7/29/2019 6.doc (1)
1/5
O R I G I N A L A R T I C L E
Screening and evaluation of probiotics as a biocontrolagent against pathogenic Vibrios in marine aquacultureA.V. Ravi1, K.S. Musthafa1, G. Jegathammbal1, K. Kathiresan2 and S.K. Pandian1
1 Department of Biotechnology, Alagappa University, Karaikudi, Tamil Nadu, India
2 CAS in Marine Biology, Annamalai University, Parangipettai, Tamil Nadu, India
Introduction
Aquaculture is the worlds fastest growing food-produc-
tion sector, with cultured shrimps and prawns (Suba-
singhe et al. 1998). However, there is a serious problem
with microbial disease outbreaks, leading to an annual
global loss of about US$3 billion in the shrimp-culture
industry alone (Lundin 1996). A major bacterial disease
of shrimps is vibriosis, which is caused by Vibrio species
that also indirectly affects the shrimps health by affect-
ing the water quality and stress (Lightner 1996; Sung
et al. 2001). Conventional approaches, such as the use of
disinfectants and antimicrobial drugs to control diseases,
have had limited success in the prevention or cure of
aquatic diseases. The massive usage of commercially
available antibiotics results in natural emergence of
antibiotic-resistant bacteria, which can transfer their
resistance genes to other bacteria that have never been
exposed to the antibiotics (Austin et al. 1995; Moriarty
1997). This has led to suggesting the usage of nonpatho-
genic bacteria as probiotic biocontrol agents instead of
antibiotics (Fuller 1978; Gatesoupe 1999; Mishra et al.
2001). A few species of bacteria, such as lactic acid
bacteria and Bacillus species, which constitute a large
part of microflora of gills, skin and intestinal tracts of
shrimps, are attempted as probionts against fish and
shellfish pathogenic bacteria (Skjermo and Vadstein
1999; Rengipipat et al. 2000). This probiotic approach to
disease control is not used much in shrimp larval
culture, and there are only a few reports on probiotics.
The present investigation has been made to screen pro-
bionts from marine samples against pathogenic Vibrios
isolated from infected fish and to evaluate the potential
of probiont in vivo and in vitro.
Keywords
Bacillus cereus, Paenibacillus polymyxa,
Penaeus monodon, probiotic, shrimp culture,
Vibrio.
Correspondence
A. Veera Ravi, Department of Biotechnology,
Alagappa University, Karaikudi 630 003,Tamil Nadu, India.
E-mail: [email protected]
20070079: received 18 January 2007,
revised 30 March 2007 and accepted 2 April
2007
doi:10.1111/j.1472-765X.2007.02180.x
Abstract
Aims: The present work aims at finding potential probionts from marine
sources as a biocontrol agent against pathogenic Vibrio species in shrimp larval
culture.
Methods and Results: A total of 109 bacterial strains were isolated from sea-
water, sediment and marine fish-gut samples, and were screened for their ant-
agonistic activity against Vibrio species. Three strains (Q, Q1 and M) isolated
from the marine sediment were found antagonistic against Vibrio strains. Based
on 16S ribosomal DNA gene sequence analysis, the strain Q was identified as
Paenibacillus spp. (EF012164); Q1 as Bacillus cereus (DQ915582); and the M as
Paenibacillus polymyxa (DQ915580). Further, the two bacterial species, Paeniba-
cillus spp. and B. cereus were challenged separately at two different concentra-
tions of 104 and 105 CFU ml)1 for probiotic activity in the postlarvae of
Penaeus monodon against pathogenic Vibrio harveyi and Vibrio spp.
Conclusions: The present study identified the probiotic activity of Paenibacillus
spp., B. cereus and Pa. polymyxa against the pathogenic Vibrios in the postlar-
vae of P. monodon.
Significance and Impact of the Study: In vivo study reveals that the marine
bacterial species can be used as probionts against pathogenic Vibrios in shrimplarval culture practices.
Letters in Applied Microbiology ISSN 0266-8254
2007 The Authors
Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 219
7/29/2019 6.doc (1)
2/5
Materials and methods
Target pathogens
Two strains of Vibrio harveyi (MTCC 3438) and Vibrio
vulnificus (MTCC 1145) were obtained from the Insti-
tute of Microbial Technology, Chandigarh, India. Thethird strain was isolated from the skin mucus of infected
marine fish (Hemirhampus far) and identified as Vibrio
species by growing on thiosulphate citrate bile salts
sucrose agar medium (HiMedia, Mumbai, Maharastra,
India) followed by biochemical analysis (Laurent et al.
2000). All the three Vibrio strains were used as target
organisms, against which the probiotic bacteria were
screened for antagonistic activity.
Primary screening by replica plate method
The probiotic bacteria were isolated from seawater, sedi-
ment and gut content of healthy fish (Lates calcarifer).
The seawater and sediment samples were collected from
Point Calimere, located in the Bay of Bengal (Lat.
1018N and Long. 7952E). The seawater samples were
collected using Niskin water sampler, the sediment sam-
ples by using Peterson crab, and the samples were
brought to the laboratory aseptically in an insulated con-
tainer at 4C. The fish gut content was aseptically
removed from a live healthy fish obtained from a com-
mercial fish form. The samples were serially diluted, pla-
ted on Zobell marine agar (ZMA; Hi Media, India) and
incubated at room temperature for 2448 h. The colonies
from ZMA were replica plated on the Muller Hinton agarmedium (MHA; Hi Media, India) swabbed against target
bacterial strains and incubated at room temperature for
24 h. The colonies showing the zone of clearance against
the target Vibrio strains were maintained separately in
pure cultures (Mette et al. 2004).
Well-diffusion agar assay
The potential probionts (Q, Q1 and M) were further tes-
ted for their reproducible antagonistic activity in a well-
diffusion agar against the target strains (Mette et al.
2004). The test Vibrio strains were grown overnight at
37C in a medium containing alkaline peptone water pre-
pared in 10 g l)1 (pH 78 02), and these strains at the
cell density of 104 CFU ml)1 were seeded in three con-
centrations (10, 50 and 100 ll) with 10 ml of MHA med-
ium in the Petri plates. In this medium, wells with a
diameter of 3 mm were made and filled with 10 ll of live
suspension of probiotic culture with cell density of
105 CFU ml)1 that had already grown in marine nutrient
broth at room temperature. The Petri plates were incuba-
ted at room temperature (28 1C) for 24 h and
observed for the zone of clearance.
Molecular characterization of probiont
The DNA of three probionts, such as Q, Q1 and M, was
extracted by alkaline lysis method (Ausubel et al. 1990),and 16S rDNA was amplified by using eubacterial univer-
sal primers, namely forward primer 5 AGA-
GTTTGATCCTGGCTCAG 3 and reverse primer 5
ACGGCTACCTTGTTACGACTT 3(Andrew et al. 2001).
PCR was performed with a 50-ll reaction mixture con-
taining 2 ll (10 ng) of DNA as the template, each primer
at a concentration of 05 lmol l)1, 15 mmol l)1 of MgCl2and each deoxynucleoside triphosphate at 50 lmol l)1, in
addition to 1 U of Taq DNA polymerase along with buffer
as recommended (MBI Fermentas, Hanover, MD, USA).
After the initial denaturation for 45 min at 95C, there
were 40 cycles consisting of denaturation at 95C for
1 min, annealing at 55C for 1 min and extension at 72C
for 2 min and final extension of 5 min at 72C. The
amplification of 16S rDNA was confirmed by running the
amplification product in 1% agarose gel electrophoresis in
1 TAE buffer. The PCR product of 16S rDNA of the iso-
lates was sequenced, and further comparison was made
with previously available sequences in NCBI (National
Center for Biotechnology Information) using BLAST
(Basic Local Alignment Search Tool).
In vivo inhibition of pathogenic Vibrio
Hatchery-reared postlarvae of Penaeus monodon wereacclimatized under laboratory conditions for 24 h and fed
with freshly hatched Artemia salina nauplii. They were
introduced into four sets of troughs in triplicates, each
filled with filtered seawater, salinity maintained at 10 ppt,
pH at 78 02 and temperature at 30C. Set 1 was
inoculated with probionts at 104 and also 105 CFU ml)1
in rearing medium to facilitate their attachment and col-
onization on the larvae for 24 h. The concentration of the
probiotic strains was chosen based on the results obtained
in the well-diffusion agar assay. The probiont-treated lar-
vae after 1 day were then exposed to pathogenic Vibrio
strains at 104 CFU ml)1 for 1 h. Set 2 was inoculated
with pathogenic Vibrio strains alone at 104 CFU ml)1 in
rearing medium to serve as positive control. Set 3 was
inoculated with probionts alone at 104 and 105 CFU ml)1
to rearing medium to check whether the probiont was
pathogenic to larvae or not. Set 4 received no bacterial
inoculum and served as control. The CFU ml)1 in the
overnight culture of potential probionts and pathogenic
Vibrio strains were standardized from OD measurements
at 540 nm (UV-Vis Spectrophotometer U-2800; Hitachi,
Probiotics as a biocontrol agent A.V. Ravi et al.
220 Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 2007 The Authors
7/29/2019 6.doc (1)
3/5
Tokyo, Japan). Mortality in each set was recorded for
5 days and no water exchange was made during that per-
iod (Abraham 2004).
Results
Screening for antagonistic strains
The primary screening of 109 strains, isolated from sea-
water, sediment and gut content of healthy fish, revealed
that only three strains (Q, Q1 and M) isolated from mar-
ine sediments exhibited antagonistic activity against all
the Vibrio strains. Further confirmation on the antagonis-
tic potential of those three strains against V. harveyi, Vib-
rio spp. and V. vulnificus was made using well-diffusion
agar assay. Two strains Q and Q1 were observed to dis-
play the maximum antagonistic activity against the
V. harveyi and Vibrio spp., and they were further tested
for their potential in vivo (Table 1).
16S rDNA sequence analysis of probiont
The active probiotic bacterial isolates were subjected to
the 16S rDNA sequence analysis and identified the probi-
ont Q as Paenibacillus spp., Q1 as Bacillus cereus and M
as Paenibacillus polymyxa.
Challenging test of probiont with the postlarvae
of Penaeus monodon
The in vivo mortality of the larvae after treatment with or
without probionts Paenibacillus spp. and B. cereuschallenged against Vibrios were observed for 5 days
(Figs 1 and 2). The pathogenic Vibrio strains in the
absence of probionts caused total mortality of the larvae.
However, the larvae treated with probiont B. cereus
against V. harveyi exhibited a mortality of 373% at
104 CFU ml)1 and 403% at 105 CFU ml)1. The larvae
treated with probiont Paenibacillus spp. against V. harveyi
showed a mortality of 303% at 104 CFU ml)1 and 343%
at 105 CFU ml)1. When they were treated with probiont
B. cereus against Vibrio spp., the mortality was 227% at
104 CFU ml)1 and 163% at 105 CFU ml)1. The larvae
treated with probiont Paenibacillus spp. against Vibrio
spp. exhibited the mortality of 15% at 104 CFU ml)1 and
196% at 105 CFU ml)1. Whereas, the probiont Pa.
polymyxa showed least activity against Vibrio spp. and no
activity against the other two pathogens.
Discussion
The present study confirms the potential of probionts in
both in vitro and in vivo conditions to control pathogenic
Vibrios (Table 1, Figs 1 and 2). However, Mette et al.
(2004) have observed a maximum zone of clearance up
to 23 mm when pathogenic bacteria are challenged
against probiotic bacteria in vitro analysis, but in in vivo
assay, most of the probionts are pathogenic themselves to
the larvae of Scophthalmus maximus. Contrary to this, the
bacterial strains of B. cereus and Paenibacillus spp. do not
show any significant pathogenicity to the shrimp larvae in
our studies.
In the present study, total mortality of shrimp larvae
were observed when they were treated with Vibrios alone,
which confirms that the Vibrio strains are highly patho-
genic. When the larvae are pretreated with probiont and
then exposed to Vibrios, their mortality is significantly
(P < 0001) reduced. Two bacterial species, B. cereus and
Paenibacillus spp. exhibit better probiotic activity by con-
ferring the survival of shrimp larvae up to 85% when
treated against Vibrio spp. (Figs 1 and 2). This result
finds support of other workers. Vaseeharan and Ramasa-
my (2003) have recorded 90% reduction in the mortality
of P. monodon adults when challenged by the probiontBacillus subtilis against V. harveyi. A similar effect has
been observed with marine bacterium Alteromonas spp. at
106 CFU ml)1 that protects shrimp larvae of P. monodon
against V. harveyi with 104 CFU ml)1 by reducing the
mortality to 59% (Abraham 2004). Lone et al. (1999)
have observed a significant reduction in the mortality of
25% in rainbow trout (Oncorynchus mykiss) against Vibrio
anguillarum after pretreatment with Pseudomonas fluores-
cens AH2. Furthermore, similar effects have been observed
with beneficial marine bacteria in protecting the embryos
Table 1 Antagonistic activity of probiotic strains (M, Q and Q1) as zone of clearance in mm against different concentrations (ll) of Vibrios inwell-diffusion agar assay
Probiont
Vibrio spp. Vibrio harveyi Vibrio vulnificus
10 50 100 10 50 100 10 50 100
M 1133 115 1466 057 14 10
Q 1033 057 1133 057 20 00 10 00 1166 057 1466 057 0825 026 0887 087 10 00
Q1 2166 057 3466 057 33 173 2633 115 3133 23 2633 115 2105 054 2235 078 2066 115
Values are mean SD for three observations; , no probiotic activity.
A.V. Ravi et al. Probiotics as a biocontrol agent
2007 The Authors
Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 221
7/29/2019 6.doc (1)
4/5
of Homarus americanus (Gil and Fenical 1992), oyster lar-
vae (Douillet and Langdon 1994), larvae and adults of
penaeid shrimps (Maeda and Liao 1992; Maeda 1994;
Abraham et al. 2001).
The antagonistic effect of probionts can be attributed
to the bioactive compounds produced by them to inhibit
the pathogens. In the present study, probionts, such as
Paenibacillus spp. and B. cereus, exhibit zone of clearance
against pathogenic Vibrios on diffusion agar plates. This
demonstrates the production of antibacterial compounds
that diffused through the agar inhibiting the growth of
Vibrios. Previous workers have established that antimicro-
bial compounds are produced by probionts (Vaseeharan
and Ramasamy 2003; Mette et al. 2004). Further, it is
pertinent to note that the species of Paenibacillus, like Pa.
polymyxa and Paenibacillus thiaminolyticus produce
antibacterial compounds, such as polymyxin, octopytin
and baciphelacin (Slepecky and Hemphill 1992) and
Paenibacillus koreensis also produces an iturin-like anti-
fungal compound (Chung et al. 2000). Similarly, B. cereus
produces antibacterial compounds, like zwittermicin-A
and kanosamine (Jocelyn et al. 1996).
The result reveals that strains of Paenibacillus spp. and
B. cereus are effective in inhibiting the shrimp larval path-
ogens, like Vibrio spp. and V. harveyi both in vitro andin vivo. The probionts significantly (P < 0001) reduce the
mortality and do not have any pathogenic effect on the
shrimp larvae. Therefore, these bacterial probionts can be
used effectively in controlling the shrimp larval pathogen
that may substitute the use of antibiotics in aquaculture
which otherwise causes negative impacts.
Acknowledgements
The authors are thankful to DBTs Bioinformatics Infra-
structure Facility, Alagappa University, for the compu-
tinginternet facilities provided. Ms G. Jegathammbal
acknowledges the financial assistance rendered by the
Tamil Nadu State Council for Science and Technology,
India.
References
Abraham, T.J. (2004) Antibacterial Marine Bacterium Deter
Luminous Vibriosis in Shrimp Larvae. Pp. 34. NAGA,
World Fish Centre Quarterly.
Abraham, T.J., Shanmugam., S.A., Uma, A., Palaniappan, R.
and Dhevendaran, R. (2001) Biocontrol of shrimp bacterial
pathogens using penaeid larvae associated bacterium,
Ateromonas sp. J Aquacult Trop16
, 1122.Andrew, E.A., Melissa, G.B., Marc, E.F., Peter, G.V., Jonathan,
P.Z. and Sabino, Z. (2001) Diversity and detection of
nitrate assimilation genes in marine bacteria. Appl Environ
Microbiol 67, 53435348.
Austin, B., Stuckey, L.E., Robertson, P.A.W., Effendi, I. and
Griffith, D.R.W. (1995) A probiotic strain of Vibrio algino-
lyticus effective in reducing disease caused by Aeromonas
salmonicida, Vibrio anguillarum and Vibrio ordalli. J Fish
Dis 18, 9396.
Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J.
and Struhl, K. (1990) Current Protocols in Molecular Bio-
logy. New York: John Wiley & Sons, Inc.
Chung, Y.R., Chung, H.K., Inhwan, H. and Jongsik, C. (2000)Paenibacillus koreensis sp. nov, a new species that produces
an iturin-like antifungal compound. Int J Syst Evol Micro-
biol 50, 14951500.
Douillet, P.A. and Langdon, C.J. (1994) Use of a probiotic for
the culture of larvae of the pacific oyster (Crassostrea gigas
Thunberg). Aquaculture 119, 2540.
Fuller, R. (1978) Epithelial attachment and other factors con-
trolling the colonization of the intestine of the gnotobiotic
chicken by lactobacilli. J Appl Microbiol 46, 335342.
120
100
80
60
Mortality(%)
40
20
01
Paenibacillus spp. against Vibrio harveyi Paenibacillus spp. against Vibrio spp.2 3 4
Figure 2 Percentage mortality of Penaeus monodon postlarvae when
treated with Paenibacillus spp. at: (1) 104 CFU ml)1 against Vibrio har-
veyi; (2) 105
CFU ml)1
against V. harveyi; (3) 104
CFU ml)1
againstVibrio spp.; and (4) 105 CFU ml)1 against Vibrio spp. ( ), pathogen;
( ), probiont; (+) pathogen; ( ) probiont; ( ) control.
120
100
80
60
M
ortality(%)
40
20
01
Bacillus cereusagainst Vibrio harveyi Bacillus cereusagainst Vibrio spp.2 3 4
Figure 1 Percentage mortality of Penaeus monodon postlarvae after
5 days of treatment with Bacillus cereus at: (1) 104 CFU ml)1 against
Vibrio harveyi; (2) 105 CFU ml)1 against V. harveyi; (3) 104 CFU ml)1
against Vibrio spp.; and (4) 105 CFU ml)1 against Vibrio spp. ( ) ,
pathogen; ( ), probiont; (+) pathogen; ( ) probiont; ( ) control.
Probiotics as a biocontrol agent A.V. Ravi et al.
222 Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 2007 The Authors
7/29/2019 6.doc (1)
5/5
Gatesoupe, F.J. (1999) The use of probiotics in aquaculture.
Aquaculture 180, 147165.
Gil, M.S. and Fenical, W. (1992) Embryos of Homarus americ-
anus are protected by epibiotic bacteria. Biol Bull 182,
105108.
Jocelyn, L.M., Laura, S.S., Julie, C.L., Haiyin, H., Jon, C. and
Jo, H. (1996) Production of kanosamine by Bacillus cereus
UW85. Appl Environ Microbiol 62, 30613065.
Laurent, V., Hanglamong, H., Godelieve, C., Patrick, S. and
Willy, V. (2000) Selected bacterial strains protect Artemia
spp. from the pathogenic effects of Vibrio proteolyticus
CW8T2. Appl Environ Microbiol 66, 11391146.
Lightner, D.V. (1996) A Handbook of Shrimp Pathology and
Diagnostic Procedures for Diseases of Cultured Penaeid
Shrimp. Baton Rouge, LA: World Aquaculture Society.
Lone, G., Jette, M., Bettina, S., Ingrid, H. and Torben, F.N.
(1999) Inhibition of Vibrio Anguillarum by Pseudomonas
fluorescens Ah2, a possible probiotic treatment of fish. Appl
Environ Microbiol 65, 969973.
Lundin, G.G. (1996) Fish health and quarantine. In Global
Attempts to Address Shrimp Disease. p. 45. MarineEnvi-
ronmental Paper No. 4. Land, Water and Natural Habitats
Division, Environment Department, World Bank, Rome.
Maeda, M. (1994) Biocontrol of the larvae rearing biotope in
aquaculture. Bull Natl Res Inst Aquacult 1, 7174.
Maeda, M. and Liao, I.C. (1992) Effect of bacterial population
on the growth of a prawn larvae, Penaeus monodon. Bull
Natl Res Inst Aquacult 21, 2529.
Mette, H., Oivind, B., Ana, R., Janne, N., Jette, M., Sigmund,
J., Haze, D., Peter, A., et al. (2004) Selection and identifi-
cation of autochthonous potential probiotic bacteria from
turbot larvae (Scophthalmus maximus) rearing units. Syst
Appl Microbiol27
, 360371.
Mishra, S., Mohanty, S., Pattnaik, P. and Ayyappan, S. (2001)
Probiotics possible application in aquaculture. Fish
Chimes 21, 3137.
Moriarty, D.J.W. (1997) The role of microorganisms in aqua-
culture ponds. Aquaculture 151, 333349.
Rengipipat, S., Rukpratanporn, S., Piyatiratitivorakul, S. and
Menasaveta, P. (2000) Immunity enhancement in black
tiger shrimp (Penaeus monodon) by a probiont bacterium
(Bacillus S11). Aquaculture 191, 271288.
Skjermo, J. and Vadstein, O. (1999) Techniques for microbial
control in the intensive rearing of marine larvae. Aquacul-
ture 177, 333343.
Slepecky, R.A. and Hemphill, H.E. (1992) The genus Bacillus
nonmedical. In The Prokaryotes ed. Balows, A., Truper,
H.G., Dworkin, M., Harder, W. and Schleifer, K.H. 2nd
edn. Vol. II. pp. 16631696. New York: Springer.
Subasinghe, R., Bartly, D.M., Megladdery, S. and Barg, U.
(1998) Sustainable shrimp culture development: biotech-
nological issues and challenges. In Advances in Shrimp Bio-
technology ed. Flegel, T.W. pp. 1318. Bangkok: National
Centre for Genetic Engineering and Biotechnology.
Sung, H.H., Hsu, S.F., Chen, C.K., Ting, Y.Y. and Chao,
W.L. (2001) Relationship between disease outbreaks in
cultured tiger shrimp (Penaeus monodon) and the compo-
sition of Vibrio communities in pond water and shrimp
hepatopancreas during cultivation. Aquaculture 192,
101110.
Vaseeharan, B. and Ramasamy, P. (2003) Control of patho-
genic Vibrio spp. by Bacillus subtilis BT23, a possible probi-
otic treatment for black tiger shrimp Penaeus monodon.
Lett Appl Microbiol36, 8387.
A.V. Ravi et al. Probiotics as a biocontrol agent
2007 The Authors
Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 223
Top Related