Download - Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

Transcript
Page 1: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

Agricultural, Construction and Utility Machinery

New Products

Page 2: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

2

Oval 100 X-powerpack work lamp

• Xenon (HID) work lamp with integrated ballast unit • New compact design for easy mounting• EMC class 5 according to CISPR25 for absolutely disturbance free radio and wireless transmission• Watertight system protective rating: IP6K7 – 6K9K• Close range illumination with clear lens• With AMP 6.3 plug (further plug versions on request)• Including 500 mm harness, sliding bracket and bracket for 4-point mounting

Mega Beam X-powerpack work lamp

• Xenon (HID) work lamp with integrated ballast unit • New compact design for easy mounting• EMC class 5 according to CISPR25 for absolutely disturbance free radio and wireless transmission• Watertight system - protective rating: IP6K7 – 6K9K• Close range illumination with structured lens• With AMP 6.3 plug (further plug versions on request)• Including 500 mm harness, sliding bracket and bracket for 4-point mounting

Series

Series

Series

Series

1GA 996 461-311 12V 1GA 996 461-321 12V, 180° (pendolous)11GA 996 461-331 24V1GA 996 461-341 24V, 180° (pendolous)

1GA 996 176-36112V, close rangewith external Xenon (HID) ballast4th generation

Module 70 X-powerpack(external ballast unit)

• Xenon (HID) work lamp with external ballast unit • EMC class 5 according to CISPR25 for absolutely disturbance free radio and wireless transmission• Watertight system - protective rating: IP6K7 – 6K9K • Close range illumination with clear lens• Including wiring harness

Ultra Beam X-powerpack work lamp

• Xenon (HID) work lamp with integrated ballast unit • New compact design for easy mounting• EMC class 5 according to CISPR25 for absolutely disturbance free radio and wireless transmission• Watertight system - protective rating: IP6K7 – 6K9K• Close range illumination with structured lens• With AMP 6.3 plug (further plug versions on request)• Including 500 mm harness, sliding bracket and bracket for 4-point mounting

bbbbbbaanannanaaaa cececeettttttigigigggiggigigggghtht s srararararararaaraaraarangngngeennnnnnnnngg g g g wwww

d dddddddddisisisisssstutututuuuuuuurbrbrbrbrbrbrbb• • • WaWaWWaWaaWaWW ttetetteteertrttrtrrt• •• •• CClClClClClCClClClClCC ososooosooose e e• • •••••• InIInInInnInnnnInnnInccccclclclllcccccc udududududdududddududiiiiiiii

62

6 .5

27

137

74

110

120

176

6 6

136

62

73 30 10M

112

102

133

1GA 998 534-431 12V 1GA 998 534-441 12V, 180° (pendolous)1GA 998 534-451 24V1GA 998 534-461 24V, 180° (pendolous)

•• ••••

1GM 996 135-231 12V 1GM 996 135-241 12V, 180° (pendolous)1GM 996 135-251 24V1GM 996 135-261 24V, 180° (pendolous)

O

• • • •

2

Page 3: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

3

Module 70 HB3

• Compact work lamp for close range illumination• Surface mounting or built-in version available• With hardened glass lens, free-form refl ector and clear lens• Including HB3 12V/65W bulb with 1860 lumens

Module 70 LED

• Compact LED work lamp with minimum power consumption• Extremely long service life of the high performance LEDs• Close range illumination with clear lens• Multivoltage: 9 V – 33 V• Incl. connection cable of 2 m, potted cable version• Back of the hosing with large cooling ribs for optimized heat dissipation• Absolutely dust- and waterproof (IP6K7 – 6K9K)• Generation II > 550 lumens light output, 9 - 33 V Generation I >180 lumens light output, 9 – 33 V or 36 – 80V• Power consumption: Generation I: 7 W Generation II: 15 W

85

85.5

118.5

1 0M42.8

97.2

73.8

47.5

83110.4

Generation II

Mega Beam LED • LED work lamp with minimum power consumption• Extremely long service life of the high performance LEDs• Close range illumination with clear lens• Multivoltage: 9 V – 33 V or 36 V – 80 V• Incl. connection cable of 2 m, potted cable version• Back of the hosing with large cooling ribs for optimized heat dissipation• Absolutely dust- and waterproof (IP6K7 – 6K9K)• Generation II > 550 lumens light output, 9 - 33 V Generation I >180 lumens light output, 9 – 33 V or 36 – 80V• Power consumption: Generation I: 7 W Generation II: 15 W

Generation II

part numbers on request12V, close range with external Xenon (HID) ballast 4th generation

1GO 996 176-39112V, close range, built-in version1GO 996 176-40112V, close range, surface mounting

1G0 996 176-701Generation I, 9 - 33 V

1GM 996 176-721Generation II, 9 – 33 V

1GM 996 136-101Generation I, 9 - 33 V 1GM 996 136-111Generation I, 9 - 33 V,pendant mounting1GM 996 136-13136 - 80 VGeneration I1GM 996 136-191Generation II, 9 - 33 V

Module 70 surface mount XENON

• Compact HID work lamp for use in cramped conditions• With external ballast unit 4th generation and D1S bulb • Homogenous close range illumination• HID version offers 2.5 times more illuminance than a halogen work lamp with a power consumption of only 42 Watts

Mo

• Co• W• Ho• HI

ha42

M

••• •

5.4

93.7

1 25136.3

55

33

93.5

47.5

111 83

1 0M

83

94.6

8 5

93

114.3

69.594

23

Page 4: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

4

AS 400

Same as AS 300 but with sturdy housingmade of diecast aluminium

AS 500

Compact, ultra heavy-duty work lamp with specialfeatures for use on mining machinery • MustADD fi ltering system• Heavy duty 3rd generation ballast unit• D2S bulb• Watertight system-protective rating: IP6K7 – 6K9K

AS 3001GA 996 242-50112 V, close range1GA 996 242-51124 V, close range1GA 996 242-52124 V, close range, heavy duty bracket1GA 996 242-53112 V, close range, heavy duty bracketpendant mounting1GA 996 242-54124 V, long range1GA 996 242-55112 V, long range

AS 4001GA 996 242-10112 V, close range1GA 996 242-111 24 V, close range1GA 996 242-12724 V, long range, heavy duty bracket

1GA 996 261-75712V, left version

1GA 996 261-76712V, right version

AS 300

• Xenon (HID) work lamp with integrated ballast unit (4th generation) • Handle recess is integrated in the plastic housing• HID version offers 2.5 times more luminance than a halogen work lamp with a power consumption of only 42 Watts• With DEUTSCH plug and 2 m connection cable from sealed metal screw fi xture (further plug versions on request)• Special mounting base made of stainless steel with high sophisticated vibration damping for extreme impact and vibration loads• Available with close range or long range light distribution• Available with D1S as well as D2S bulb• Watertight system-protective rating: IP6K7 – 6K9K

OVAL 100 Xenon Integral for vertical mounting

• Xenon (HID) work lamp with integrated ballast unit (4th generation) • HID version offers 2.5 times more illuminance than a halogen work lamp with a power consumption of only 42 Watts• Vertical mounting on tubes max. Ø28 mm, min. Ø 15 mm• Close range illumination with clear lens• With DEUTSCH plug • Allowed vertical swivelling +/- 35°

• X ((• HH hhh o • V

m m• CCC•• WW• • AAA

part numbers on request

4

Page 5: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

5

OVAL 100 Xenon Integral with handle

• Xenon (HID) work lamp with switch and integrated ballast unit (4th generation) and D1S bulb• HID version offers 2.5 times more illuminance than a halogen work lamp with a power consumption of only 42 Watts• 2 different light distributions available: close range and object illumination• Designed packaging for Xenon (HID) versions with bracket• Special magnetic base cover available• With AMP plug (further plug versions on request)

OVAL 100 H3 with handle

• Measurements same as above• With switch (version without switch on request)• Available either with DEUTSCH plug or grommet (AMP version on request)• H3 bulb included

Ultra Beam with prism refl ector

• Halogen work lamp with optic free lens and prism refl ector offers a homogenous close range illumination• For 12V 55W or 24V 70W H3 bulbs (not included)• Available with AMP plug• Other plug and mounting versions on request

1GA 996 261-59124V, close range1GA 996 261-61112V, close range1GA 996 261-71112V, close range, with magnetic base

1GA 996 361-78124V, with magnetic base andDEUTSCH plug, close range illumination

1GA 996 361-11112V, with grommet,close range illumination

1GA 996 361-501for H3

1GA 997 506-601for H3

OVAL 100 with prism refl ector

• Halogen work lamp with optic free lens and prism refl ector offers a homogenous close range illumination• For 12V 55W or 24V 70W H3 bulbs (not included)• Cable entry through grommet• Other plug and mounting versions on request

O

• Xb

• tc

• 2c

• v

• S• W

5

Page 6: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

6

Module 60 Work Lamp

• Compact dimensions with only 60 mm light aperture allow easy integration in customized design solutions• Despite the minimal overall size, it produces excellent light output and homogenous light distribution• Low weight • Protective rating: IP5K4K• Version with HB3 or H9 bulb available (version with H11 bulb on request)• Built-in version, mounting with 3 screws • Low beam module and high beam module available as well

Module 90 Work Lamp

• Compact work lamp with stylish FF-refl ector for a homogenous close range light distribution • Light aperture 90 mm• Clear lens for a brilliant appearance• With H9 12V/65W bulb with 2100 lumens• Protective rating: IP5K4K splash waterproof• Refl ector made of diecast aluminium lens made of hardened glass• Built-in version for mounting with 4 screws (not included)• Module 90 work lamp is also available as Xenon version with X-powerpack external ballast unit

C220 Head Lamp Flasher UnitFor surface mounting

• With H7 dipped beam optimized as head lamp for agricultural and construction machines• With H3 bulb for a homogenous, wide and farreaching illumination of the vision area without dazzle• With fl asher pointing toward front and rear• ECE approval• Mounting base can be adjusted 15° to all sides• Version for vertical or horizontal mounting, centremount or bottom-mount available. • EE = right hand traffi c, LE = left hand traffi c• All available versions are with position lamp and with DEUTSCH plug – other plug versions on request• High pressure waterproof - protective rating: IP5K9K

Design II

Design I

centre mount

For

• W lam• W fa w• W• EC

centre mount

rear side with � asherrerearereaarr sr srr idededdeid wiwi wi withthth th thht � a�a� a�a�a� a�a�aa hshesheshehherrrrrr

bottom mount

•• •

botbobobototbotbbottomtomomomomtommm mo mmmom untntunbotbototbototottomtomtomommmm momommm untunt

••• ••

Design II

Design I

• ••••• • •

1GO 996 163-08712V H9 bulb, 65 W

1EE 996 174-05112 V, bottom mount, left1EE 996 174-06112 V, bottom mount, right

1LE 996 174-11112 V, bottom mount, left1LE 996 174-12112 V, bottom mount, right1EE 996 174-13712V, vertical, centre mount

centre mount versions on request

1GL 998 570-06112V HB3 bulb 60 W,close range, design I1GL 998 570-07112V H9 bulb, 65 W,close range, design II

103

90

1 10

85

85

6

Page 7: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

7

Built-in work lamp 6182

• Compact work lamp with stylish FF-refl ector for a homogenous light distribution• Clear lens for a brilliant appearance• H9 12V/65W bulb with 2100 lumens• Protective rating: IP67• Refl ector made of diecast aluminium lens made of hardened glass• Built-in version for mounting with 4 screws (not included)• Available as H11 version as well, part number on request

Eco 21

• Low-cost work lamp for close-range application• Incl. 21 W bulb, 12 V or 24 V• Bulb socket accessible from outside, including connection cable 500 mm long• FF refl ector in the housing welded with clear lens• Projecting housing edge – to protect the plastic lens• Surface-mounted version for upright mounting• Protective rating: IP5K9K• Light aperture 88 x 88 mm• 24W 12V (BA15s) or 37,5 W (GE 893) 12V versions on request• Plastic lens and glass lens versions available

• Built(not

• Avaipart

• •••• • •••• • • •

GE Version

PicadorBuilt-in work lamp

• Compact work lamp with stylish FF-refl ector for a homogenous close range light distribution• Clear lens version available on request• Refl ector made of polyphenylene sulfi de, lens made of hardened glass• Protection rating: IP5K4K• Built-in version, mounting with 4 screws• Black rim versions on request• 24V version on request

clear lens versionlong range illuminaton

part number on request

structured lens version

1GA 996 179-02112 V, plastic lens, P21W1GA 996 179-00124 V, plastic lens, P21W

1GA 996 179-01124 V, glass lens, P21W1GA 996 179-03724 V, amber plastic lens, P21W

GE versions on request

1GA 996 182-001mid range illumination, H9

1GA 996 082-09712V, white rim, structured lens

7

Page 8: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

8

A maximum of 4 operable reversing spotlights may be fi tted per commercial vehicle/trailer.

Variant A: two additional reversing spotlights at the rear

Variant B:one additional reversing spotlight per side

Variant C:two additional reversing spotlights at the rear, plus one additional reversing spotlight on each side

Eco 21 reversing spotlight

• With special type-approval approval E4 23 262• Incl. 21 W bulb, 24 V• 12 V version available on request• Bulb socket accessible from outside, including connection cable 500 mm long• FF refl ector in the housing welded with pattern-free lens• Projecting housing edge – to protect the plastic lens• Protective rating: IP5K9K

Ultra Beam reversing spotlight with clear lens

• Different light distribution compared to the work lamp• With special type-approval (approval number pending)• Including AMP plug• For pendant and upright mounting• Protective rating: IP6K9K• GGVS/ADR approved

Only reversing spotlights with a correspondingtype-approval symbol are approved for additionalmounting to the commercial vehicle and trailer.

For further information- refer available brochure (9Z2 999 123-574) or the poster with all available reversing spotlights

• Two additional reversing spotlights at the rear for commercial vehicles, buses and trailers with a length of more than 6 m.• In addition, one reversing spotlight on each side for commercial vehicles, buses and trailers with a length of more than 6 m.

Here’s how to create optimum visibility conditions.From July 2006, the legislature permitted a total of four reversing spotlights.

w

• • ••••••••

Otmmm

h llllll ililill bbbbbbl i ttllltlt ii htttt

2ZR 996 179-70124 V

2ZR 996 506-50124 V

8

Page 9: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

9

OVAL 100 with 1+1 electronics

• To guarantee increased safety and reduced machine downtime the 1+1 switch-over system for double beam versions is available on request. • A special circuit allows to confi gure double beam work lamps in the way that as soon as one fi lament fails the second bulb takes over immediately. The LED readout shows the current status of the bulb.

X-powerpack ballast unit

• EMC class 5 according to CISPR25 for absolutely disturbance free radio and wireless• High-pressure waterproof system (IP6K7-6K9K)• Usable for D1s or D2s Xenon (HID) burners• Usable in combination with different work lamps – refer pages 16 and 17

Time Delay Relay for Interior lamps

• Time delay for 7 sec. and dimming • Connection: Pin1=Door contact, Pin2=Interior lamp, Pin3=+ Ub, Pin4=GND• With CE approval• Voltage 12 V (9 – 16 V), 24 V on request• Max. Load: 50 W• Dimensions: 30 mm x 62 mm• Connector pin: AMP Faston 6,3 x 0,8• Other time delay durations on request.

ISO/NASO Flasher Unit

• Modularity between US and Europe fl asher units – same connector type• Operational reliability and friendliness• “Simple” usability as hazard warn switch• IP67 • Voltage range 9 – 16 V• Sealed electronic inside the housing• e1 approval for ISO

LED oval combination rear lamp

• Rear lamp is equipped with a total of 24 LEDs and has a clear lens cover • The indicator function has patented electronics for the indicator failure check. • Horizontally and vertically mounting possible. • The multi-voltage light can be turned through 180 degrees and can be used on both the right and the left side.• 2 body fastening screws and 100 mm harness are included • ECE and SAE type-approved versions

5HE 010 313-00112V for interior lamps with bulbs or LEDs

4 DN 009 508-007ISO

4DN 009 508-017NASO

OVA

• Tomafor

• A swofai

Th

• •••

••••

X-po

• EMC distu• High• Usa• Usa

refe

2SD 344 390-017 ECE2SD 344 390-027 SAEstop-, tail and fl asher light2SB 344 390-097 ECE2SB 344 390-097 SAEstop-, taillight2BA 343 390-077 ECE2BA 343 390-087 SAEfl asher2SA 343 390-037 ECE2BA 343 390-047 SAEstoplight2DA 343 390-057 ECE2DA 343 390-067 SAEtaillight

125

55

103

1 41

129

6.4

56

5.4

29

part numbers on request

part numbers on request

9

Page 10: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

10

Mini Oval LED

• With four white LEDs and a red or blue LED which are arranged behind a brilliant, clear lens. • Ambient lighting with colour LED (blue or red, as desired) can be switched additionally • Protective rating: IP69• Current consumption 12 V approx. 1.46 A at 6 W

Oval interior Lamp

• Flush mounting• Broad illumination, warm white light• Available with / without reading spotlight (narrow illumination)• Transparent lens, black housing• Electrical connection through blade connector• Choice of screw type or snap-type fastening possible• Protective rating: IP3

Interior lamp 4916

• Functions: on / off / door • Housing and lens made of plastic• Installation dept 23 mm • Available with clear and black housing• Mounting either with 2 screws or with snap fastening• Including bulb (C10W, 12V), wire harness (150 mm) and AMP plug (3 tabs 6.3)

• • • • • • •

• W a• A a• • C

I

••••• •

Reading lamp 4074

• With adjustable spot • Including on / off switch• Housing and lens made of impact resistant plastic• Installation depth 44 mm • Mounting with snap fastening• Including bulb (WY5W, 12V), wire harness (150 mm) and AMP plug

2JB 343 570-011with frame and switch2JB 343 570-011without frame

46

7 0

50

2 JA 964 916-007grey housing2 JA 964 916-017black housing

130

82

32

15

2AB 004 074-057black housing, amber bulb2AB 004 074-077 grey housing, amber bulb

2JA 009 294-00112V without spot lamp2JA 009 294-01112V with spot lamp and amber LED lamp2JA 009 294-02112V with spot lamp2JA 009 294-24124V without spot lamp2JA 009 294-25124V with spot lamp and amber LED lamp2JA 009 294-26124V with spot lamp

10

Page 11: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

11

Disc Horn – High Tone

• 12V, 5 amp• ECE approved• Frequency: 400 Hz• Sound level: 113 dB• Single bolt mounting • With fl at plug connectors 6.3 or Deutsch plug

Electronic Accelerator Pedalfor agricultural and construction equipment vehicles

• Combines the trusted Hella sensor technology (APS – angular position sensor) with the simple mechanical concept• Highly accurate and contact less position measurement through CIPOS technology (Contact less inductive position sensor)• Individual sensor programming• Customer specifi c “Pedal Plate “ for the pedal lever possible (not part of delivery)• Customer specifi c pedal lever setting also possible• No temperature infl uence and corrosion resistant

Heavy Duty Accelerator Pedalfor medium and heavy commercial vehicles • Combines the trusted Hella sensor technology (APS – angular position sensor) • Highly accurate and contact less position measurement through CIPOS technology (Contact less inductive position sensor)• Signal behaviour: Two output signals „half scale“• Individually sensor programming • Robust against mechanical tolerances (no calibration of pedal to engine ECU at vehicle production line necessary)• High resolution• Robust against magnetic and electromagnetic fi elds

Electronic Floor Mounted Accelerator Pedalfor trucks, buses and construction machines

• Combines the trusted Hella sensor technology (APS – angular position sensor) • Highly accurate and contact less position measurement through CIPOS technology (Contact less inductive position sensor)• Signal behaviour: Two output signals „half scale“• Individually sensor programming • Robust against mechanical tolerances (no calibration of pedal to engine ECU at vehicle production line necessary)• High resolution• Robust against magnetic and electromagnetic fi elds• Kick down function available

f

for agricul

• Combines with the sim

• Highly accu(Contact le

• Individual s• Customer s• Customer s• No temper

Heavy DuH

• H (C•

• Sin• Wi

Deutsch plug

3AL 996 156-00712V3AL 996 156-02712V, with Deutsch plug3AL 996 156-03724V, with Deutsch plug

part numbers on request

part numbers on request

part numbers on request

11

Page 12: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

12

Signal lamps

Voltage converters

Beacons

Intellegent battery sensor

Relays

Refl ex refl ectors

Head lamps

Horns

Rotary angle sensor

Back-up alarms

nal lamps

Work lamps

Switches

Hella’s large range of lights, electronic and electro mechanic components provides a uniquevariety of versions – with a suitable solution for every application in the range somewhere.

Material Handling specifi c products

VoVoVoVoVoooVoVoVooVooVoVooVooVVV ltlttltltltltltltltltlttltlttltltlttltltltltltltltltttltltltaagaagagagaagagagagagaagaagagaaagagaaaaaggagggeeeeeeeeeee e eeeee eee eee eeeeeeeee cocoocoococoocooocoocooococooocoooooocooocococccoconvvvvvvvvvnvvvvvvvvvvererereeerreererere tetetetetetetetettetettettetettttetteetteers

BeaconsBeacons

InInnInnInInnntetetetetetetetteteeeeteeetetetetetelllllllllllllllllllllllllllllllllll egegegegegegeggegeegegegeegegegeeggegeeeeeeegeee enenenenenenenenenenenneneeenne t ttttt t t t tt ttttttttt babababababababababababababbbbabbbbabbattttttttttttttttttttttttttttttttttererererererereeereererererereeree y y y y y yy yyyy yyy sesesesesesesseseseseseseseseseseseseseseseseseseeseseseseseeseeseseseseeeseseseeeseseseseseseseseesesssensnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnnsnsnsnsnsnssssnsnsnsnsnsnsnsnsnsnsnssnnnssnnsnnsnsnnsnssssnsssnsnsssoooooooorororoooooooooooooooororooooooooooooo

Page 13: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

13

Material Handling specifi c products

Oval 100 FL

• Unique work lamp especially developed for forklifts• With 2 different light distributions that can be switched separately or simultaneously according to the needs of the customer. – lower refl ector offers a homogenous broad ground illumination, upper refl ector illuminates the high rise rack• The Free-Form (FF) prism refl ector provides a very broad an homogenous close range illumination with an optic free lens• Connection with grommet and wire harness (440 mm), other versions on request• Pendant mounting possible by rotating the lamp insert 180° (disconnection of the harness group necessary)• For 2x H3 12 V 55 W or 2x 24 V 70 W bulbs• With hardened glass lens and refl ector made of aluminium diecast• Protective rate: IP 6K9K

• •

Head lamp for fork lifts

• Compact head lamp with hardened glass lens• Low beam (H7) including fl asher lamp (PY21W) and position lamp (W5W)• Optic free lens for a brilliant appearance• Special bracket for mounting on vertical surfaces• Mounting with 2 M6 screws • Vertical swivelling +4° - +21°• Connection with DEUTSCH plug• Protective rating: IP 6K5K

H

• • • • • • • •

Lower re� ector provides a broad and homogeneous ground illumination Upper re� ector offers a concentrated illumination of the high rise rack

1GN 996 361-46112 V, grommet with wiring harness1GN 996 361-65124 V, grommet with wiring harness

1BR 996 171-10712 V

1BR 996 171-11724V

Page 14: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

14

Material Handling specifi c products

LED rear lamp

• LED rear / stop /indicator lamp with brilliant styling• Multivoltage 9-32 Volts• Very low power consumption • Active thermal control• ECE approved• Pre-wired with 500 mm or 200 mm of cable• Watertight and vibration resistant• Only on version for horizontal / vertical, left / right, 12V / 24 V• Lean surface mounting, easy to fi x , only 3 holes needed• Led rear / stop / indicator / reverse lamp without ECE approval separate available

Rotating beacon KLX1with Hella Xenon technology

• Compact, handy design (just 10 cm in height), and low weight• Symmetrical and homogenous light distribution on account of special Fresnel optics• Multi-voltage system (10-80 V) for varied applications• Operating safety with inverse polarity protection• Easy replacement of the plug-type fl ash tubes• Two versions: permanent surface-mounting with three-point fi xing (in accordance with DIN or US standard) or magnetic fi xing with plug for cigarette lighter.• Shock-resistant polycarbonate domes in amber, red, clear or green fi nishes.• Sturdy bayonet fi xing system with additional safety screw.• Easy replacement of the plug-in type fl ash tubes, fl ash rate 70 +- 15 fl ashes/min• Multi-voltage system: For all vehicles with 12 V or 24 V system.• Very low current consumption (0.1 – 0.3 A)• Rated power 4 W• Insensitive to vibration.

The KLX 1 is particularly suited to special applicationssuch as internal transport, construction and industrialplants, airports and other areas which are not part ofpublic road traffi c.The product is not approved for public road traffi cwithin the area of the European Union.

2SD 343 910-001With 500m cable open end2SD 343 910-017With 200mm cable+ AMP-super seal connector

4 function lampwithout ECE approvalpart number on request

• LED with• Mul• Very• Act• ECE• Pre

at• On lef• Le on• Le wi

• Wa

red• Stu ssaf• ••• EaEaEaa fl fl a ass•• • MuMuMu

oo oor r• VeV r•• • • RaRRaRaRaa• •• IInInI ss

• S o• M a• O• E• T• T t s l• S

r

2XD 009 224-001amber dome,permanent surface mounting

2XD 009 224-011red permanent surface mounting

2XD 009 224-101amber dome, magnetic fi xing

2XD 009 224-111red dome, magnetic fi xing

Page 15: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

15

Material Handling specifi c products

K-LED beacon

• K-LED beacons can withstand even the toughest of weather conditions.• System made of circular LED discs with 60 high-performance LEDs each combined with high-sheen refl ectors• Intensive, homogenous light image with unique 360° warning effectiveness• Alloyed aluminium housing with smooth, easy-clean light dome• Integrated MulitFLASH system enables programming of 10 different fl ash sequences• Multivoltage: 9 –32 V• LED colour amber• Modular system in an innovative design with transparent light domes.• Robust and reliable system of highpower LEDs.• Sturdy aluminium housing in various colours: orange, silver-coloured and black.• Socket and cover are alloyed, providing optimum corrosion protection.• Transparent, clear light dome made of PMMA. It is straightforward to replace.• Reliable locking through bayonet system.• Protective rating: IP 5K4K 9K • Beacons have a self-diagnosis function for the electronics which helps prevent incorrect handling. Protection from voltage peaks and inverse polarity.

“Rota Compact” FL beacon and“Rota Compact” R beacon

• Both beacons with an amber dome and a black base available• Equipped with pipe socket attachment in accordance with DIN 14620 Form A; • KL Rota Compact FL is equipped with fl exible attachment and rubber housing • KL Rota Compact R is equipped with fi xed pipe socket attachment and ABS plastic base.• Interference suppression conducted Class 3 (CISPR25)• Number of revolutions 180 RPM• Power consumption bulb 12 V 55 W or 24 V 70 W• Approvals: ECE-R65, SAE J575, SAE J595, SAE J845• Protective rating: IP 5K4K, IP 9K (resistant to high-pressure jet cleaner)

2XD 009 386-011amber housing

2XD 009 386-111housing silver

2XD 009 386-411housing black

• • •

• • •• •• ••••

•• ••••

2RL 009 506-0012RL 009 506-007 12 V, fl exible base2RL 009 506-101 2RL 009 506-10712V, fi xed pipe socket 2RL 009 506-0112RL 009 506-01724 V, fl exible base

Page 16: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

Hella Modular Systems - Xenon (HID

Ultra Beamsurface mount

Ultra Beamfl ush mount

Mega Beamsurface mount

Mega Beamfl ush mount

Oval 100surface mount

Oval 100fl ush mount

Module 70surface mount

Module 70fl ush mount

Module 90fl ush mount

3 rd generationballast unit

4 th generationballast unit

1GA 998 534-001 1GA 998 534-221

1GA 998 534-501 1GA 998 534-541

1GM 996 135-001 1GM 996 135-141

1GA 996 161-521

1GM 996 135-501

1 GA 996 161-501 1GA 996 461-151

page 3

1G0 996 176-101

1G0 996 163-021

page 3

1G0 996 176 101

1GA 998 53

1GA 996 161 521

1 GA 996 161

Page 17: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

D) Work Lamps4 th generation

ballast unit X-powerpack X-powerpackintegral integral external

partnumbers on request

page 5

page 2 1GA 998 534-581

page 2

page 2

page 2

2

2

e 5

2

Page 18: Agricultural, Construction and Utility Machinery New Products · Module 70 surface mount XENON • Compact HID work lamp for use in cramped conditions • With external ballast unit

Hella Fahrzeugteile Austria GmbHTarget Group Agricultural, Construction and Utility MachineryA-1100 Vienna, Hebbelplatz 5Tel.: +43(1)606 89 20, Fax: +43(1)606 88 50Internet: www.hellaagro.com, E-Mail: [email protected]

Requirements and tests according to Hella standard N67001Requirement class 3

Protection against penetration Degree of protection IP5KX-of solid foreign objects DIN 40050-9 and acc. toincluding dust SAE J5752 resp.

Protection against water Splash water test acc. to HN67007-03High-pressure cleaner testacc. to DIN 40050-9 (IPX9K)and possibly acc. to HN67007-02 Leak test withliquids containing tensidesacc. to HN 67007-06

Resistance to Test acc. to HN 67017-02fogging

Heat resistance in 1 h bei 50°C; headlamps inoperating condition addition 48 h at + 23° in still

air. For KSS5 in addition 1hwith 80% dirty diffusing lens.Test acc. to HN 67009-02and acc. to SAE J575 resp.test acc. to HN 67009-062

High and low temperature Without reflectors 2h at 80° Cresistance, appliance not in +2 h at 40°C;operation with reflex reflectors 48 h

+65°C + 2h –40°C;headlamps 2h 90°C + 2h.–40°

Resistance to temperature Following 30 minutes ofshock operating in moving air,

immersion in water having atemperature of +20°C

Resistance to –mechanical shock

Resistance to Headlamp must withstand afree fall dropping test from a height of

30 cm on 6 sides without anyhidden damages

Resistance to Externally mountes headlampmechanical impact must withstand penduium

impact from the side with 5joules without damage

Vibration resistance Wide band random 0,1g2/HzTest acc. to SAE J5752)

Resistance to fuel Test acc. to HELLA-NormN 67016-01

Adhesive strenght of the Test acc to DIN EN ISO 2409coating requirement: Gt 1 bis 2

Corrosion resistance salt Test 144 h SS - DIN 50021spray fog test (SS)

Condensation water constant Test acc. to DIN 50017 –atmosphere (KK) device in operation 48 h – KK

Modified Corrodite Test acc. to DIN EN ISO 4541test 1 cycle (only in case of

surfaces chromium-plated fordecorative purposes)

After the tests the function of the devices must still be guaranteed (except evaluations of electrolytic reactions and burning behaviour).2) Applies only to U.S. devices

Requirement class 4

Degree of protection IP5KX-DIN 40050-9 and acc. toSAE J5752 resp.

Splash water test acc. to HN67007-01High-pressure cleaner testacc. to DIN 40050-9 (IPX9K)and possibly acc. to HN67007-02 Leak test withliquids containing tensidesacc. to HN 67007-06.Mud deposit test acc. to HN67007-05.

Test acc. to HN 67017-02

1 h at 50°C; headlamps inaddition 48h at +23°C in stillair. For KSS5 in addition 1hwith 80% dirty diffusion lens.Test acc. to HN 67007-02and acc. to SAE J575 resp.test acc. to HN 67009-062.

Without reflectors 2h at 80°C+ 2h at –40°C;with reflex reflectors 48h+65°C + 2h –40°C;headlamps 2h 90°C +2h–40°C

Following 15 minutes ofoperating in still air,immersion in water having atemperature of +20°C

A peak acceleration of 40 gmust be survived withoutdamage(50 shocks each in all 3 axeshalf-sine form, duration 6 ms)

Headlamp must withstand adropping test from a height of30 cm on 6 sides without anyhidden damages

Externally mounted headlampmust withstand penduiumimpact from the side with 10joules without damage

Test acc. to SAE J5752

extended test duration 4h

Test acc. to HELLA-NormN 67016-01

Test acc. to DIN 50017 – 48hrequirement; Gt 1 to 2

Test 144 h SS - DIN 50021

Test acc. to DIN 50017 – 48 h – KK

Test acc. to DIN EN ISO 45411 cycle (only in case ofsurfaces chromium-plated fordecorative purposes)

Requirement class 9

DIN 40050-90 degree ofprotection IP5KX and acc. toSAE J5752 resp.

High-pressure cleaner testacc. to DIN 40050-9 (IPX9K)and possibly acc. to HN67007-02 Leak test withliquids containing tensidesacc. to HN 67007-06.Mud deposit test acc. to HN67007-05.

Test acc. to HN 67017-02possibly rain track test acc.to HN 67007-07.

1 h at 50°C; headlamps inaddition 48h at +23°C in stillair. For KSS in addition 1hwith 80% dirty diffusion lens.Test acc. to HN 67009-02and acc. to SAE J575 resp.test acc. to HN 67009-062.

Without reflectors 1h +80°C+ 2h –40°C – test acc. to HN67011-02; with reflexreflectors: 48h +65°C +2h –40°C; headlamps 2h +90°C +2h –40°C – test acc. to HN67011-03

Following 30 minutes of operationin moving air, immersion in waterhaving a temperature of 20°C.Test acc. to HN 67012-02

DIN EN 60068-2-32 andSAE J12112 resp.

HN 67013-12Vertical: 5,8g / 16 h -horizontal: 3,8g / 16 hwith T-cycls 2

Test acc. to DIN 50017 – 48hrequirement; Gt 1 to 2

Test 144 h SS - DIN 50021(extended test)

Test acc. to DIN 50017 – 48 h – KK

Test acc. to DIN EN ISO 45411 cycle (only in case ofsurfaces chromium-plated fordecorative purposes)

Requirement class 10

DIN 40050-90 degree ofprotection IP5KX and acc. toSAE J5752 resp.

High-pressure cleaner testacc. to DIN 40050-9 (IPX9K)and possibly acc. to HN67007-02 Leak test withliquids containing tensidesacc. to HN 67007-06.Mud deposit test acc. to HN67007-05.

Test acc. to HN 67017-02possibly rain track test acc.to HN 67007-07.

1 h at 50°C; headlamps inaddition 48h at +23°C in stillair. For KSS in addition 1hwith 80% dirty diffusion lens.Test acc. to HN 67009-02and acc. to SAE J575 resp.test acc. to HN 67009-062.

Without reflectors 1h +80°C+ 2h –40°C – test acc. to HN67011-02; with reflexreflectors: 48h +65°C +2h –40°C; headlamps 2h +90°C +2h –40°C – test acc. to HN67011-03

Following 30 minutes of operationin moving air, immersion in waterhaving a temperature of 20°C.Test acc. to HN 67012-02

Test acc. to HN 67013-09(40g, 50 shocks eachin all 3 axes, half shine formduration 6 ms)

DIN EN 60068-2-32 andSAE J12112 resp.

HN 67013-12Vertical und horizontal:9,6g / 7 h with T-cycle 2 andHN 67013-07

Test acc. to DIN 50017 – 48hrequirement; Gt 1 to 2

Test 144 h SS - DIN 50021(extended test)

Test acc. to DIN 50017 – 48 h – KK

Test acc. to DIN EN ISO 45411 cycle (only in case ofsurfaces chromium-plated fordecorative purposes)