ADME Studies in Knockout Rats Lacking Key Drug Transporters
Kristen BettingerGlobal Product Manager
Agenda
• Introduction
• ADMET Knockout Rats
• Current R&D Development
• Custom Model Development
• Summary
Historical Use of Animals
384-322 BCE Aristotle among the first to perform experiments on
living animals
1600s William Harvey described the
movement of blood in mammals
1700s Antoine Lavoisier used a guinea pig in a calorimeter to prove that respiration was
a form of combustion
1880s Louis Pasteur demonstrated the
germ theory of medicine by giving anthrax to sheep
1890s Ivan Pavlov used dogs to describe
classical conditioning
1980s Mario Capecchi pioneered
recombinant KO technology in mouse ES cells
ES Cell Targeting in Mice
Mosaic Founder
Pseudopregnant femaleTransfer blastocyst
Inject ES cells into mouse blastocyst
Limitations of ES Cell Targeting
• Mosaic founders
• Long process (12-18 months)
• Limited in strain
• Not widely adapted to other animal species
What about ES Cell Gene Targeting in Rats?
• ES cells have only recently been isolated from rats• Buehr, M. et al., Capture of authentic embryonic stem cells from rat blastocysts. Cell 135:1287–1298
(2008)
• Rat ES cells can be genetically manipulated to produce genetically engineered rats
• Li, P. et al., Germline competent embryonic stem cells derived from rat blastocysts. Cell 135:1299–1310 (2008)
• Tong, C. et al., Production of p53 gene knockout rats by homologous recombination in embryonic stem cells. Nature 467:211-215 (2010)
• Tong, C. et al., Generating gene knockout rats by homologous recombination in embryonic stem cells. Nature Protocols 6:827-844 (2011)
For more than 25 years, the scientific community has looked to expand the breadth of organisms possible and shorten timelines
Overcoming the Limitations: Zinc Finger Nuclease Technology
The Result…• We now have the ability to create targeted knockouts in the most appropriate models, including the rat
Geurts, et al., 2009
Lab Mission
• Focus on modified model organism to address unmet needs
• ADME/Toxicology• Neurobiology• Cardiovascular• Metabolism• Immunology/ Inflammation
• Provide rapid custom services
• Build a repository to develop, acquire, characterize, and distribute knockout rat models
Why The Rat?
• Physiology• More reflective of humans
• Behavior • Rats superior cognitive function over mice
• Technical advantages• Tissue harvest & biological fluid sampling• Surgical manipulations• Better tolerance of longitudinal dosing• Improved resolution of tumor location
in vivo imaging
Agenda
• Introduction
• ADMET Knockout Rats
• Current R&D Development
• Custom Model Development
• Summary
Why ADMET?
• Pressure to reduce costs
• Predict safety issues sooner
Existing transporter assays are non-definitive•Chemical inhibitors
•Non-selective
ADMET Knockout Rats -
Mdr1a, Bcrp, Mrp1, Mrp2, and p53• Improved predictability of assays
• Knockout is preferred over inhibitor assays• Additional models to correlate results • Rat is preferred species
• Enables clinical testing sooner• Faster assessment of the safety of
preclinical compounds • Saves valuable resources
Mdr1a Knockout Rat
• Mdr1a gene encodes for the P-glycoprotein (P-gp)• Efflux transporter across blood/brain barrier and intestine• Implicated in drug resistance
• Homozygous knockout (no functional protein)
• 20 base pair deletion within exon 7• No detectable P-glycoprotein via
western blot• Sprague Dawley background strain
+Mdr1a (+/+) Mdr1a (-/-)
S4 S3 S3 S3 S4 S3 S3 S3
Amount Loaded
Protein Fraction
Mdr1a
Actin
KO:
tggaagctaactcttgtgattttggccatcagc-------------------ctggtatttgggc
WT:
tggaagctaactcttgtgattttggccatcagccctgttcttggactgtcagctggtatttgggc
Mdr1a –
Drugs Known to Interact with P-gp
• Cancer Chemotherapy• Doxorubicin• Daunorubicin• Vinblastine• Vincristine• Paclitaxel• Teniposide• Etoposide
• Immune Response• Cyclosporine A
• Antihistamine• Terfenadine
• Cardiac Drugs• Digoxin• Quinidine• Posicor• Statins
• Others• Ivermectin• Abamectin• Loperamide• Colchicine• Erythromycin
Oral Absorption of Digoxin
in Mdr1a Knockout Rats
Differential Expression Levels of the Drug Transporter Family in Mdr1a Knockout Rats
Liver Kidney
0
50
100
150
200
Mdr1a Mrp1 Mrp2 BCRP
Gene Name
Expression (%
)
WT
KO
020406080100120140160180
Mdr1a Mrp1 Mrp2 BCRP
Gene Name
Expression (%
)
WT
KO
Mdr1a Plays a Significant Role in Several Biosynthetic and Metabolic Pathways in the Liver
WT KO
Up Regulated Pathway P Value Down Regulated Pathway P ValueSterol Biosynthetic Process 1.28E‐23 Pheramone Binding 2.15E‐12Cholesterol Biosynthetic Process 7.41E‐21 Odorant Binding 6.19E‐11Sterol Metabolic Process 6.28E‐18 Carboxylic Acid Metabolic Process 1.58E‐06Cholesterol Metabolic Process 1.81E‐15 Oxoacid Metabolic Process 1.58E‐06Steroid Biosynthetic Process 8.73E‐17 Organic Acid Metabolic Process 1.96E‐06Cell Division 2.38E‐15 Cellular Ketone Metabolic Process 1.96E‐06
Bcrp
Bcrp
Knockout Rat
• Bcrp gene encodes for the Abcg2 transporter• Drug transport across blood/brain barrier, liver, intestine, and placenta• Multiple drug resistance • Chemically induced birth defects
• Homozygous knockout (no functional protein)• 588 base pair deletion • No detectable protein via western blot• Sprague Dawley background strain
• Characteristics• Decreased elimination of substrate drugs
Bcrp
–
Drugs Known to Interact with Bcrp
Substrates• Topotecan• Mitoxantrone• Flavoperidol• Diflomotecan• Methotrexate• Sulfasalazine• Prazosin• Benzoylphenylurea• Cimetidine• Dantrolene
• Inhibitors• Oestrone• 17β-oestradiol• Fumitre-morgin C
Dantrolene
Levels in Bcrp
Knockout and Wild Type Rats
Oral Absorption of Sulfasalazine
in Bcrp Knockout Rat
Jonker, et. al. 2002. PNAS
Mrp1 Knockout Rat
• Mrp1 gene encodes for the Abcc1a transporter• Efflux transporter across liver• Implicated in multiple drug resistance
• Homozygous knockout (no functional protein)• 43 base pair deletion • No detectable protein via western blot• Sprague Dawley background strain
Wild-Type Mrp1 (-/-)
Mrp1
Actin
Anticancer• Doxirubicin• Anthracycline• Etoposide• Methotrexate
Mrp1 –
Drugs Known to Interact with Mrp1
Others• Ritonavir• Saquinavir• Verapamil• Cyclosporin A• Agosterol A• Fluorescein
Plasma Concentration of Fluorescein
in Mrp1 Knockout Rats
Mrp2 Knockout Rat
• Mrp2 gene encodes for the Abcc2 transporter• Efflux transporter across liver, small intestine, kidney• Implicated in multiple drug resistance
• Homozygous knockout (no functional protein)• 726 base pair deletion • No detectable protein via western blot• Sprague Dawley background strain
• Characteristics• Compromised biliary excretion resulting in hyperbilirubinemia
Mrp2 –
Drugs Known to Interact with Mrp2
Substrates• Cisplatin• Doxorubicin• Methotrexate• Glutathione• Etoposide• Valsartan• Mitoxantrone
Inhibitors• Cyclosporine• Delaviridine• Efavirenze• Emtricitabine
Glutathione Levels in Mrp2 Knockout Rats
500.00
600.00
700.00
800.00
900.00
1000.00
1100.00
1200.00
Con
cent
ratio
n of
GSH
(uM
)
Mrp2 (-/-) X. Chu, 2006. PharmacologyWT
Application of p53 Knockout Rat -
Faster Carcinogenicity Screening• FDA requires early carcinogenicity assay
• Mouse and Rat • 2 year study• Multiple doses• Groups of 50 animals• $500,000 or more to conduct for a single compound
• Tp53 Knockout Mouse • Approved by FDA• 6 month assay• Rat still required!
p53 Knockout Rat
• Heterozygous knockout (one allele has mutation)• One copy of Tp53 functions normally• One copy carries a deletion within Tp53 gene
– 14 base pair deletion within exon 3
• Homozygous animals have no detectable p53 protein via western blot
• High degree of early tumor formation and malignancy
• Sprague Dawley background strain
75 kDa
50
37
50
37
p53
Actin
Kidney Liver Kidney Liver
Wild-type P53 (-/-)
p53 Knockout Rat
p53 Rat Kaplan-Meier Curve
n=27
n=31
n=39
Summary of Initial Data
• Drug transporter knockout rats serve as more specific tools to replace existing experiments using wild-type rats and substrate inhibitors
• Selective• More relevant information obtained• Reduce number of animals and experiments needed• Rats are preferred over mice for toxicology studies
Agenda
• Introduction
• ADMET Knockout Rats
• Current R&D Development
• Custom Model Development
• Summary
Models in Development
Nuclear Receptors (Repsonse)• PXR• CAR• PXR/CAR
• Available end of 2011
SLC Transporters• Oat1• Oat3• Oct1• Oct2• Oatp1b3• Oct1/Oct2• Oat1/Oat3
Humanized Transporters• Mdr1a• Mdr1a/b
Agenda
• Introduction
• ADMET Knockout Rats
• Current R&D Development
• Custom Model Development
• Summary
Looking Beyond the Rodent…..
The Rabbit as a Model
• Cardiovascular disease• Ocular• Dermal• Joint• ADMET
*
*
Microinjection StatisticsSession 1 Session 2 Session 3 Session 4 Total
Embryos Collected 207 119 120 111 557
Embryos Microinjected 196 98 96 75 465
Embryos Transferred 122 76 68 60 326
Rabbits Born 9 1 2 4 16
Embryos Collected/Rabbits Born 35Embryos Microinjected/Rabbits Born 29Embryos transferred/Rabbits Born 20Positive Founders Generated 3
Summary
SAGEspeed™ custom model creation platform• Rat/ Mouse/Rabbit• Any strain• Founder animals produced in as little as 5 months
• ADMET• Mdr1a• Mrp1• Mrp2• Bcrp• PXR• p53
Immunodeficiency• Rag1• Rag 2• DNAPK• Foxn1
• Neuroscience• BDNF• DISC1• Lrrk1
• Park2• Park7• DJ-1• Lrrk2
Cardiovascular• Apoe• Leptin• Ldlr
Exclusive catalog of knockout rats• Ready to ship cohorts• Global distribution • AAALAC facility
Acknowledgements
• Xiaoxia Cui, PhD• Diana Ji• Rachel Henry• Iara Carbery• Jason Books• Kevin Gamber, PhD• Michelle Strake• Deb Knoerzer• Phil Simmons• Edward Weinstein, PhD
Top Related