction communication channel. Cell 84, 381‐388.
60) Kwak, B.R., van Kempen, M.J., Theveniau‐Ruissy, M., Gros, D.B., and Jongsma, H.J. (1999). Connexin expression in cultured neonatal rat myocytes reflects the pattern of the intact ventricle. Cardiovascular research 44, 370‐380.
61) Lablack, A., Bourdon, V., Defamie, N., Batias, C., Mesnil, M., Fenichel, P., Pointis, G., and Segretain, D. (1998). Ultrastructural and biochemical evidence for gap junction and connexin 43 expression in a clonal Sertoli cell line: a potential model in the study of junctional complex formation. Cell and tissue research 294, 279‐287.
62) Laird, D.W. (2006). Life cycle of connexins in health and disease. The Biochemical journal 394, 527‐543.
63) Lampe, P.D., and Lau, A.F. (2000). Regulation of gap junctions by phosphorylation of connexins. Archives of biochemistry and biophysics 384, 205‐215.
64) Lauf, U., Giepmans, B.N., Lopez, P., Braconnot, S., Chen, S.C., and Falk, M.M. (2002). Dynamic trafficking and delivery of connexons to the plasma membrane and accretion to gap junctions in living cells. Proceedings of the National Academy of Sciences of the United States of America 99, 10446‐10451.
65) Lecanda, F., Warlow, P.M., Sheikh, S., Furlan, F., Steinberg, T.H., and Civitelli, R. (2000). Connexin43 deficiency causes delayed ossification, craniofacial abnormalities, and osteoblast dysfunction. The Journal of cell biology 151, 931‐944.
66) Levental, I., Lingwood, D., Grzybek, M., Coskun, U., and Simons, K. (2010). Palmitoylation regulates raft affinity for the majority of integral raft proteins. Proceedings of the National Academy of Sciences of the United States of America 107, 22050‐22054.
67) Levin, M., and Mercola, M. (1998). Gap junctions are involved in the early generation of left‐right asymmetry. Developmental biology 203, 90‐105.
68) Lingwood, D., and Simons, K. (2007). Detergent resistance as a tool in membrane research. Nature protocols 2, 2159‐2165.
69) Loddenkemper, T., Grote, K., Evers, S., Oelerich, M., and Stogbauer, F. (2002). Neurological manifestations of the oculodentodigital dysplasia syndrome. Journal of neurology 249, 584‐595.
70) Lopez, P., Balicki, D., Buehler, L.K., Falk, M.M., and Chen, S.C. (2001). Distribution and dynamics of gap junction channels revealed in living cells. Cell communication & adhesion 8, 237‐242.
71) Ma, C., Agrawal, G., and Subramani, S. (2011). Peroxisome assembly: matrix and membrane protein biogenesis. The Journal of cell biology 193, 7‐16.
72) Malewicz, B., Kumar, V.V., Johnson, R.G., and Baumann, W.J. (1990). Lipids in gap junction assembly and function. Lipids 25, 419‐427.
73) Mandel, H., Sharf, R., Berant, M., Wanders, R.J., Vreken, P., and Aviram, M. (1998). Plasmalogen phospholipids are involved in HDL‐mediated cholesterol efflux: insights from investigations with plasmalogen‐deficient cells. Biochemical and biophysical research communications 250, 369‐373.
74) Marsh, D. (2007). Lateral pressure profile, spontaneous curvature frustration, and the incorporation and conformation of proteins in membranes. Biophysical journal 93, 3884‐3899.
75) Martin, P.E., and Evans, W.H. (2004). Incorporation of connexins into plasma membranes and gap junctions. Cardiovascular research 62, 378‐387.
76) Martinez, A.D., and Saez, J.C. (1999). Arachidonic acid‐induced dye uncoupling in rat cortical astrocytes is mediated by arachidonic acid byproducts. Brain research 816, 411‐423.
77) Massey, K.D., Minnich, B.N., and Burt, J.M. (1992). Arachidonic acid and lipoxygenase metabolites uncouple neonatal rat cardiac myocyte pairs. The American journal of physiology 263, C494‐501.
78) Mayor, S., and Riezman, H. (2004). Sorting GPI‐anchored proteins. Nature reviews Molecular cell biology 5, 110‐120.
79) Mese, G., Richard, G., and White, T.W. (2007). Gap junctions: basic structure and function. The Journal of investigative dermatology 127, 2516‐2524.
80) Meyer, R., Malewicz, B., Baumann, W.J., and Johnson, R.G. (1990). Increased gap junction assembly between cultured cells upon cholesterol supplementation. Journal of cell science 96 ( Pt 2), 231‐238.
81) Motley, A.M., Hettema, E.H., Hogenhout, E.M., Brites, P., ten Asbroek, A.L., Wijburg, F.A., Baas, F., Heijmans, H.S., Tabak, H.F., Wanders, R.J., et al. (1997). Rhizomelic chondrodysplasia punctata is a peroxisomal protein targeting disease caused by a non‐functional PTS2 receptor. Nature genetics 15, 377‐380.
82) Musil, L.S., Beyer, E.C., and Goodenough, D.A. (1990a). Expression of the gap junction protein connexin43 in embryonic chick lens: molecular cloning, ultrastructural localization, and post‐translational phosphorylation. The Journal of membrane biology 116, 163‐175.
83) Musil, L.S., Cunningham, B.A., Edelman, G.M., and Goodenough, D.A. (1990b). Differential phosphorylation of the gap junction protein connexin43 in junctional communication‐competent and ‐deficient cell lines. The Journal of cell biology 111, 2077‐2088.
84) Musil, L.S., and Goodenough, D.A. (1991). Biochemical analysis of connexin43 intracellular transport, phosphorylation, and assembly into gap junctional plaques. The Journal of cell biology 115, 1357‐1374.
85) Musil, L.S., and Goodenough, D.A. (1993). Multisubunit assembly of an integral plasma membrane channel protein, gap junction connexin43, occurs after exit from the ER. Cell 74, 1065‐1077.
86) Nagan, N., and Zoeller, R.A. (2001). Plasmalogens: biosynthesis and functions. Progress in lipid research 40, 199‐229.
87) Naher, B.S., Mannan, M., Noor, K., and Shahidullah, M. (2010). Chondrodysplasia Punctata in a Newborn; Rhizomelic Type: A Case Report. Bangladesh J Child Health 34, 28‐30.
88) Nakamura, T.Y., Yamamoto, I., Kanno, Y., Shiba, Y., and Goshima, K. (1994). Metabolic coupling of glutathione between mouse and quail cardiac myocytes and its protective role against oxidative stress. Circulation research 74, 806‐816.
89) Naus, C.C., and Laird, D.W. (2010). Implications and challenges of connexin connections to cancer. Nature reviews Cancer 10, 435‐441.
90) Nimmo, G., Monsonego, S., Descartes, M., Franklin, J., Steinberg, S., and Braverman, N. (2010). Rhizomelic chrondrodysplasia punctata type 2 resulting from paternal isodisomy of chromosome 1. American journal of medical genetics Part A 152A, 1812‐1817.
91) Oswald, G., Lawson, C., Raymond, G., Golden, W.C., and Braverman, N. (2011). Rhizomelic chondrodysplasia punctata type 1 and fulminant neonatal respiratory failure, a case report and discussion of pathophysiology. American journal of medical genetics Part A.
92) Oyamada, M., Kimura, H., Oyamada, Y., Miyamoto, A., Ohshika, H., and Mori, M. (1994). The expression, phosphorylation, and localization of connexin 43 and gap‐junctional intercellular communication during the establishment of a synchronized contraction of cultured neonatal rat cardiac myocytes. Experimental cell research 212, 351‐358.
93) Pascolat, G., Zindeluk, J.L., Abrao, K.C., Rodrigues, F.M., and Guedes, C.I. (2003). Rhizomelic chondrodysplasia punctata ‐ case report. Jornal de pediatria 79, 189‐192.
94) Paznekas, W.A., Boyadjiev, S.A., Shapiro, R.E., Daniels, O., Wollnik, B., Keegan, C.E., Innis, J.W., Dinulos, M.B., Christian, C., Hannibal, M.C., et al. (2003). Connexin 43 (GJA1) mutations cause the pleiotropic phenotype of oculodentodigital dysplasia. American journal of human genetics 72, 408‐418.
95) Paznekas, W.A., Karczeski, B., Vermeer, S., Lowry, R.B., Delatycki, M., Laurence, F., Koivisto, P.A., Van Maldergem, L., Boyadjiev, S.A., Bodurtha, J.N., et al. (2009). GJA1 mutations, variants, and connexin 43 dysfunction as it relates to the oculodentodigital dysplasia phenotype. Human mutation 30, 724‐733.
96) Peters, N.S., Green, C.R., Poole‐Wilson, P.A., and Severs, N.J. (1993). Reduced content of connexin43 gap junctions in ventricular myocardium from hypertrophied and ischemic human hearts. Circulation 88, 864‐875.
97) Pike, L.J. (2004). Lipid rafts: heterogeneity on the high seas. The Biochemical journal 378, 281‐292.
98) Pike, L.J. (2006). Rafts defined: a report on the Keystone Symposium on Lipid Rafts and Cell Function. Journal of lipid research 47, 1597‐1598.
99) Pike, L.J. (2009). The challenge of lipid rafts. Journal of lipid research 50 Suppl, S323‐328.
100) Pike, L.J., Han, X., Chung, K.N., and Gross, R.W. (2002). Lipid rafts are enriched in arachidonic acid and plasmenylethanolamine and their composition is independent of caveolin‐1 expression: a quantitative electrospray ionization/mass spectrometric analysis. Biochemistry 41, 2075‐2088.
101) Poelzing, S., and Rosenbaum, D.S. (2004). Altered connexin43 expression produces arrhythmia substrate in heart failure. American journal of physiology Heart and circulatory physiology 287, H1762‐1770.
102) Pralle, A., Keller, P., Florin, E.L., Simons, K., and Horber, J.K. (2000). Sphingolipid‐cholesterol rafts diffuse as small entities in the plasma membrane of mammalian cells. The Journal of cell biology 148, 997‐1008.
103) Purdue, P.E., Zhang, J.W., Skoneczny, M., and Lazarow, P.B. (1997). Rhizomelic chondrodysplasia punctata is caused by deficiency of human PEX7, a homologue of the yeast PTS2 receptor. Nature genetics 15, 381‐384.
104) Quinn, P.J., and Kagan, V.E. (2002). Phospholipid metabolism in apoptosis (New York: Kluwer Academic/Plenum Publishers).
105) Rajendran, L., and Simons, K. (2005). Lipid rafts and membrane dynamics. Journal of cell science 118, 1099‐1102.
106) Rapoport, T.A. (2007). Protein translocation across the eukaryotic endoplasmic reticulum and bacterial plasma membranes. Nature 450, 663‐669.
107) Reaume, A.G., de Sousa, P.A., Kulkarni, S., Langille, B.L., Zhu, D., Davies, T.C., Juneja, S.C., Kidder, G.M., and Rossant, J. (1995). Cardiac malformation in neonatal mice lacking connexin43. Science 267, 1831‐1834.
108) Rintala, J., Seemann, R., Chandrasekaran, K., Rosenberger, T.A., Chang, L., Contreras, M.A., Rapoport, S.I., and Chang, M.C. (1999). 85 kDa cytosolic phospholipase A2 is a target for chronic lithium in rat brain. Neuroreport 10, 3887‐3890.
109) Rodemer, C., Thai, T.P., Brugger, B., Kaercher, T., Werner, H., Nave, K.A., Wieland, F., Gorgas, K., and Just, W.W. (2003). Inactivation of ether lipid biosynthesis causes male infertility, defects in eye development and optic nerve hypoplasia in mice. Human molecular genetics 12, 1881‐1895.
110) Roell, W., Lewalter, T., Sasse, P., Tallini, Y.N., Choi, B.R., Breitbach, M., Doran, R., Becher, U.M., Hwang, S.M., Bostani, T., et al. (2007). Engraftment of connexin 43‐expressing cells prevents post‐infarct arrhythmia. Nature 450, 819‐824.
111) Rosa Castro, R., Rosario Torres, I., Felipe Velasquez, V., Rosalio Ballona, C., Iris Kikushima, Y., and Eva Klein, D. (2002). [REPORTE DE UN CASO DE CONDRODISPLASIA PUNCTATA VARIEDAD RIZOMÉLICA]. Folia Dermatológica Peruana 13.
112) Saltman, A.E., Aksehirli, T.O., Valiunas, V., Gaudette, G.R., Matsuyama, N., Brink, P., and Krukenkamp, I.B. (2002). Gap junction uncoupling protects the heart against ischemia. The Journal of thoracic and cardiovascular surgery 124, 371‐376.
113) Sastrowijoto, S.H., Vandenberghe, K., Moerman, P., Lauweryns, J.M., and Fryns, J.P. (1994). Prenatal ultrasound diagnosis of rhizomelic chondrodysplasia punctata in a primigravida. Prenatal diagnosis 14, 770‐776.
114) Schubert, A.L., Schubert, W., Spray, D.C., and Lisanti, M.P. (2002). Connexin family members target to lipid raft domains and interact with caveolin‐1. Biochemistry 41, 5754‐5764.
115) Schwanke, U., Konietzka, I., Duschin, A., Li, X., Schulz, R., and Heusch, G. (2002). No ischemic preconditioning in heterozygous connexin43‐deficient mice. American journal of physiology Heart and circulatory physiology 283, H1740‐1742.
116) Segretain, D., and Falk, M.M. (2004). Regulation of connexin biosynthesis, assembly, gap junction formation, and removal. Biochimica et biophysica acta 1662, 3‐21.
117) Severs, N.J., Bruce, A.F., Dupont, E., and Rothery, S. (2008). Remodelling of gap junctions and connexin expression in diseased myocardium. Cardiovascular research 80, 9‐19.
118) Shanske, A.L., Bernstein, L., and Herzog, R. (2007). Chondrodysplasia punctata and maternal autoimmune disease: a new case and review of the literature. Pediatrics 120, e436‐441.
119) Simons, K., and Toomre, D. (2000). Lipid rafts and signal transduction. Nature reviews Molecular cell biology 1, 31‐39.
120) Simons, K., and van Meer, G. (1988). Lipid sorting in epithelial cells. Biochemistry 27, 6197‐6202.
121) Singer, S.J., and Nicolson, G.L. (1972). The fluid mosaic model of the structure of cell membranes. Science 175, 720‐731.
122) Solan, J.L., and Lampe, P.D. (2007). Key connexin 43 phosphorylation events regulate the gap junction life cycle. The Journal of membrane biology 217, 35‐41.
123) Solan, J.L., and Lampe, P.D. (2009). Connexin43 phosphorylation: structural changes and biological effects. The Biochemical journal 419, 261‐272.
124) Spector, A.A., and Yorek, M.A. (1985). Membrane lipid composition and cellular function. Journal of lipid research 26, 1015‐1035.
125) Spray, D.C., White, R.L., de Carvalho, A.C., Harris, A.L., and Bennett, M.V. (1984). Gating of gap junction channels. Biophysical journal 45, 219‐230.
126) Sprong, H., van der Sluijs, P., and van Meer, G. (2001). How proteins move lipids and lipids move proteins. Nature reviews Molecular cell biology 2, 504‐513.
127) Steinberg, S.J., Dodt, G., Raymond, G.V., Braverman, N.E., Moser, A.B., and Moser, H.W. (2006). Peroxisome biogenesis disorders. Biochimica et biophysica acta 1763, 1733‐1748.
128) Stoll, C., Dott, B., Roth, M.P., and Alembik, Y. (1989). Birth prevalence rates of skeletal dysplasias. Clinical genetics 35, 88‐92.
129) Stuhlmann, D., Ale‐Agha, N., Reinehr, R., Steinbrenner, H., Ramos, M.C., Sies, H., and Brenneisen, P. (2003). Modulation of homologous gap junctional intercellular communication of human dermal fibroblasts via a paracrine factor(s) generated by squamous tumor cells. Carcinogenesis 24, 1737‐1748.
130) Teigler, A., Komljenovic, D., Draguhn, A., Gorgas, K., and Just, W.W. (2009). Defects in myelination, paranode organization and Purkinje cell innervation in the ether lipid‐deficient mouse cerebellum. Human molecular genetics 18, 1897‐1908.
131) Thai, T.P., Heid, H., Rackwitz, H.R., Hunziker, A., Gorgas, K., and Just, W.W. (1997). Ether lipid biosynthesis: isolation and molecular characterization of human dihydroxyacetonephosphate acyltransferase. FEBS letters 420, 205‐211.
132) Thai, T.P., Rodemer, C., Jauch, A., Hunziker, A., Moser, A., Gorgas, K., and Just, W.W. (2001). Impaired membrane traffic in defective ether lipid biosynthesis. Human molecular genetics 10, 127‐136.
133) Thai, T.P., Rodemer, C., Worsch, J., Hunziker, A., Gorgas, K., and Just, W.W. (1999). Synthesis of plasmalogens in eye lens epithelial cells. FEBS letters 456, 263‐268.
134) Theis, M., Jauch, R., Zhuo, L., Speidel, D., Wallraff, A., Doring, B., Frisch, C., Sohl, G., Teubner, B., Euwens, C., et al. (2003). Accelerated hippocampal spreading depression and enhanced locomotory activity in mice with astrocyte‐directed inactivation of connexin43. The Journal of neuroscience : the official journal of the Society for Neuroscience 23, 766‐776.
135) Thomas, S., Preda‐Pais, A., Casares, S., and Brumeanu, T.D. (2004). Analysis of lipid rafts in T cells. Molecular immunology 41, 399‐409.
136) Thomas, S.A., Schuessler, R.B., Berul, C.I., Beardslee, M.A., Beyer, E.C., Mendelsohn, M.E., and Saffitz, J.E. (1998). Disparate effects of deficient expression of connexin43 on atrial and ventricular conduction: evidence for chamber‐specific molecular determinants of conduction. Circulation 97, 686‐691.
137) van Meer, G. (2005). Cellular lipidomics. The EMBO journal 24, 3159‐3165.
138) van Meer, G., and Lisman, Q. (2002). Sphingolipid transport: rafts and translocators. The Journal of biological chemistry 277, 25855‐25858.
139) van Meer, G., Voelker, D.R., and Feigenson, G.W. (2008). Membrane lipids: where they are and how they behave. Nature reviews Molecular cell biology 9, 112‐124.
140) Wallner, S., and Schmitz, G. (2011). Plasmalogens the neglected regulatory and scavenging lipid species. Chemistry and physics of lipids 164, 573‐589.
141) Wanders, R.J., Barth, P.G., Schutgens, R.B., and Tager, J.M. (1994). Clinical and biochemical characteristics of peroxisomal disorders: an update. European journal of pediatrics 153, S44‐48.
142) Wanders, R.J., and Waterham, H.R. (2006). Biochemistry of mammalian peroxisomes revisited. Annual review of biochemistry 75, 295‐332.
143) Willecke, K., Eiberger, J., Degen, J., Eckardt, D., Romualdi, A., Guldenagel, M., Deutsch, U., and Sohl, G. (2002). Structural and functional diversity of connexin genes in the mouse and human genome. Biological chemistry 383, 725‐737.
144) Wood, P.L., Khan, M.A., Smith, T., Ehrmantraut, G., Jin, W., Cui, W., Braverman, N.E., and Goodenowe, D.B. (2011). In vitro and in vivo plasmalogen replacement evaluations in rhizomelic
chrondrodysplasia punctata and Pelizaeus‐Merzbacher disease using PPI‐1011, an ether lipid plasmalogen precursor. Lipids in health and disease 10, 182.
145) Yalin, C.T., Bayrak, I.K., Danaci, M., and Incesu, L. (2003). [Yenidoganda rizomelik kondrodisplazi punktata ve foramen magnum stenozu]. Tanisal ve Girisimsel Radyoloji 9, 100‐103.
146) Zech, T., Ejsing, C.S., Gaus, K., de Wet, B., Shevchenko, A., Simons, K., and Harder, T. (2009). Accumulation of raft lipids in T‐cell plasma membrane domains engaged in TCR signalling. The EMBO journal 28, 466‐476.
8 APPENDIX
CURRICULUM VITAE
Name: Fatma Aslı Erdem
Date of birth: 07/07/1987
Residency: Vienna, Austria
E‐mail: [email protected]
EDUCATIONAL BACKGROUND
Molecular Biology Studies 2006‐2011 Center for Molecular Biology, University of Vienna, Austria since September 2010: Diploma thesis
Thesis title: Alterations in the gap‐junctional protein Connxin‐43 under
conditions of ether lipid deficiency
Institute: Center for Brain Research
Medical University of Vienna, Austria
Supervisor: Prof. Dr. Johannes Berger
Graduation in Software Engineering 2001‐2006 Higher Technical College of Vienna (HTL Donaustadt)
Secondary School (AHS Rosasgasse) 1997‐2001
Primary School (VS Nymphengasse) 1993‐1997
Top Related