Supplementary Fig. 1.
(a) Vector map of pCX-EGFP vector construct.
(b) Vector map of Amh-Ires2-Egfp vector construct.
(c) Vector Map of Bucsn2-Ires2-Egfp Vector Construct.
(d) Vector map of Fetuin-A –shRNA vector construct.
Supplementary Table 1 : Primer sequence used for genotyping of transgenic lines
Si. No.
Constructs Primer 5’ 3’ T anneal
(0C)Product
Size (bp)
1 pCX-Egfp F: CGACAACCACTACCTGAGCAR: AGCCAGAAGTCAGATGCTCAA
60 300
2 Amh-IRES2-Egfp F: AAGCCCTTTGAGACAGTCGCR: ATATAGACAAACGCACACCG
62 295
3 Fetuin-A shRNA F: GACGGTACAGGCCAGACAATR: TTCTCTGTCCCACTCCATCC
61 292
4 Bucsn2-IRES2-Egfp F: GAAACAATCTAGTCAATCCAAGR: ATATAGACAAACGCACACCG
62 900
Supplementary Table 2:
DNA concentration and conditions used while standardizing in vivo Testicular
transfection using linearized pCX-EGFP plasmid suspended in Tris-HCl solution.
Abbreviation used. DOI: date of injection, Conc.: Concentration, Vol.: Volume, amt.:
Amount, Highlighted row depicts the most suitable condition of in vivo testis
transfection Used in this study. + denotes minimum and ++++ denotes maximum
fluorescence.
Supplementary Fig. 2.
PCR genotyping of the offspring obtained from fore founder AU 4 & AU 5
transfected with pCX-Egfp. AU 4 & AU 5 were mated with wild type (Wt) female
mice. Pups of the G2 generation were generated by mating males and females of
slot blot positive animals (C11 & C16) from G1 generation. ‘C #’ denotes
transgenic animal of pCX-Egfp line from FVB/J strain. Wt denotes wild type mice.
NT denotes no template. +ve denotes plasmid DNA.
Supplementary Fig. 3.
Slot blot analysis of the PCR positive progeny obtained from the fore founder
males AU 4, AU 5 and founder animals C 11 and C 16. C 3 – C 18 (G1
generation pups of AU 4 & AU 5); C 19 – C 32 (G2 generation pups of C 11 & C
16); Wt1-Wt4 gDNA from four different wild type mice. pCX-Egfp fragment was
used as positive control. The gDNA were hybridized with GFP probe isolated
from pCX-Egfp plasmid by restriction digestion. ‘C #’ denotes transgenic animal
of pCX-Egfp line. Wt - denotes wild type mice. +ve denotes plasmid DNA
fragment.
a
Supplementary Fig. 4.
(a) PCR genotyping of the offspring using genomic DNA (gDNA) obtained
from fore founder MG 1 & MG 2 transfected with Amh-IRES2-Egfp. MG 1 &
MG 2 were mated with wild type female mice. MG denotes the forefounder
animal of Amh-IRES2-Egfp. MT denotes transgenic animal of Amh-IRES2-
Egfp line. Wt denotes wild type mice. NT denotes no template. +ve denotes
plasmid DNA.
Supplementary Fig. 4.
(b) Slot blot analysis of the PCR positive progenies obtained from the fore founder
males MG 1, MG 2 and founder animals MT 5 and MT 21. MT 3- MT 33 (G1
generation pups of MG 1 & MG 2); MT 42- MT 60 (G2 generation pups of MT 5 &
MT 21); Wt1-Wt4 gDNA from four different wild type mice. Ires2-Egfp fragment was
used as positive control. The gDNA were probed with Ires2-Egfp fragment isolated
from Amh-Ires2-Egfp plasmid by restriction digestion. MT - denotes transgenic animal
of Amh-Ires2-Egfp line from FVB/J strain. Wt– denotes wild type mice.
(c) Shows restriction pattern and probe binding region for southern blot analysis.
b
BamHI
1.3kb 4kb
Total length of delivered transgene (~5.3kb)
c
Probe
b
a
Supplementary Fig. 5.
(a) Absence of EGFP expression in Liver (i & ii) ; Spleen (iii & iv) ; and skin (v &
vi) of 5 days old Amh-Ires2-Egfp transgenic mouse. Scale bar: i - iv 20 µm; v & vi
50 µm.
(b) EGFP expression in testicular section of adult (42 days old) Amh-Ires2-Egfp
transgenic mouse. Note: non-specific staining in interstitial area. Scale bar: 50 µm.
Supplementary Fig. 6.
PCR genotyping of the offspring using gDNA obtained from post weaning tail
biopsies of progeny generated from fore founder TBa and TBc transfected with
Bucsn2-Ires2-Egfp. Fore founder TBa and TBc were mated with wild type
female mice. Pups of the G2 generation were generated by mating males and
females of PCR positive animals from G1 generation (TBc 1 & TBc 7).
Lanes 1-7: TBa 1 - TBa 7. Lanes 8-17: TBc 1 – TBc 10. Lanes 22-30: TBc 18-
TBc 26. Lanes 18-19 and 32 & 34 : gDNA of Wt mice as negative control.
Lanes 20 & 36: no template. Lanes 21 and 38: Bucsn2-Ires2-Egfp plasmid
DNA as positive control
22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38
TBc7TBc1
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
WtTBa
G1
G2
WtTBa
EGFP 28Kda
β-actin 42 kda
b
Supplementary Fig. 7.
(a) Slot blot analysis of the PCR positive progenies obtained from the fore
founder males TBa, TBc and founder animals TBc 1 & TBc 7. TBa 1- TBa 7
(G1 generation pups of TBa); TBc 1 – TBc 10 (G1 generation pups of TBc);
TBc 18 – TBc 26 (G2 generation pups of TBc 1 & TBc 7); WT1-WT4 gDNA
from four different wild type mice. Bucsn2-Ires2-Egfp fragment was used as
positive control. The gDNA were probed with Ires2-Egfp fragment isolated from
Bucsn2-Ires2-Egfp plasmid by restriction digestion. TBa (#) and TBc (#) -
denotes transgenic animal of Bucsn2-Ires2-Egfp line from FVB/J strain. TBa &
TBc - denotes fore-founder animals of Bucsn2-Ires2-Egfp. Wt - denotes wild
type mice.
(b) Protein from mammary glands of three different transgenic females and two
different wild type mice was probed with GFP antibody. GFP expression (~28
kDa) was observed in transgenic mice whereas there is no GFP signal in wild
type mice. β-actin expression was observed in all the samples probed.
aTBa 1
TBa 2
TBa 3
TBa 4
TBa 5
TBa 6
TBa 7
TBc 1
TBc 2
TBc 3
TBc 4
TBc 5
TBc 6
TBc 7
TBc 8
TBc 9
TBc 10
TBc 18
TBc 19
TBc 20
TBc 21
TBc 22
TBc 23
TBc 24
TBc 25
TBc 26
Wt 1
Wt 2
Wt 3
Wt 4
+Ve
+Ve
Supplementary Fig. 8.
Slot blot analysis of the progeny obtained from the fore founder males 1FT,
2FT, and 3FT. 1FT1-1FT7 (G1 generation pups of 1FT); 2FT1-2FT17 (G1
generation pups of 2FT); 3FT1-3FT12 (G1 generation pups of 3FT); Wt1-Wt4
gDNA from four different wild type mice. FT - denotes Fetuin- A shRNA
expressing transgenic mice. Wt – denotes wild type mice.
Supplementary Table 3:
Table showing the inheritance of transgene in G1 and G2 progeny of fore
founder mice generated by present procedure.
Supplementary Table 4:
Table showing comparison of occurance of transgene positive pups in
percentile, when different constructs were used as transgene.
Transgene Tg Positive Pups/Total Pups Born (in G1)
Instance of TgPositive Pups
pCX-EGFP 13/24 54.16 %
Amh-IRES2-Egfp 21/40 52.5 %
Bucn2-IRES2-Egfp 12/18 66.66 %
Fetuin-A-ShRNA 16/36 44.44 %
Average of all percentile
54.44 %
Top Related