Download - 2013 UNC Asheville Track & Field Guide

Transcript
Page 1: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

1/// F E A R T H E D O G ///

Page 2: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

2 /// F E A R T H E D O G ///

Athletics Media Communication

Mike Gore Associate Athletics Director for

External Affairs / Track & Field ContactOffi ce Phone: (828) 251-6923Cell Phone: (828) 575-6649

Email: [email protected]

Matt PellegrinDirector of Athletics Media

CommunicationOffi ce Phone: (828) 251-6931Cell Phone: (828) 707-0302Email: [email protected]

Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com

Mailing Address:One University Heights

Justice Center, CPO #2600Asheville, N.C. 28804

COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.

Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.

Photographers: Photo passes are limited to working press photo-graphers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.

Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every track & fi eld meet. After the contest, each media member will receive a box score of the game.

Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the track & fi eld coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Communication representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.

Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communication Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.

MEDIA INFORMATION

UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.

UNC ASHEVILLE MISSION STATEMENT

Page 3: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

3/// F E A R T H E D O G ///

NEWSPAPERS

Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585

Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319

The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665

The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506

WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078

TELEVISION

WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618

WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430

WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305

RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310

WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835

WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875

Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteFacility: Karl Strauss TrackChancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneAssociate Athletics Director of External Affairs: Mike GoreAthletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904

PRIMARY ATHLETICS LOGO

SECONDARY ATHLETICS LOGOS

MEDIA OUTLETS

Page 4: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

4 /// F E A R T H E D O G ///

SAM BARBEAUOverview: A thrower from North Carolina...he competed in the outdoor season as a freshman...specializing in javelin.

2011-12: Competed in four competitions this outdoor season... he showed a natural ability for the throws...he set a PR for the javelin early in the sea-son at the UNCC 49ers Classic with a mark of 43.18m... later in the season he had a season best of 31.95m in the discus.

Collegiate Best Marks:

Javelin- 43.18m

Discus-31.95

JOHN BELLARDOverview: Rising sophomore who will make an impact in the horizontal jumps and javelin...he is now second all-time in the indoor triple jump and fourth al-time in the javelin.

2011-12: Opened up his season with a mark of 13.06m in the triple jump at the ASU Invitational...jumped 6.22m in the long jump at the JDL Fast Track Collegiate Invitational...had a season best at the Big South Indoor Championships with a mark of 13.12m in the triple jump... Outdoor...fo-cused on the javelin for outdoor...improved over 16m in just four outdoor competitions...his best distance for the season was at the Big South Out-door Championships with a mark of 54.83m.

Before UNC Asheville: Attended St. Thomas Academy in Mendota Heights, MN for two years... relocated to Providence High School in Char-lotte for the remainder of his education...participated on mulitple sports throughout high school...played on the USA handball team.

Collegiate Best Marks

Long Jump - 6.22m

Triple Jump - 13.12m

Javelin- 54.83mHigh Jump - 1.96m (6 ft. 5in.)

Page 5: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

5/// F E A R T H E D O G ///

RYAN BLACKMONOverview: The seasoned runner will be competing in his second year for the Bulldogs and hopes to fi nish his senior season with continued success.

2011-12: Outdoor...he competed in the 10k for the Big South Champion-ships (34:05.36).

Before UNC Asheville: A transfer from Vermont.

Collegiate Best Marks:

5k: 15:42.72

10k: 34:05.36

MILES BROWNOverview: An incoming freshman from Green Hope High School…he is ready for competition during the indoor and outdoor seasons...after set-ting a PR at at NCHSAA 4A State Championships in the 400m (49.49)… his current high school 400m time would place him 1st All-time for the Bulldogs.

Page 6: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

6 /// F E A R T H E D O G ///

RYAN CATRINEOverview: The new Bulldog is will be a great addition to the men’s dis-tance team and provide depth… he competed at the NCHSAA 4A Mideast Regional in the 800m… he received all-conference honors for cross coun-try as well for Fuquay-Varina.

JEREMY GLOWEROverview: The distance star from West Johnson placed second at the NCH-SAA 4A State Championships with a time of 9:26.38 in the 3200m run.

Page 7: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

7/// F E A R T H E D O G ///

COURTNEY HENRYOverview: Rising junior who is on the All-time list for the 100m, 200m and the long jump… a valuable member of the team who continues to make an impact in the short sprints and horizontal jumps.

2011-12: Competing in only the indoor season…he set a PR at the fi rst meet of the year with a time of 6.57 in the 55m…placing him 3rd All-time…the same day he set another PR at Appalachian in the long jump…later in the season he ran a PR of 7.17 in the 60m dash...

2010-11: Opened up his season with a mark of 12.80m (42-00) in the triple jump at the ASU Invitational...ran a collegiate bests of 23.06 in the 200m and 7.19 in the 60m at the Niswonger Invitational...had a collegiate best of 6.11m (20-0.5) in the long jump at the Kent Taylor Invitational.

Before UNC Asheville: Attended Ola High School...school record hold-er in the 100m, 200m & long jump...career bests of 11.19 (100m), 22.60 (200m), 22’3” (long jump) & 41’11” (triple jump).

Collegiate Best Marks

55m - 6.57

60m - 7.17

200m - 23.06

LJ - 6.81m

TJ - 12.43m

KURT HIBBERTOverview: Former baseball player for the Bulldogs who began his col-legiate track and fi eld career during the 2010-2011 school year...as a novice thrower he has shown unprecedented success in track and fi eld...scoring in the Outdoor and Indoor Big South Championships for the Bulldogs...he is expected to improve and carry the throws for Asheville.

2011-12: After a solid rookie year he was primed for a breakout season...starting the indoor season with a PR in the shot put (12.12m)...later in the season he had another PR in the weight throw when it counted the most at the Big South Indoor Championships (15.50m)... scoring for the Bulldogs...Outdoor...late in the season with a PR in the discus, he placed 3rd in at the Winthrop Twilight Meet (45.61m); the mark placed him fourth on the all-time list... he is now the best hammer thrower in school history with a ten meter PR in the hammer (54.47m) at Western, NC. 2010-11: New to the sport, he made an impact immediately on the team...learning two new throws for the indoor season...he set personal records af-ter only two indoor meets...shot put (10.89m) and weight throw (13.32m)...Outdoor...in less than a season he improved his shot put mark by over a foot (11.17m)...unexpected success for a new thrower he posted an im-pressive mark of 44.39m in the discus at the UNCC 49ers Classic...his consistency was present in the hammer as well (44.34m).

Before UNC Asheville: Primary sport has been baseball through his freshman year here at UNC Asheville...started throwing this summer...per-sonal bests of 133’ (Discus) & 128’ 6” (Hammer).

Collegiate Best Marks

Shot Put -12.97m

Hammer- 54.47m

Weight- 16.71m

Discus- 45.61m

Page 8: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

8 /// F E A R T H E D O G ///

CAMERON HOWARDOverview: The high jumper from Texas who has competed one year for the Bulldogs… he is a strong jumper who has helped the Bulldogs.

2011-12: In indoor he got a new season best of 6-0.75 in the High Jump atNiswonger Invitational, placing 15th...he went 5-10.75 in the High Jump at Big South Indoor Championship, placing 8th...Outdoor...he PRed with a mark of 6-1.25 in the High Jump at Big South Championships, placing 8th.

Collegiate Best Marks

High Jump6-1.25

JORDAN JAVADIOverview: A talented hurdler from Providence High School in Charlotte, N.C....he was a 2 time North Carolina 4A South West Conference Cham-pion in the 110m hurdles (2011, 2012)...2012 NC 4A West Region Champion in the 110m hurdles...2012 NC 4A State Champion in the 110m hurdles...his personal record in the 110m hurdles is 14.21.

Page 9: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

9/// F E A R T H E D O G ///

PATRICK OSBORNEOverview: A incoming freshman who is from Macedonia, Ohio… running for Nordonia High School in the middle distance races… he competed at the OHSAA District Track and Field Championship and placed 5th in the 1600m with a PR of 4:22.32.

ELLIOTT PAHEL-SHORTOverview: A rising sophomore who competed for the Bulldogs during indoor and outdoor.

2011-12: Competed in limited meets during the outdoor season but had a PR in the 5k at the Raleigh Relays…

Before UNC Asheville: Attended Carrboro High School, placed ninth in the state as an individual to help his team win the 2A team state champions his senior year.

Page 10: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

10 /// F E A R T H E D O G ///

SEBASTIAN PANIAGUAOverview: Rising junior who will add depth to the middle distance squad

2011-12: The sophomore competed in limited meets during the indoor season…he ran on the DMR relay at the Big South Indoor Championships as a crucial 3rd leg… Outdoor…at the Duke Invitational he set a PR in the 800m with a time of 1:59.39…later that day he set another PR in the 1500m with a time of 4:16.45.

2010-11: Starting the season off well at the Niswonger Invitational with a PR in the 400m with a time of 53.34… the middle distance runner showed success at the Big South Indoor Championships as a member of both the Distance Medley Relay and the 4x400m… Outdoor… once again a PR in the early part of the season in the mile (4:43.60)… he went onto to com-pete in the 800m and 4x400m relay at the outdoor championships.

Before UNC Asheville: Attended Battlefi eld High School...was District Champion in 500m, District Runner Up in 800M, All Area Team Indoor Track...member of Cross Country, Indoor, Outdoor Track District Champi-ons 2006-2010 and 2008 Region Champions 4x800M Relay

Collegiate Bests:

1500 Meter Run -4:16.45

400 Meter Dash- 53.34

5000 Meter Run -18:50.74

8000 Meter Run -29:40.92

800 Meter Run -1:58.39

One Mile Run -4:43.60

KEVIN PARADISEOverview: A leader for the men cross country team as a rising sophomore… he has been a immediate impact for the Bulldogs in the distance races…after his freshman year he is listed 14th All-time in the 8k and 10k…he is rank 4th in school history in the outdoor 10k.

2011-12: Leading the Bulldogs cross country season during his freshman… he was the number one runner at a number of meets…he ran a PR of 25:53 in the 8k at the Big South Championship…placing 27th overall…he went onto race at NCAA D1 Southeast Regional…Indoor…after a late cross country season he eased into the indoor season…running a personal best in the 3000m at the JDL Fast Track College Invitational… a few weeks later he placed 12th in the 5k at the Big South Indoor Championships…Outdoor… running a PR at the Appalachian Open, he was primed for another champion-ship competition…doubling in the 5k and 10k… he ran a PR in the 10k with a time of 31:53.54…and a season best time of 15:29.97 in the 5k.

Before UNC Asheville: A runner from Medina High in Ohio…a standout distance star who placed 25th at the OHSAA State Cross Country Cham-pionships…Medina teammate of former Bulldogs Sam Maynard and Kent Rankin.

Collegiate Best Marks:

10000 Meter Run 31:53.54

3000 Meter Run 9:06.31

5000 Meter Run 15:23.48

8000 Meter Run 25:53.00

Page 11: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

11/// F E A R T H E D O G ///

SKYLER WINCHESTEROverview: A running who specializes in the distance races…attended Bearden High School in Knoxville, TN…coming with a large class of runners for 2012-13 season…expected to make an impact for the Bulldogs…ran a PR at the TSSAA Section 1 AAA Championships and placed 1st.

LAUREN BAKEROverview: After her fi rst year of collegiate competition...she has potential to make an impact in the high jump in the following years.

20110-12: Sophomore athlete who added depth to the jumps program...Indoor... she fi nished 10th at the Big South Championships...Outdoor... she improved her outdoor season best and fi nished 7th place at Big South Championship.

Before UNC Asheville: Attended Providence High School... a versatile athlete for Providence HS, she competed in the 200m, 400m, high jump, and all of three of the sprint relays.

Collegiate Bests:

High jump- 1.60m

Page 12: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

12 /// F E A R T H E D O G ///

SCARLETT BEAMONOverview: A motivated distance runner who will be added depth to the Bulldogs in her fi rst season... in 2012 she competed at the NCHSAA 4A State Championships in both the 1600 and 3200....she set personal records in both races.

KASEY BRIGGSOverview: A standout distance runner...she will add more depth to the dis-tance squad will be looked at to help give UNC Asheville more of an up-front presence within the Big South Conference.

2011-12: A strong runner during the cross country season and the indoor season in the 5k... it was during the outdoor season when she began to crush-ing her personal record...with a time of 18:18.26 in the 5k at UNCC 49ers Classic...shaving off almost a minute of her high school time...competing in both the 5k at the both the indoor and outdoor Big South Championship.

Before UNC Asheville: Briggs is a distance runner from Athens Drive HS in Raleigh... She has posted a PR of 5:25 in the 1600 meters, 11:20 in the 3200 meters and 19:11 in the 5K in cross country.

Collegiate Best Marks:

5k- 18:18.26

Page 13: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

13/// F E A R T H E D O G ///

EMMA BUSSARDOverview: A senior in her fi fth year of competition....she is capable of leading the Big South Conference in the distance events in her fi nal year as a Bulldog.

2011-12: Although only competing in the indoor season...her performances were sea-sonal and personal bests...her fi rst personal record came at the Dick Taylor invite, where she fi nished third in the mile with a time of 5:09.08... two weeks later she dropped more than ten seconds off her 3k time (10:14.05)... at the Big South Championship she ran the mile, 3k and 5k...fi nishing in the top ten in every event.

2010-11: Third year athlete who is continuing her steady development and improve-ment...Cross Country...fi nished 3rd at the WCU Open...fi nished 13th at the Big South Preview meet...ran a collegiate best of 18:48.2 at the Royal Cross Country Challenge...fi nished 17th at the Big South Conference Championships (18:52)...Indoor...placed 2nd at the ASU Open in the mile in a collegiate best of 5:21.72...at the Kent Taylor Invitational ran another collegiate best in the mile (5:19.02)...at the Niswonger Invitational ran the 3k in a personal record of 10:26.98...placed 5th at the Dick Taylor Invitational in the mile running a personal record (5:09.43)...at the Big South Conference meet she ran a collegiate best of 18:22.77 in the 5k, also ran the 3k and the 1 mile, placing 5th in the 1 mile...Outdoors...opened the outdoor season with an 800m at the Palmetto Classic running 2:23.19...placed 3rd in the 5k at the 49er Classic running a PR of 17:48.65, followed that performance with a school record in the steeplechase running 11:30.39...placed 3rd at the Beynon Catamount Classic in the 1500m running a PR of 4:49.24.

2009-10: Helped the cross country team to a 6th place showing at the Big South Con-ference championships with her fi nish...suffered through health issues during the indoor/outdoor season.

2008-09: Solid performer freshman year...placed 13th at the Big South Conference cham-pionships in cross country...placed 10th at the Greater Louisville Cross Country Classic Blue Division...placed 9th & 8th at the indoor Big South Conference championships in the 3k & 5k...broke the school record in the steeplechase at the outdoor Big South Confer-ence championships with a 5th place fi nish (11:45.93).

Before UNC Asheville: Attended Carrollton High School...track team won state in 2005, 2006 and were second in state 2007, 2008...third place individual in state cross country (2004 & 2006), fi fth place individual in state cross country (2007)....individual state champion in 3200 and 1600 (2005 & 2006)...fourth place in 1600 (2005 & 2006)...third place in 3200 (2007 & 2008)...school record in 1600m, 3200m and 5k...career bests of 2:23 (800m), 5:12 (1600m), 11:17 (3200m) & 18:35 (5k)... is a vegetarian who likes to cook.

Collegiate Bests:

1500m - 4:49.24 1 mile - 5:09.08 3k - 10:14.05

3k Steeplechase - 10:53.29 5k - 17:48.65 5k (xc) - 18:48.20

RACHEL CARSONOverview: A rising junior on the distance side has great potential...she con-tinues to improve despite a challenging sophomore season with injury.

2011-12: Competing only in the indoor season...she had two PRs this sea-son with limited competition...mile (5:23.25) and 3k (10:48.71).

2010-11: Freshman athlete who will add depth to the middle distance program...9th place at WCU Open...ran a career best at the Clemson Cross Country Invitational.

Before UNC Asheville: Attended James Wood High School... Cross Country Captain...7 varsity letters in track and cross country...most valuable female cross country athlete...most outstanding female track athlete...Win-chester TV3 student athlete of the week...6 time state competitor...JWHS athlete of the year...best career marks of 2:20.15 (800m), 5:16 (1600m), 11:59 (3200m), 19:28 (5k).

Collegiate Bests:

5k - 19:28.32

Page 14: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

14 /// F E A R T H E D O G ///

ASHLEI CLODFELTEROverview: She is hard worker and talented athlete, who continues to help the track squad... after a strong junior season; she is expected to lead the team in the jumps and throws for her fi nal year.

2011-12: As a junior her area of focus was in the jumps and javelin... Opened up her indoor season with a personal best of 7.72 in the 55m sprint and a solid per-formance in the triple jump with a mark of 10.75m at the ASU Invitational...at the Dick Taylor Invitational ran a time of 8.47 (60m)..had big performances at the Big South Conference Indoor meet in the long jump with a personal best of 5.04m...Outdoors...opened the season with a throw just short of her PR in the javelin at the Charlotte 49er Classic (38.90m) and placed fi fth in an impressive group of forty throwers ...at the Big South Outdoor Championship placed third in javelin with a throw of 39.58m.

2010-11: Opened up her indoor season with marks of 4.75m (LJ) & 10.58m (TJ) at the ASU Invitational...at the ASU Open ran a time of 7.82 (55m)...ran a personal best of 9.70 in the 60m hurdles (5th best time in school history) at the Dick Taylor Invitational...had big performances at the Big South Conference meet in the 60m hurdles running 9.49, 4th all time in school history, and the triple jump placing 4th with a school record mark of 11.81m...Outdoors...opened the season with a throw just short of her PR in the Javelin at the Palmetto Classic (38.44m) and a collegiate best in the long jump (4.94m)...at the 49er Classic threw a PR of 39.80m to place 5th along with running a PR in the 100m hurdles (16.60).

2009-10: Made an immediate impact as a rookie...saw big improvement in the Jav-elin at the Big South Outdoor Conference Championships to place 4th with a mark of 38.62m...also placed 9th in the triple jump at the outdoor championships with a mark of 10.80m.

Before UNC Asheville: Attended North Davidson High School...was 2009 Track and Field MVP...2008 National Champion of Javelin throw at AAU Junior Olym-pics...2007 placed 7th in Javelin throw at AAU Junior Olympics...2005 Freshman Award for Track and Field...career bests of 15.40 (100m Hurdle), 26.56 (200m), 16-9.25 (long jump) & 36-1.5 (triple jump)...also a member of the basketball team where she was co-MVP (2007-08) & MVP (2008-09).

Collegiate Bests:

60m Hurdles - 9.49

Javelin - 39.80m (130-7)

Long Jump - 5.04m (16-6)

Triple Jump - 11.81m (38-9.00)

COLBY CRAWFORDOverview: A local from Candler, NC... she ran for Enka High in the short sprints...a redshirt her fi rst year at UNC Asheville...she is expected to com-pete in 2012.

Page 15: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

15/// F E A R T H E D O G ///

ERIN DALTONOverview: The Virginia talent will add support to the Bulldogs in both cross country and on the track...her ability to run a wide range of events was evident in her senior season at Mills Godwin.... placing second in the 3200m (11:21) and another second place fi nish in the 1600m (5:11.42).

ADRIAN ETHERIDGEOverview: As a rising sophomore she is now listed 4th on the all-time for 10k...she expected to grow as a runner in the distance races.

2011-12: She showed her strenghts during the cross country season ...she was the leading Bulldog at a numbers of meets...setting a PR at the Big South Championships as the lead runner for the team (19:31.00)...Indoor...she started her season off with a PR in the 3k with a time of 10:47.11...three weeks later she set a season best in the 5k and anchored the 2nd fastest DMR team in school history....Outdoor... she did not skip a beat during the Big South Outdoor Championships...scoring in both the 10k and 5k for the Bulldogs...an impressive feat for a freshman.

Before UNC Asheville: Attended Oak Ridge High School in Tennes-see and was a former teammate of current standout Melanie Kulesz. High school team were three time state champions while she was a member. Was an All-State athlete all four years. Has personal records of 11:02 (3200m) and 18:38 (5k). Her favorite food is her mama’s chili. Planning on majoring in art with a concentration in photography.

Collegiate Best Marks

10000 Meter Run - 37:42.70

1500 Meter Run - 5:00.37

3000 Meter Run - 10:47.11

5000 Meter Run - 18:05.83

6000 Meter Run - 23:25.00

One Mile Run - 5:19.88

Page 16: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

16 /// F E A R T H E D O G ///

MEREDITH FOSTEROverview: Two-sport athlete at UNC Asheville as she also competes on the volleyball team in the fall...the rising junior is looking forward to more success in the high jump.

2011-12: The talented sophomore had a breakout season... Indoors.. com-peted in six meets...fi nished near the top of the pack in most meets... at the Big South Indoor Championships she had a PR and placed 5th (1.65m)...the mark placed her second on the school’s all-time list...Outdoors...did not fi nish below 6th place in any competition during outdoor season...fi nished 4th at the Big South Outdoor Championships (1.65m)... her mark of 1.65m placed her number one on the all-time list.

2010-11: The incoming freshman showed tremendous potential... Indoors.. competing in fi ve meets...fi nished the indoor season with 10th place at the Big South Indoor Championships (1.53m)...Outdoors...fi nished 10th at the Big South Outdoor Championships (1.55m).

Before UNC Asheville: An All-Conference volleyball player as a sopho-more, junior and senior...made the All-Region team her fi nal three years at West Henderson ...state high jump champion her junior year...regional champion in the long jump as a sophomore and junior.

Collegiate Best Marks

High Jump- 1.67m (5 ft. 5 3/4 in.)

ANNA GELBACHOverview: The four year sprinter from Myers Park is going to add some speed to the Bulldog squad... at NCHSAA 4A State Championships she placed 9th with a time of 58.26 in the 400m...her PR in the 400m is 57.7...qualifi ed for the state meet in the 400m in 2011 and 2012...conference champion in the 400 meters in 2012...regional runner-up in the 400 in 2012...school record holder in the Indoor 400...anchored the school record breaking 4x400 in both indoor and outdoor...anchored the state 4x400 in 2012

Page 17: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

17/// F E A R T H E D O G ///

SARAH GENTRYOverview: Enters her senior year in the fall of 2012...has developed into an all-star on the track... made a very successful move up to 800m as a sophomore...now sec-ond in the 800m outdoors and 400m and 5th in 200m on UNC Asheville’s outdoor all-time list... for indoor track she holds the school record in the 800m (2:11.40) and 600m (1:36.71) and is in half of the ten all-time relay times.

2011-12: Indoors... at the JDL Fast Track Invitational in Winston-Salem she ran a PR of 2:14.87 then just two weeks later at the Big South Conference fi nished fi rst in the 800m (2:11.40), setting a new school record...member of the 5th place Distance Medley Relay (running the 800m leg) and then scored on the 4 x 400m relay, which were second and fi rst respectively, in school history...Outdoors...Ran 2:10.87 at Duke in early April and three weeks later continued her fi rst-place performance at the Big South Championships with her victory at 800m... fi nished the season strongly in May.

2010-11: Indoors...debuted in the 800m at the Niswonger Invitational running 2:23.72, then just three weeks later at the Big South Conference meet placed second in the 800m (2:15.31) setting a new school record...also a member of the second place Distance Medley Relay (running the 400m leg) and the scoring 4 x 400m relay, both were second all-time marks in school history...Outdoors...Ran 2:14.85 at Duke in early April and three weeks later fi nished third in the conference 800m...fi nished the season strongly in May at Clemson, running second-best times in school history at 800m and 400m, respectively (2:12.14 and 58.24).

Before UNC Asheville: Enjoyed an excellent prep career at Canyon Creek Chris-tian Academy in Plano, Texas...coached by Skip Lane... was the 2009 TAPPS (Texas Association of Private and Parochial Schools) 4-A State Champion in the 200 and 400...was the 2008 TAPPS 3-A State Champion in the 200 and 400…also captured district titles in the same division both years winning the 100, 200 and 400....high school personal bests: 100m-12.77; 200m-25.96; 400m-58.34.

Collegiate Career Bests:

55m - 7.78 100m - 13.02 200m - 26.88 Indoors, 25.88 Outdoors

400m - 58.80 Indoors, 57.41 Outdoors 600m - 1:36.71 Indoors

800m - 2:11.40 Indoors, 2:08.96 Outdoors 1500m- 4:40.09 Outdoors

Mile- 5:14.53 Indoors

ALYSKA KALMEIJEROverview: The rising senior is a versatile athlete who brings a completive spirit to all three season of her running competitions... eager to compete for her fi nal year...expected to continue her success on the track.

2011-12: Indoors...ran a season indoor best in the 800m at the Big South Championships and set a school record on the 4x400 relay team....Out-door...fi nished sixth at the Beynon Sports Surfaces Catamount Classic with a season best of 2:20.23.

2010-11: Came into the season as one of the most improved athletes...ran a career best of 19:23.80 at the Royal Cross Country Challenge...Indoors...ran an indoor best in the 800m at the Dick Taylor invite running 2:22.87...at the Big South Conference meet was a member of the scoring relays, Distance Medley & 4 x 400m, helping the team earn a 2nd and 5th place fi nish, respectively.

2009-10: Solid contributor during the cross country season...ran season best of 19:43 at the UNC Charlotte Invitational...was a member of 4th place DMR team at the Big South Indoor Conference Championships...ran 2:17.66 at the Big South Outdoor Conference Championships to score along with being on the 4th place 4 x 400m relay squad.

Before UNC Asheville: Attended Alan C. Pope High School...was a 4 year letterman in cross country...MVP in 2006, Coach’s Award in 2007 & 2008...was a 3 year letterman in track & fi eld...Rookie of the Year (2006), Most Outstanding Distance Runner (2007), Most Valuable Player (2008)...career bests of 2:21.08 (800m), 5:21.58 (1600m) & 19:43.88 (5k).

Collegiate Bests:

800m - 2:17.66

1500m - 4:56.22

1 mile - 4:52.95

5k - 19:23.80

Page 18: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

18 /// F E A R T H E D O G ///

MELANIE KULESZOverview: The rising senior was named Big South All-Conference in Cross Country as a freshman and sophomore ....named Big South Conference Runner-Up in the mile for Indoor Track as a sophomore...named Big South All-Conference in Outdoor Track as a Junior in the 10,000 meters (3rd place)... in her three years at UNC Asheville she has dominated the distance races... she is looking forward to continued success on and off the track this year as a Bulldog.

2011-12: She redshirted her cross country season...Indoors...placing 5th in 3k at the Big South Championships and raced the 5k and mile...she performed well under the ex-hausting triple at the championship...Outdoors...late in the season at the Raliegh Relays she placed 4th with a PR (17:36.69) in the 5k...less than a month later she set another PR in the 10k at the Big South Outdoor Championships.

2010-11: Cross Country...debuted at the Royal Cross Country Challenge with a time of 18:39...earned All-Conference honors with her 9th place showing at the Big South Conference Championships (18:33)...ran the 6th fastest time in school history for the 6k at NCAA Regional’s (22:33)...Indoors...won the mile at ASU Open with a time of 5:21.04...ran 5:15.09 in the mile at the Kent Taylor Invitational...ran a personal record of 10:24.36 (3k) at the Niswonger Invitational...placed 4th in the mile at the Dick Taylor Invitational running a personal record of 5:06.07, which is also the 5th fastest time in school history...at the Big South Conference meet she placed 4th, 2nd & 5th in the 3k, 1 mile & 5k, respectively...all of her times placed her in the top fi ve all-time performances, 3rd - 3k, 5th - 1 mi & 3rd - 5k, running 10:10.38, 5:04.78, 17:56.59...Outdoors...won the 800m at the Palmetto Classic (2:17.81)...placed 2nd at the 49er Classic in the 5k running 17:47.15...won the Beynon Catamount Classic 1500m running 4:41.83.

2009-10: Solid contributor during her freshman year...placed 9th at the Big South Pre-view meet...ran a season best of 18:42 during the cross country season...All-Conference performer in cross country with her 10th place showing...broke the Freshman Record at the NCAA Southeast Regional Cross Country Championships (22:52)...placed 8th & 9th at the Big South Indoor Championships in the 3k & 1 mile...placed 6th at the 49er Classic running 17:48.33 which qualifi ed her for USATF Junior Nationals in Des Moines, IA...placed 11th at USATF Junior Nationals with at time of 18:34.23.

Before UNC Asheville: Attended Oak Ridge High School...Tennessee Prep Xtra Cross Country Runner of the Year junior year...TN Region 2 Cross Country Champion senior year...TN All-State in Cross Country sophomore, junior, and senior year...named the Prep Xtra Cross Country TN fi rst team four consecutive times (track and cross country)...awarded MVP in cross country and track sophomore, junior, and senior year...fi nished 3rd in the 3200m, 4th in 1600, and 5th in 4x800 junior year...Oak Ridge won Re-gion 2 Cross Country Championships all 4 years...Cross Country State Champions ju-nior year...Cross Country State Runner-Up sophomore and senior year...4x800 Runner-Ups at the TN State Track Meet sophomore year ...track DMR school record...4x800 State Bound all four years...career bests of 1:02 (400m), 2:22 (800m), 5:09 (1600m), 11:10 (3200m), 18:20 (5k)...has played the piano for ten years.

Collegiate Bests:

800m - 2:17.81 1500m - 4:39.09 1 mile - 5:04.78 3k - 10:10.38 5k - 17:36.69 6k xc - 22:33 10k-36:56.61

ALYSSA LASHWAYOverview: A North Carolina native...she should bring some depth to the middle distance program...she ran a 2:22.21 in the 800m at NCHSAA 3A Midwest Regional, placing second.

Page 19: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

19/// F E A R T H E D O G ///

COREY McCLINTOCKOverview: Hard-working senior who has experience in the sprints and transitioned as a thrower her sophomore year...has seen tremendous gains in her performance and continues to improve...now second all-time in school history in the hammer throw.

2009-12: As a new hammer thrower set a season best at the Big South Championships in 2011 with a mark of 38.52m....less than a year later she improved more than 15 meters in the hammer throw an almost unheard of improvement...her PR for the 2012 outdoor season was at Raleigh Relays (45.99).

Before UNC Asheville: Competed in high school state championships during freshman, sophomore, and junior years.

Collegiate Personal Bests:

Hammer- 45.99

Discus- 13.76

KASSANDRA PIERREOverview: The talented sprinter from New York is expected to make an immediate impact for the Bulldogs in the 100m and 200m.

Page 20: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

20 /// F E A R T H E D O G ///

CLAIR POWELLOverview: A talented distance runner who looks to lead her team during her senior season.

2011-12: Ran a solid season for the cross country team...had a season best of 20:44 at the Big South Championships...Indoor...placing fi fth at Applachian in the 3k ...she was ready for a PR in the mile at the Kent Taylor Invite two weeks later (5:23.14)...competing at the Big South Indoor Champion-ships she showed tremedous improvement....placing 9th in the 5k with a PR of 18:05.68...Outdoors...ran a PR of in the 3k late in the season at Duke (10:49.29) and ended the season with a 15th place in the 10k.

2010-11: Came back from an injury to be a solid contributor for the cross country team this year...Indoor...opened up the season with a mile personal record at the ASU Open, then broke it again at the Kent Taylor Invitational running 5:25.38...followed up her mile performances with a 3k at the Nis-wonger Invitational running 10:55.95...ran a personal record at the Dick Taylor Invitational running 10:46.95 in the 3k...at the Big South Conference meet she was a member of the 2nd place Distance Medley team running the 1200 leg, also ran a personal record of 18:22.29 in the 5k...Outdoors...ran a PR of 4:58.01 in the 1500m at the 49er Classic.

2009-10: Had a great rookie year as the cross country teams number two runner and a strong contributor until an injury sidelined her year...had best marks of 11:05 (3k), 19:10 (5k) and 22:58 (6k).

Before UNC Asheville: Attended Mooresville High School... Mooresville Tribune athlete of the week 3 times during her career...MVP for Cross coun-try, indoor and outdoor track...school record holder in 1500 and 1600...team captain for xc and track teams...also played basketball...best career times of 5:26 (1600m) and 19:54 (5k)...in her spare time she likes to sew.

Collegiate Bests:

10000 Meter Run-39:52.63 3000 Meter Run-10:41.29

5000 Meter Run-18:05.68 6000 Meter Run-22:59.00

KELSIE RUBINOOverview: A versatile distance runner who ran for Lake Norman High...she place 6th at the NCHSAA 4A West Regional meet in the 800m.... she has a strong work ethic and ability to train for multiple events.

Page 21: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

21/// F E A R T H E D O G ///

Jesse Norman just fi nished up his fi fth year as head coach of the UNC Asheville Cross Country and Track and Field programs. The Bulldogs cross country and track and fi eld program have shown tre-mendous improvements across the board during his tenure.

In the 2011-12 seasons, the Bulldogs men’s track team had Milan Ristic qualify for the NCAA Preliminary Outdoor meet in the 110 hurdles. It marked the fi rst time a Bulldog hurdler had advanced to a NCAA championship meet. Ristic won the Big South Conference championship in the 110 hurdles at the outdoor meet and won the 60 hurdles at the league’s indoor meet in February. On the women’s side, Sarah Gentry captured the 800 meters at the outdoor BSC champi-onships for her fi rst ever championship.

The 2010-11 seasons saw new heights for the program. The women’s cross country squad improved their team fi nish at the Big South Championships with Melanie Kulesz again earning all-confer-ence honors. The indoor season had the women’s team fi nishing in third place; the highest fi nish in school history. Norman was named Big South Indoor Track and Field Women’s Coach of the Year after Asheville’s impressive performance. During the outdoor season Natalie Pearson (100m & 200m) and Simon Haake (Javelin) qualifi ed for the NCAA Eastern Regional with Pearson advancing on to the NCAA National Championships in Des Moines, Iowa. The outdoor season also had Ristic qualify for the European U-23 Championships in the 110m hurdles. He also guided Ashlei Clodfelter to a school record in the triple jump (38-9).

During the 2009-10 seasons, both Bulldog cross country squads improved their showing from the previous season with freshman Mel-anie Kulesz earning all-conference honors. In the track and fi eld ranks,

Asheville had both Simon Haake and Natalie Pearson qualify for the Eastern Regional under tougher standards. Pearson became the fi rst Bulldog student-athlete to qualify for the National Championships in the 200 meters. Pearson was ranked fi rst nationally in the 200 during the season. Kulesz qualifi ed for the USATF Junior Nationals in the 5,000m placing 11th at the championships. Norman worked for two years at Western Carolina with the Catamounts men and women’s distance teams before coming to UNC Asheville in the summer of 2007. He helped guide WCU cross country runner Dan Fassinger to an all-conference fi nish in cross country and Deanna Kulesz to an all-conference fi nish in the 1500 and 3000 meters. Norman was part of a Catamount coaching staff that helped WCU win two straight Southern Conference Outdoor Track and Field championships. Norman enjoyed a great career at Western Carolina from 1999-2003. He won the Southern Conference individual championship in cross country in 2001, the only Catamount ever to accomplish such a feat and earned all-conference honors in the 10,000 meters during the 2000 outdoor season. Norman had a sensational prep career at Fuquay-Varina HS where he was a fi ve-time state champion in cross country, 1600 meters and 3200 meters. Norman earned a degree in physical education from Western Carolina in 2003 and then picked up his master’s in physical education in May of 2007. Norman holds USATF Level I & II certifi cations in endurance and was invited to attend the United States Olympic Committee’s Emerging Elite coaching clinic held at the Olympic Training Center in Chula Vista, CA for both the endurance (2009) and the jumping (2010) event groups. Jesse and his wife Melanie have a daughter Eliza.

JESSE NORMAN HEAD COACH - FIFTH SEASON

Page 22: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

22 /// F E A R T H E D O G ///

Joel Williams is in his sixth year as an assistant track and fi eld coach with the UNC Asheville men’s and women’s programs. He has been in charge of coaching the sprints (up to 800m) and hurdle events, throws and high jump since his hiring in the fall of 2007.

His latest notable runner is Milan Ristic, a native of Belgrade, Serbia, who capped his sophomore year and the 2012 track season by becoming the program’s fi rst hurdler to qualify for the NCAA Regionals while breaking his own school record with a time of 13.88 (42 inch hurdles). Ristic has improved from a time of 14.49 in high school over 39 inch hurdles to his 13.88 over the collegiate/international hurdles. Ristic won both the 60m hurdles at the Big South indoor championships and the 110m hurdles at the outdoor championships during the 2011-2012 school year. Ristic also set school records for 200m indoors and outdoors with times of 21.68 and 21.62, respectively.

Also, during 2011-2012 school year, Williams coach to Sarah Gentry winning the 800m conference championships at both the indoor and outdoor Big South champion-ships. Gentry set a school record indoors with a time of 2:11.40 and ran 2:10.87 out-doors. She also moved to number 2 all time for the school outdoors in the 400m with a time of 57.65.

The 2010-2011 season was highlighted by the performances of junior Simon Haake, Ristic and sophomore Sarah Gentry.

Haake broke his own school record in the javelin with a throw of 68.15 meters to qualify for the NCAA East preliminary round for the second consecutive year. He also posted the second-best hammer throw and the third-best shot put marks in program history after having recorded Asheville’s top-three marks in both events indoors.

Williams also elicited impressive results from Ristic in his freshman year. He set school records in the 110m hurdles (14.32) as well as the 100m and 200m. The hurdles time qualifi ed him for the European Athletics Under-23 Championships held in July 2011. Ristic also established school indoor records in the 55m and 200m and ran the second-fastest 60m hurdle time in Asheville history. Gentry led the women’s side in her fi rst year at 800m by setting a school record while fi nishing second in the Big South Conference Indoor Championships. Outdoors, Gentry moved into second place in program history with a time of 2:12.14 and surpassed her own second-best school time in the 400m.

The 2009-10 season featured Haake and Clodfelter in the javelin.

Haake established a school record with a throw of 64.57m at the conference cham-pionships, which qualifi ed him for the NCAA East prelims. Clodfelter, meanwhile, moved into second place on the school’s all-time list with a throw of 38.62m.

The men’s side saw two school records set indoors and two outdoors, while a new school standard record also was established on the women’s side.

Meanwhile, Haake and Williams continued to write an intriguing story in the javelin. The sophomore, who walked on the Bulldog team as a freshman despite never having competed in track and fi eld nor any sport at East Chapel Hill High School, improved his personal best from the previous season by almost 11 meters. He also recorded the second-best throw in school history (55.56 meters) to fi nish seventh at the conference championships. Williams made an immediate impression in his fi rst season at Asheville (2007-08) as all of his throwers made the school’s all-time top 10 list. Erik Nabi led the way as he extended his personal best in the javelin by 6.03m in one year, earning all-conference honors with a throw of 55.48m, second in school history. Daniel Corriher improved by more than a meter in the shot put and indoor weight while entering the school top fi ve in the shot and hammer throw. Haake began his Bulldog career when he moved into the school top 10 with a throw of 44.66m while making the fi nals of the conference championships. Prior to his arrival at UNC Asheville, Williams coached at Watauga High School in Boone from 1994-2005. He was in charge of the indoor track and fi eld program while serving as assistant for the outdoor team. Ten of his indoor athletes won 4-A state championships, and he guided the 1997 girls’ team to the program’s fi rst state title. Williams also oversaw the development of 12 state champions outdoors. Watauga captured three straight state girls’ outdoors titles (1995-97), while the boys’ outdoors squad tied for third in 1997 and was runner-up in 2000. The Pioneers were dominant at the conference level, with the boys and girls teams each winning eight straight league championships during his 12 seasons at the school. He also was the strength coach for several school record-setting throwers. Four Watauga athletes whose careers Williams infl uenced achieved noteworthy success beyond their Pioneer days. Brenda Taylor won the 400m hurdles in the NCAA Championships while attending Harvard and fi nished seventh in that event for the U.S. in the 2004 Olympics at Athens, Greece. Her second-place time of 53.36 at the U.S. Olympic Trials was fi fth-best in the world that year. She also earned a bronze medal in the 2003 World Indoor Champion-ships as a member of the U.S. 4x400 relay team. While at Watauga, Taylor won nine individual and relay state titles. Williams helped design her weight program for the 2004 Olympics and worked with her at Harvard and post-collegiately. Lindsay Taylor, Brenda’s twin sister, won numerous Ivy League championships in the hurdles and high jump while at Brown, qualifi ed for two NCAA Championships in the heptathlon and fi nished third in the pole vault at the 2003 USATF National Indoor Championships. Williams continued to work with her during that period. Her high school years included a high jump of 5-11.5. She was second in that event in the USATF Junior National Championships, fourth in the Pan Am Junior Champion-ships in Cuba and third nationally in 1997 as voted by Track and Field News. Abraham Morlu, a sprinter from Liberia, was coached by Williams from his fresh-man year at Watauga to a spot on his country’s 400m relay team for the 2000 Olympics in Sydney, Australia, while a freshman at UNC-Chapel Hill. Morlu also made the Liberian relay team for the 2001 and 2003 World Championships.

JOEL WILLIAMS ASSISTANT COACH - SIXTH SEASON

Page 23: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

23/// F E A R T H E D O G ///

Adam Puett is in his third year as the assistant coach with the UNC Asheville cross country and track and fi eld programs.

Adam works primarily with the middle and long distance runners. Dur-ing his fi rst year at UNCA, Adam helped coach the UNCA women to their highest fi nish in school history at the Big South Indoor Conference Cham-pionships by placing third. Adam also helped his athletes achieve 21 personal bests, while coaching 4 Big South All-Conference Performers.

Puett enjoyed an outstanding career for Western Carolina University. He was the 2005 Western Carolina Male Athlete of the Year and 2006 Southern Conference Outdoor Performer of the Year. Adam earned All Conference honors three times in cross country and 10 times in indoor and outdoor track. He was a fi ve-time So-Con champion in indoor and outdoor track plus a four-time NCAA outdoor regional qualifi er in the 1500. The Alabama native won the Southern Conference 1500 meters for three consecutive years. Before coming to UNC Asheville, Puett served as an assistant coach at WCU for three years. He coached events ranging from the 800 meters to the 10,000 meters. The Alabama native coached 13 All-Conference performers and six Southern Conference champions during his tenure. He helped lead the Catamount programs to fi ve different league championships. Puett graduated from Western Carolina in 2006 and then earned his Masters in Physical Education from WCU in 2009.

ADAM PUETT ASSISTANT COACH - THIRD SEASON

Page 24: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

24 /// F E A R T H E D O G ///

Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”

The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.

During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.

In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.

Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.

In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.

In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.

Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.

The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.

THE BIG SOUTH CONFERENCE

Page 25: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

25/// F E A R T H E D O G ///

BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100

Charlotte, NC 28226Phone: (704) 341-7990

Fax: (704) 341-7991www.BigSouthSports.com

Founded 1983

PresidentPenelope W. Kyle, Radford University

Vice PresidentDr. Frank Bonner, Gardner-Webb University

SecretaryDr. Anne Ponder, UNC Asheville

CommissionerKyle B. Kallander

Associate CommissionerJames Companion

Associate CommissionerDawn Turner

Assistant Commissioner - Public RelationsMark Simpson

Assistant Commissioner - MarketingChad Cook

Director of Multimedia DevelopmentMark Bryant

Offi ce ManagerTerri Ballard

Assistant Director of MarketingMatt VanSandt

Assistant Director of Public RelationsNic Bowman

Assistant Director of ComplianceSherika McLean

Marketing AssistantMelissa Estepp

Public Relations AssistantBriana Mayes

Administration/Multimedia AssistantEarl Laing

Coordinator of Football Offi cialsDoug Rhoads

Coordinator of Men’s Basketball Offi cialsJoe Forte

Coordinator of Women’s Basketball Offi cialsCharlene Curtis

Coordinator of Baseball UmpiresTony Thompson

Coordinator of Softball UmpiresBetsy Kidd

Coordinator of Men’s Soccer Offi cialsPaul James

Coordinator of Volleyball Offi cialsDaniel Leake

Member Institutions (12): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Longwood University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University

Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (4) – Liberty University, Longwood University, Radford University, Virginia Military Institute

Associate Members: Stony Brook University (football), Davidson College (women’s lacrosse)

Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Women’s Lacrosse, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball

Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; Marge Connelly, Longwood; Dr. Claude Lilly, Presbyterian; Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop

BIG SOUTH QUICK FACTS

Page 26: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

26 /// F E A R T H E D O G ///

Page 27: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

27/// F E A R T H E D O G ///

ABOUT THE UNIVERSITY As the University of North Carolina at Asheville celebrates eighty years of excellence in higher education, the campus community welcomes new challenges and greater successes as one of the nation’s leading liberal arts colleges. From its beginnings as Buncombe County Junior College, where 86 students enrolled in 1927 to further their educations beyond high school, the University has valued liberal arts ideals and community engagement. Its special commitment to student learning and undergraduate education was reaffi rmed when it joined the University of North Carolina system in 1969 as the University of North Carolina at Asheville. The University maintains its liberal arts imperative, as the designated undergraduate liberal arts University of the 17-campus University of North Carolina system.

Vision

UNC Asheville students, within a diverse and inclusive community, experience liberal arts education at its best.

Mission

UNC Asheville is distinctive in the UNC system as its designated liberal arts university. Our practice of the liberal arts emphasizes the centrality of learning and discovery through exemplary teaching, innovative scholarship, creative expression, co-curricular activities, undergraduate research, engaged service, and practical experience. Primarily undergraduate, UNC Asheville offers a liberal arts education characterized by high quality faculty-student interaction. We offer this challenging educational experience to all promising students who are committed to liberal learning and personal growth.

Our liberal arts educational approach emphasizes life skills including critical thinking, clear and thoughtful expression, and honest open inquiry. Students undertake concentrated study in one area while simultaneously developing an understanding of the connections among disciplines. We encourage students to clarify, develop and live their own values while respecting the views and beliefs of others. In addition, we cultivate an understanding of the dimensions of human diversity while recognizing the common humanity of all. We believe a quality liberal arts education enables our graduates to be lifelong learners and to lead successful, fl ourishing lives as leaders and contributors to their communities.

At UNC Asheville, we respond to the conditions and concerns of the contemporary world both as individuals and as a university. We incorporate economic, social and environmental sustainability into our institutional practices and curriculum. With a range of associated centers, partnerships, and initiatives, we fulfi ll our public responsibility to address the needs of our community through a continuum of learning. We develop a commitment to continuing service characterized by an informed, responsible, and creative engagement with the Asheville area, the southern Appalachian region, the state of North Carolina, and a diverse and increasingly connected world.

Alma Mater

In 2000 the university community set about the task of writing a new Alma Mater—the offi cial anthem of UNC Asheville, sung at all ceremonial events—to replace the one from the 1960s. In Latin, alma mater means “nourishing mother,” and it also refers to the school one attended.

Hail Our Alma Mater, Hail UNCA.

Learning be your watchword,Greatness be your way.

High upon the mountains,In the Land of Sky,

Stands our Alma Mater,Lift your voices high.

Noble Alma Mater,Hear our words of praise.

May we love and honor you,Until the end of days.

Page 28: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

28 /// F E A R T H E D O G ///

WWWWWiWWiWiWiWWWWiWiWiWiW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCCNCCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC A AA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhshs eveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn sssssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuuppppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt tttttttttttheheheheheheheheheheheheheheheheheheehehhheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaaaasyssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 33333330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarra tststststststststststststststssssssss, , , , , , , ,,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscscsccieieeieieieieei ncnceeeaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillililiiiiiiiiiiibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....

HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s

AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 2020202020202020

MoMoMoststst P Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchhhhhhchc oooololoololooolooololololooolololooo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititititittererererereere atatataturururureeee,e,ee,e, EEEEEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnnonnnnnnnnnnno mmmemememeeeeeememeememeeeem ntntntntntnntntntnntnntnnnnnnntnntnn alalalalalallalalalalaallllalallallalalaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuutututututututtututututututtuuutuuuudididdidididididdidddididdididdididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,, HeHeHeHeHeealthth &&&& &&&& W W WWWWWWWWWWWWWWWele lnnesessssPrPrromomommotottoto ioioioionn,n, aaandndndd A A A AAAAAAAAAAAAAAAAAAAAAAArtrtrttttrtrtrtrtrtrttrtrtrrrtrtrtrtrtrttrrtrtt

FuFuFuF llbllbblbblblbbbbbbblllllblbllbbl riririgghgghghghghhhhghghhgggghhgghgghhgg t t AAAAAwAwwwwwAwAAwAAAA arararardsdsdssssssssssssdssss: ::: ::: :::: 37373737373737773773773737377773737373737373737373377 s s tttutututut ddddeeeeeeeeeeeeeed ntntntntntntntntnnnn s s hhavev reeeeeececececceceieiiiiieieieiieivvvveveved ddddddd ddd ddd ththththhhhhhhhhe e prprprprprprprrprpprrrprprrp eseseseseseseseseesesesseseseeesttitititttttttttt gigigigiououououous s s s awaaawawawawawawawwawawawawawawawawawawawwawararaararrrrrarrarararaararraarara ddd

UnUnUnUnUnUUnnnnnUnnnUnddddedededddddededdergrgrgrgrggrgrgggrggrgrgrgrggrggggraraaaaaaaaaaaaddduduuududduatatatatatatataaate eeeeee e ReReReRReReReRR seseseseseeararararchchchhc :: ::::::: MoMooooreree tt thahahan hhhahahahaahahhhhalfffflfflffff oo oof f fffffff ststsstststtstsstuuududdudududdu eeeeneeneneneeneee tststsststss ccc c c ccc c cccccccccccc cccccomomomo plpplplpp eteetetetettetettetettette eeeeeeeee eeeee eeeeeeee orooororrorrrorrororororrrrrroooo igigggginininininininininininiinii aaaaaaaalalaaalalaaa r rrrrrrrrrrrrrrrreeeseeseesessssseseesseeesseeeaeeaeaeaeaeaeaeaaae rcrrcrrrcrcrcrcrcrcrcr hhhhhhhhh h hh hhhhhhhhhhhhhh iniinininininnnininininniininiinnniiinnninniinnninnnn t ttt ttttt tttttttttttttttttttttthhhhhhhehehehhhehhhehheh iriririrrr fi fi fi fififififi e ee e e eeeldldlddld o oooof f f fffffff stststststttudududududududduddyyyyyyyyyythththrorougugh hh thththhhthhthhhthhheeeeeeeee e UnUnUnUnUnUnUnUnUnUUnUUnnivivivivivivivviviviiverererererererereerersisisisisss tytytyyyyyyyyyyyy’s’s’s’s nnnnnnnnn nnaaaatataatioioionananalllllly y y rrrrrerererr cooooococcoooogngngnnnngnngngngggggg izizziziiizizzizizi edededdedededededddeddedddd U U UUUUU UU UUUUU UUUUUUUUUUUUUndndndndndndndnndndndnddnndndnddndndnddndndndddddderereeereererererereeeeerereeereeeerereeerereee grgrgrgrrgrgrgggggggg dadadadadadduuauuuauauauauauuuauaaaauaaaateteteteteteeeteteteeeteeeetetetttttttttteee R R Reeeseseseseseseseseseseesesseeseeseeseseeseesseeseeseseseesseeeeeeaeaeaaeeeaeaeeeeeeeeaeeeae rrrcrcrcrcrcrcrcrccrccrcrcrrrrccrcrccchhhh hh hhhhhhhhhhhhh hhhhhh hhhhhhhhhhhhh PrPrPrPrrrrrrPrPrPPPPrrrP ogooogogogogogogogogogogooogoooggogoogoogogggoogogogogooggoo rararaaararararrararaaarrararrararaaraarraraaarararaaaar mm.mmm.m.mm.m.mmmmmmmmmm.mmmmmm.mmmmmmmmm UUUU NCNCCCC AAAA A AAAAshshshshhhhhevevevvvililillilillleleleleleleleeffofoooooooof unundeeeeeeeeed d ttththhthhhheeee e NaNaNaNaNaNNNaNaNaNaaaaaNaaaatitititititit onononononnonoono lalllalalllla CC CCCCCCCCCCCCCCCononononnonononooo fefefefeferrerer ncnce e e onoo UUUUUUUUndndndndnndndndndnnnn errrrererrrrggrgrgggg aadadaadadadddadaa uauauuuauauaaaauauuaauaaaauaaauaauatttttteteteteetttetttttt R RRR RRRRR RRRRReseseeeesesesesesessssesesseseseseeseeeeee eaeaeaeaeaeeaeaeaeaeaeaeaeaeaeaeaeaeaeearcrcrccccrcrcrrcrcr hhhhhhhhhhhhh h h hhhhh mmomore tthahan n 25222222225255552522522222522525255555222 yy yyyeaeeeaeaeaeeaeaeeaeeaeeeeeaeeeeeeaearsrrrsrsrsrsrssrsrssrsrsrssrrrrsrsrssrrrsrssrssssss aaaaaaaa aaaaaaaaaaaaaa gogggggggogogogogoggogogggogogogoggogoggggggggggg .

StStStStSStStStStS udddududududddduuduudududyy yyyyyy yy yyyyyy yyy AbAbAAA roorooooooooooaaaaaadddda a aaaaaaaaaaaaaaaaaaaaandndndndddndddddddndndndndndndndnndnnndnnddndn S SS SSSSSS SSSSSSSSSSSttutuututututututututttt dddydydyddyddydddydyyddydyy A AA A AAAAwawwaww y:y: 1 17 77 pepepeeeeeercrrr eeeeeenenneenee t t tt oofofffooooooo s sssssssssstutututuuuuuuuudddddddddededdddedddddddddddddddd ntnnnnnnntntnnnnnnnnnnnnnntn sssss ssssssss tatatatataaaaatataataaaaaaaaaaakekekekkekekekekekekekekekekeke a aaa aaaa aaadddddddvdvdvvvvvdddvvdvvvvvanananannanannnnnnanananananannanaa tatatatatatatatatataaaaaaaaaagegegegegegegegegegegegegegegegegeegegegeee o oooo oo o o o o oo oooooff f f f ff f fff f ff leleeleleeelelellelelellleeeleeeleeleeeleleeararararararararaararaaa ninininininininnininnininnnnniniiin ngngngnnngngngngngngnnnngngnngngngnnngnnnngnnnngnnnnnnnnggnnggggngg ooooooo oooooooooooopppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp ororooooooooooooooo tututututtttutuutuuutttutttttutututuutuutuuuuutuututuunininininininn titititttt esessssss i i innnnnnnototoototottototoototo heheheheheeheheeheeh r r rrrrr ststststststtststtstatatatatatttatatatttteseseseeseseeseseeeee aaaanndndddddddddndddddddddddd ccccc cccccccccccccccccccoououoooooo ntntnnntntnttntntntntnttrrriririrrrrirrriirirriir esesess w whihihilele e enrnrnrololollllllllelelelellleeeleel ddd ddddddddddddd atatataatatattat UUUU UUUUU UU UUNCNCNNCNCNCNCCCCNCNCNCNNCNCNCNCC A A AAAAAA AAAAAAAA AAAAAAAAAAA Ashshshshhshshhhhshhshshshhhshshhhhhshhsshs evevevevevevevevevvevevevvvevevvveveveeveve ililililillllliillililiiililleleleleleleleleeleleleelee... .

StStS ududenenenenenenttt ttttt AAAtAtAAtAtAthlhlhlhlhlhlhlh eteeeteettte e eee GGGrGrrGGGrrG adadadadadadaaduauuauauauauauaaaaaatitititititiititittitit ononononoono RRRRR R RR Ratatattttttattattatatattttattteeeeee::ee:eeeee:ee:ee UUUUU U UNCNNCNNCNNCNCNCNCNC AAAAA AA Ashshsshshshshevevevevevevvililililili lellellelele s sssss stututudeddentnnnntnnntnnnnnnnnnnnnn -a-aaththtththhthththhhthhthhthhlleleleleeeelelelelleeleletetetetetetetetetetetetettteteeeeteteetetetetessssssssssssssssss s sss hahahahahahahhahahahahahahhahaahahahahhahahhhhahahaahhh vevevevevevevvevvevveveveveveveevev o oo ooooonenennn o of f ththe e hihighghg esest t grgrrgrgrgrgrgrrgrrradadadadadaadaaaada uauauuatitittiononononrararrarrraatetetetetet ss s sss iiniiininininnin tt t t ttthhhehehehehe NNNNN NN NCACACACACACACACAA.A.A.A.A.A.A.AAA O O OOOOurururururururu ssssss sstutututututudedededededentntntntntntnn aa-a-a-athththttthleleleteteetes s sss ononononon a a a aaththleleetitiitititicc c scscscscscscscchohohoohohoohohooooooholalalalllallalalalalaarrsrsrsrsrsrsrshihhihihhhhihihhhihih pspsps wwhoho p plalay yy alalalaa ll fofofooofourururrurururrururrurrurur yyyyy yyy yyyeaeaeearsrs aaattt UNUNCCCAsAsAsAsAshehehhevivivilllllle e hahahahavevevve a aaa 9 9 9 99 9 9 pepepepepeep rcrcrcrcrcrcenenenene tt ttt grgrgradadadadaaduauauauauatiitititioonon rrratatate.e..

FaFaFaFaFaFaFaFaFFFFFFFaFacuccucucuucuc ltltltltlltl y:y:y:y:yyyyyyy 222222 2 210101001000010101010 fffff ffulululluluullll-l-l-l--l-l-ll titititititit memememememememeeeeee ff fffffffffacacacacacacaaaacululllulullululultytytytytytytytyyyyyy mm m m m mmmmmmmemememememememmememeeee bebbebebebbebbebeersrsrsrrsrsrssrsr , , , ,, 84848484484848484848484%%%%%%%% % % wiwiwiwithththtththhht ttt tttttereeerererererrrmimimimimimmimimiminananaal l l dedededededeedegrgrggrgrgggrgrggg eeeeeeeeeeeeees s

COCOPLAC: UNUNC C AsAshehevivilllle isiis t thhehe hh heaeadqdquauauartrtereers s s fofor the e CCoununcicil l of PPububblilicc c Liberal l Artsts C Coolleges, aa2727-mmemembeber r orgagaaninizazazattition of state-supppporteed libebeberalll arts collegegeges that rrrececogogninizeze tt theee immpmportancncncee e ofoff liberal l arartsts a andnd s sccicieneenceccess ededucucattiion fof r succesee s ss innn aa comom lplexex g gloloobabab l sosocicietetety.

CCCCaCaCaCaCaCCCCCaCCCCaCaCampmpmpmpmpmpmpmpmpmpmpmpmpppppus LifeRReReReReReReReReResisisisisisiiisiidededededededeedeeencncncccccncccnccncncncnnce e eeeeeeeeee Haalllls:s: AAboboutut oonene-t-thihirdrd o of f ststududenentsts l livive e onon c camampupus,s, w whiiiileleleeeeeeeeeleleleeleelelee a a a a aaa a aa aaaa aaaaaaannonononnnononononnooonoononnoonnnononnnonnn ththththththththththththththththththtthththhthhhththhherererererererererererererererererererereeerrerrrr t t t tt tt t t t tt t ttt t ttttttt ttt tthihihhihihihihihihihihihihihihihihihhhhhhhihhihiih rdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrdrdrdrdrdrdrdrddr ll l ll l ll ll l lll l ll l lliviviviviiiivivivivivivivivivivive withthinin aa one-milerarararaaadididididddiddd usususususus o o o ooffff ff ff cacacacacacaaaaaaccaaacccc mpmpmmmmmmmmmm usus.

AtAtAtAAAAAAthlhlhlhlhlhlletetetee icicicics:s:s:ss:s:: 1 115 5 5 5 NCNNNCNCNCNCNCNCNCCCCCCCCCCCCCNCAAAAAAAAAA D Divviision 1 1 tetetetetetetetetetetetetetetttttteteteteamamamamamamammamamamamamamamaaaaaaaaaaaa s s s

StStStStStStSttStStStStududududdududududududeneneneneeneneneneenenene ttttttttttt t GrGrGrGGrGrGGrGrGrGrGrouououououououououououpspspspspsppps:: :: MoMoMoMoMooMoMoMoMoMoooM rrererrererereeererereererrerererrerrererererr t t t t t tttthahahhahahahahahahaaahahahahahaahaaan n n nnnnnnnn 60606060606060600000 c ccccccccccccccccccccclulululuululululululuulululuuuuulululullubsbsbsbsbsssbsbssssbssbsbsbsbsbsbsbssbsbsbsb a a aa a a a aa aa a aaaaaaaanddndndndndndndndndndnddddddndndddnd ooo oooooo oo o oo oooooo ooooooorgrgrgrgrgrgrgrgrgrgrgrrgrgrgrrgrgrgrgggananizzata ioionss, raaaaaaaangngngngngngngngngngnggngngnngngnngnggngngng ninininininininininininninininininiiininiiniinnggg g ggg ggg g g gggggggg ggg g ggggggggggg g frfrfrfrfrfrfrfrrfrfrfrfrfrfrrfrfrffrfrrfrffrfrrrrromomomoomomomomomomomomomomomoomomommommomoooomoommomomomomo hh hhh h hh hhononononononoroorororororo s s s s ssococococococieieieieietititititiesesesess ttttttttttto o o oo oo iniinininnninintrtrtttrtrtrrtrrrrrttrrrtrrrrrrrrrramamamamamamamamaaaamamaaamaaaaa urururururuuururururruruurururururururrrruralalalalalaaallalalalalalalalalalaaaaspspspspspspspsporororororroortstststst

Innnnnntttteteeercrculululuuullultutututuutututturararaaaararal CeCeCeCeCeCCeCeCeCeCentntnttntttttttttterererererererererererererererere & & &&&&&&&&&&&&&&&&& O OO OOOOO O OOOOOOOOffiffiffiffififfiffiffiffiffiffifffifffiffi cccccc cc e e eee ofooofofofofoooo M MMMMMMululululuullultititittitititicucuucucucucuucultltltltlttlttttururururururururururalalalalalaalalal S SS S SS S SSS S SStutututututututututtuudededededededededededeeeedentntntntntntntntntntnnntntntt P PPPPPPPPPP P Prororororoororoororoororogrgrgrgrgrgrggrgrgrggrgrggrrgrrrg amamamamamamamamaamams:ss Thee Inttttererererererererccucucucuuuucucuultltltltll uuururrurrrrrurrralalalalalalalalalalaal C C CC C C C enenenenteteteteteteteteteterr r r rrrrrrr hhohohohohohohohohohoh uuusususususususususususususussussuusuuseseesesesesesesesesesesesesseesseseseessssssesssseessssesesssscocococooococoococococooccococc ffmfmfmfmfmfmfmfmfffmfmfmfmfm ororrrororororororororororortttttatatatataattaablblbbblblbblblbb e eee spspspspsppaaaaaacccca esesesesesesesessesessesesses ff f f fff f f f f f ffffff ororororororororororororororororor mm mmmmmmmmmmmmm m mmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeetitititititititititititit ngngngngngngngggggngggngngngngn s,s,s,s,s,s,s,s,s,ss,s,ss,s s s s s ssssooco ial evevevenenenene tstststt a aa aaaanndndndndnddnd p p p p ppp ppp pppror grgrrgrgrrrramamamamamsss sss ininininvovovovovooooovoovovvov lvlvlvll iniiinnininingggggg g susususususususususususususuuuuchchchchchchchchchchchcchchcc d ddd d dd d dd ddivivivvivvvvvi ererererereeerrsssssesessssssee groupppppsss sss asasasasasasasasasasas A AA AA A AA AAAA Alllllllliaiaaaaai nnnncncncnccccccncncncncncnncncncnncnncnccccccnnnce,e,e,e,e,ee,e,e,e,e,e,e,e,e,ee,,e,ee,eee,eee,eeeeeeee,,ee,,, BBBBlllBBBBBlB aacacacacacaacaaaa k k k k StSStttttSttttttudududududuududeneneneneennenennentstststststssssss A A AA A AAAAAAAsssssssssssssssococococococococococococococococociaiaiaiaiaiaaiaiaiaiaiaiaiaiaiaiatitittititittititititititititittitiononononononononononononononon, ,, ,,,, ,, , , , InInInInInInInInInIInInnnInntetetetetetetetetetetttetteteternrnrnrnrnnrnnrrrrnrr aatataaaaaaaaaaa ioionanaaaaal l l ll SSStStStStStStSStStSS ududududududduddduudeneneenennenennenne ttt t tt t tttt AAAsAsAsAsAsAsAAAAsAsA sososossosososssssociiciciciciiciiiiatatatatataatattatatattatiioioioiooioioooioiooiioionn,n,nnn,, A A AAAAAAsisisisssisisisis anannanananananananannnnaa SSS SS S Stut deddddedeeeeeeeeeeeenntntnttnttttttntntntttnn ssss s ininnnnnnn A AAAAAAshss eveveveevevevevevevevevevilille, , HHeHeHeHeHHeHHHHeHeHHHHH rmrmrrmanananananan@s@@@s@s@s@s@s@s@s@s@s@s@@s@s@s@@s@s@s@s@s@s@s@s@s@s@s@s@s@s@s@@s@s@@@s@@@s@ss@ss@@@s@@OOrOrOOOrOrOOrOOrOOOrgugugugugugulllllll ooooooosososos@@@@@ssss@@@@@ eeeeeen n n n nn LaLaLaLaLaLas s s ssssssssssss s AmAmAmAmAmAmAmAmAAmAmAmAmAmAAmAmAmererererererererererererereereerrericicicicicccicicicicicicicicicicasasasasasasasasasasasasasas (( ( (( (( ( ((( ( ( ( ( ((HOHOHOHOHOHOHOHOHOHOHOHOOHOHOHOHOHOH LALALLLALAALALALAL ))))))) anannanananananananand d ddddd d d dd d d HiHiHiHHiHiHiiHiHiHiHiHHiHiHH llllllllllllllllllllllllll elelellleeeleee . .

TTTTTThThThThThThThThThTThTTTTTTThThThThe eee eeeee SShShShShShShShShShShSShShShererererererererererrririiiriririririirilllllllllllll C CCC CCCCCCenenenenenenenene teteteteeeteteeteteeer:r:r:r:r:r:r:r:r:rr:rr WiWiWiWiWiWWWiWiWiWiWiWiWiWiWiWillllmlmlmlmlmmlmlmlmlmlma a aaaaaaa aaaa a MM.M.MMM.MMMMM.MMMMM S SSSSSSSSSSShehheheeeehheheheeehheheheherrrrrrrrrrrrrrrrrrrrrrrrrrililiiliilililiilili lllll CCCeCeC ntntntntereree i iis ththhththt eeeeeeee e unuuuunununununuuuununnniviviviviviiiviiivviviverrerererererrererer isisisiisisisisiisisisisisisisisisisityttytytytytytytytyytytyttytytyttytytytytyttytyy’s’s’s’s’’s’s’s’s’s’s’s’s’s’sssssss n nn n n nn nnnn nnn nnnnnnneweweweweweweweweweweweewewwweweeewwwesesesesesesesseseseseseeeseesessessttt tt tttt ttt aaaanaaannannd d d lalaargrgrgrgesesessssssssessssst tt t t tttt fffafafafaaaaaafaaaf cccccciiciccccccccccccciliiiitytytyty, , , oofffffffffffffffffffefefffffeeeeeffeffffefefferiirrr ngnngngngngnngngngngnggngngngngngngngngnggnggnggnggggga a rarangngngge e e ofoff a a acacacadededeeemimiimimimimic c c c c c ananananannnndd d d d d dd ouououoououtrtrtrtrtrtreaeaeaeaeaeaeachchcchchchchchhhh p p prrorogrgramams s fofocucusesed d ononononnn hhh hh h h hh heaeaeeeaaaeaeaaaaltltltltltttthyhyhyhyhyhyhyhhyhhhyhyyy lllll l l ll liviviviiviviviivvivvinininininiiinngg g gg g ggg ananananananananananananand ddddd dddd d dd weweweweweweeeweewwweww lllllllllllllllllllneneneneneneneneneneneneneessssssssssssssssssssssssssssssss pppp p p ppppp pp pppp p prororrrororororoororrrororororroroooomomomomommmmmmm titititionnnnnnnnnnnnnnnnnnnnnoo .. . ... ThThhhhhhhhhhhhhhhhhhhhhhheeeeeeeeeeeeeeeeeeeeeeeecececececeececccccc nntntntn ererere i i iiis s s hohohomemmmemee tt ttooooo o thththhhththeeeeee e acaacacaacaca adadadadaddada ememememmemiciciciciciccic DDDDDDDepeepppararara tmttmeeeneent t fof HHHHHHH HHeaeaeaeaaltltttthh hhhh ananana d d WeWeWeWWWWWWeWWWWWeWWWW llllllllllllllllll nenenn sss, withhhhhhhhhth cclalalassssroroomomommms,ss, dddd dddededededeeedediciccciccciiicatatattttttedededddededededed ssssss s ss spapapapapapapapapapapapacececececececececececcecececceccececcececeeeeceffofoff r r unundedergrgr rar duate researchh, a hiiighghghghghg -tech tttet acachingngngnngng/ddeemmmonoonstststtrararar titiononnn kkitittttchchchchchchhchhchhhchchc eneeeenennnnnenennnnnn, , ,, , , , , ,, ,,,, ananand ddd rereeeseseseseseeeeararararararararaaaarraraaaarararraararaa chchchchhhhhhhhcch aaaaa aa aaaaandndndndndnndn lleaearnnininnngggggglalalalallal bsb .Theee S Sherrrrrriliiiiii l CeCeCeeeeeenter includededededeeeeeeeeeeeeeeessss sssssss ss sss ananna ee expxpxpxxx ananansisisiveve fififi fifi t ttnenenessssss c ccenenenennneeennntttetetetetetetetteteeerrrrr,rrrrrrr,rrr,rrrr aaa a a a b b bbioioioioiooiooioiooooioioffefefeffefefefefffffefefeeeededededededededdededeededdde bababababababababbababababbabaaaackckcckckckckkcckckkckcckkckkckckcckckcck ll l l ll l ababbababababaabababbbb a a a a a aa nnndndd mmmmmmmmmmmmmmedededdedddededdddddddddedddditiiitttitittiitttitttatatatatata ioioiooion nn rrrrrrrororrrrrrorrrrror omoomomomommomomomoomommomoooooomooooooo , , , anaananaa d tththththththhtththht eee eeeee WWWWWeWeWeWWWWWW lllllll neneneeeeessssssssssssss CCCCCCCCCCCCCCCCCCCCCCCafafafafaaafé.éééééé

KiKiKKiKK mmmmmmmmmmmmmmelelelelelelelel A A AA A AAA A AAAArererereerrrenananananana: : : : : ThThThThThThe e e ee neneneneneew w w w w KKiKKKK mmmmmmmmmmmmmmmmmmmmmeleleeleleleleleelee A A AAA A AAAAAAArerereenanana, , wwwhich isssi p pararara tttt t ofofofofofofofofofofooff t t t ttttt tthehehhehehhheh SSS hheherrrrrrr iiililll CeCeCeCeCeeCeeCentntntntnttntntntntnterererereeererr, ,, , , caccccacacacacaccccann n nnn n seseseseseesess atataatatatatataaaatat uu uuu u u upp p p ppp tottotooooooooo 3 3 33,8,8,8,8,8888,8,88888, 00000000000000000000000peopoppppppopopppleleeeleelellellelle f f f ff f ffffforororororororoor cccccc conononononncececececertrtrtrtrtr s,s,ss,s, ccc cccomomomomomommmememmmmencncncncncncnccncnccemeeememememememeemememenenenenennenennennentstststs, , , cocooc nnvvocatttioioiooonsnnn , , , leleleectctctctctttttctttctururururururururu eeseseses,, ,, , ,, iinininiiii teteetercrcrcr oloolleeelelegigiggiiig ataatatatatatatataaaattaa e e e eeee e ee e mememememmememeememenn’n’n’n’nnnnnn s ss s sss ananananananannndd dd d ddd wowowowowwowwww mememmememeeen’n’n’n’nnn’nn s s ss ss bababbabbabababababababbbaabaassss-----s-sss-ssketbbbbbbbbbbalalalalaalalallaa l lll l l l ll gagagagagagagagagagggagamememmememeemmmes,s,s,s,sss h h hh h heaeaeaeaeaealtltltltltlth h h h h h fafafafafaf iriririririrs,s,sss,s a aa andndddddddd c c c c c c cc cc cccccomomomoomomomomomomomomo mmmmumumumummmmm nininityyytty eeeeventtts..s.AsAAshehehevvvvviviiiillllllllle e eee ee e e e cocooocoooocococooommmmmmmmmmmmmm unu ity.

Page 29: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

29/// F E A R T H E D O G ///

KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKKuKuKuKuKuKKKuKuKKuKKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAAAsAsAsAAAsAAsAAssssheheheheheheheheehehehheeeeeheheheeeeeevivivvvivivivivivivivivvivivviv lllllllllllllllllle ee eee e eeee ofofofofofofofooooffffo fefefefefefefefeffeeeeeeeeeeeeeeeefersrsrrrrrsrsrssrsrssrrrrsrssrssrssrsr a a a a aaaaaaaaaaaaaa ““““““““““ ““ttotototototttotottooooot p-p-p-p-p-p-p-p-pppp nononononononnonoononononooonotctctctttctctttttccttcctt hhh h hhhhhhhh hh acacacacaccacacacacacaacaaaa adadadadaddadadadaddadadaddadddda ememememememememeememememeemeememememmmmicicicicicicccicicccccicici e e e ee ee xpxpxpxpxpxpxpxpxpxxxppxxpxxpxppxppeerereeeereerereereeeerrre ieieieieieeeeiei ncncnnccccccncncnccnn eee,e,e,e,eeeeeee,,,, ”” ””” ””””” anananananananananananananana d,ddd,d,d,dddddd,ddddd,d,d,d,d,d,d,dddddd b bbb b b bbbb bbbasaasasasasasaaaa edededededededededededeeeeddeeedee o oooooo oo ooon nnnnnn n nnn nnnnn sstststststststststsststsssssttudududududududududdududuuuuuuuddenenenenenenenneneeneneeennnnennennnnnntttt t t ttttt tttttt t ttt ssususususussssss rvrvrr eyeyyyeyyyyyyyyyyyyyy r rrrrrrrrrrrrreseseeseseeseeeee popopopopopoppppppp nsnsnssn esesesesesesssesssssss, , , , , ,,,,,,AsAsAsAsAAsAsAsAsAAsAsAsAsAsAAsAsAssssAshehehehheheheheeeehehheehehehehevivivivivivivivvivivivivvvivvvvillllllllllllllllllllleeeee eee eeeeeee e isisisisiisisisississss rr r r rrrrrrr rananannanananannanaaananaanaanaaaankekekekekekekekekekekekekeekekekekeekeeedddddddd dddd dddd d d d 111111111111111111111111111111thtthththththththtththththththhththttttttttt i ii ii iiii nnnnnnnnnnnnn nnn n ththththththththththththhththhthththttt eeeeeee ee nanaaaatitititttiititittitiitititt onn o on n ththee “c“colollelegege c citty y gegetss hhigighh mamarkrks” lisst. - TThehe PPrir ncncetetonon R Re-e-viviviviv ewewewewewwewwwwwwwwwwwwwwww’s’ss’ssssss’sssssss ““““““ “ “ ThThThThThThThTTheeee ee e e e BeBeBBeBeBeeeeBeBeBeBBeeeBBBeB ststststststttsststststststtstststttstssts 3 33 3 3 3 333 333333337777777777777777777777777777777777777777 C C C CC C C C CC CC CCColololololooolollooololoooololollelelelegegegegegggggggggggg ss s - 2022020201313131333 E EE E dididititititittiononononn”” (A(A(A(AA(((((((((((( ugugugguguggggggggggggusususussu ttt tt tt 20202020202201212121222)))))))))))))

UNUNUNUNUNUNNNUNUNUNUUNUNU C CC CCCCCCC AsAsAsAsAsAsAAsAsAsAsAsAsAsAAssshehehehhheehehheeeheheeheviviviviviviivivivvvvvv lllllllllllllllleee e e eeee rarararararararrrarrrarar knknknknknknknkkknknknkknknkkknnkkkkedededededededddeee 2 2 222222 2 222221st in the nnnaataa ion n as aaa “BeBB sts Buy C C Colololololleeeegegegegeg ,” based on n quququalalitty y ofofo teaeaching, carareeeerr prprprprprprrrprprrpppppp osososososospepepepepepeeeeepp ctctcttttctcccccccccccccc ss,s,s,s,s,ssss,ss, g g ggg ggggg grararrararaaaaaararaarrar duddududududududududududududududduuuuataatatattattaatataaaaaaa iiiioioioiooiiioioi n n n nn nnn rrrraaaararaaaaatett s,s and sstututudedededed ntn debebe t leveel..Off theeehe e e igigiggghththhththhh u niiveerssititieies s inin N NNoororthth C CCararolo inina a a aa a aa ththhththththththththththtththatataatttataatattatatattt mmamamamamamamamamamaammamaamm dededeedeededeedededdd ttttttttttttt ttthehhhehheeeeeheheheehehehhheeheehehhee ll llllll llllisissssssssississsissssisssst,t,t,t,t,t,t,ttt,tt,t,tt,t,tt,ttt oo o o o ooooooonlnnnlnlnlnlnnlnlnlnlnlnlnlllllln yyyy yyy y y yyyyy y yyy y yy yyy UNUNUNUNUNUNNUNNUUNUNUNUNNUNNCCCCCCCC-C-CCCCC-ChChChapapappelll H Hilll,l, aat 13313133tht , , raraaaaanknknknknkeded higigheher r thhthhananaa U UUNCNCNNN AAshheveve ilillele. . RaRaRanknkininngsgsgs p prerereeeepapapapapapapapapapaaap rerererererreerererererrrred d d dddd d ddd dd dddd bybybybybybybybybybybybbyybybybybyy thththththththhthhttt eeee e eee CeCeCeCeCeCeCeCeCeCeCeeeeeCeeeeeeentnntntntntntnnnnnnnnnnn erererrrrrerrrrr fff fffffff fffff oroorooorororrrrororroroorororoooo CCCCCCCCC CCCCCCCCCCCCoooolololololooloooo leeeeeleleeleegegegeggegeegege AAAAAAAAAffffffffffffffffffffffffororororororororororororrorrrdadadadadadadadadadadadaddadadadaabibibibibibibiiibiiilililililillllllllll tytytytyttytytytytytytytytytyttyy a a a a a a a aaaaaandndndddndndndndndnddnndndndn PPP PP PPPPP PPPPPPPPPPrororororororororororoorooooorodudududududududdududududududududduuuuctctctctctctctccctcttcttttcc iviviviviviviviviivivivivivvvi itittttttty.y.y.y.y.y.y.y.y.y.yyyy.yyyyy. - --- - - F FF Forororororoororororororroorroro bebebebebebebebebebebebebebebbbeb s ss s ssss s s ss MaMaMaMaMaMaMaMaaMaMMaMaMaaMaMaMaaM gagaagagagagagagagagagagagagaggagaggaaazizizizziineneneneneneneneenenenee ( ( ( ((( ( (( (((AuAuAAuAuAuAuAAuAuAuuuuAAuuAA guguguguguguguguuguguguuguguustststsstststssss 2 2 2 2 222 22222010101000100000000 2)2)2222222222222

“U“U“U““U“U“U“U“U“U“U“U“U““U“U““U“UU“U“U“U“U“UUUUNNNCNNCCNCNNNCNNNNCNCNNCCCNNCNCNNN A AA AAAAAAA A AAAAAshshshshshshsshsshshshsshshs evevevevevvvvvvveveeevvvvvviiilililililililililiiiillllii leleleleleeeeeeeleleeee aa a aaaaaaaaaaa aaaaandndndndndndndndndndndndndnndndndndnnndn ttttt tttttttthehhheheheheeeeehhehhheehee c cccccccititititittitity yyyyyyy ofofofofofffofoofoffoff A AAA AAAAAAAAAA Ashshshhshshhhhhhhshshhheveveveeeeveevevevevee ililililillililllillelelelelelelleeele aaaaa a arererererreererere sssss s steteeteteeeeteeteteeeepepepepeepepepepepepeppeppe ededddededededeededdedd iiiii i innnnn n nn whwhititewewwatata ererer c ccululultututurerer m mororore ee ththanan a anynyyywhwhwhwhwhwhwhwhwhwhwhwwhwhwhwhwhw eerererererereereee e e e eeeeeeeeeee elelelelelelleleleleleele sesesese ininininininnnnninnninninnnn tt t t ttttttheheheheheheheheheheheheheheehhheeeeheh www ww w worororororororo ldlldldlddddddlldldldlldldlddddddldddlddd.................. . AsAAsAsAsAsAsAsAAsAAAsAAAsAAss didididdidididididdididdddididdiddiddiii e eeeeeee fffrfrffrfrfffffrfrfrffffrffffff ooooooomomomomomoooo t theeheirir l llonononoong g g g lilil ststttt oof f fi rsrst t dedeeeescscs enentsts a andddndnd r racace ee iiiwiwiwiw nsnsnsss, , UNUNUNUNUNUUNNCCCCCC C AAsAsAsAAAsAAsAAshehehehhhehehehevivivvvvvvvv lll e e alalalalalallalalalalaalalla umummummumummumummu s ss s ssssss ss sss anananananananannndddddd d dddprprppprprprppp ofoffesesee sosorsrs a aaaaaaaaaaaaaaaaaalslslslslsslslsoooo o ooooooooo gigiiigivevvevvveveevvvv b baaaaaccacacaccccccaaack kk k toto ttttheheh p padadddldldldlininii g ggg cocommmmmmmm ununititty.yyy.”-”---”- “““ ““HHHoH nnonon r r RoRollll: : ThThhe e BeBeeB stst O Oututu dododooror SSchchooooooooooolslslslslslslsllsslsl i ii ii i i ii i i iiiiinnnnnnnn n n n n nnnn ththththththththththhhththhe ee ee e e eeeeeeeeeBlBlueueueueueeue RRididgege,”,”””””””””””””” B B B B Blllluullllllll e e RiRidgdgggggee eeeeeeeeeeee e OuOuOuOuOOOOOOuOOuOOOOOO tdtdtdttdttdttdooooooooooorsrsr ( ( (((((AuAuA gugugugggggggggggg stst 2 2 222010100112)2)

UNUNUUUU C C AsA hehevvvvivviviviviiivvvivvvivvvvvv lllllllllllllleeeeee eeeeeeeeeeeee isisisisisissisisiisisisssissiissssssss “““““““““““““ ononononnonoooononooonnnnnnnnonoonoo eeeeeee ee e ofofofofofofofofofofofooffoofofoofoooo tttttttttttt t ttthehehehehehhehehehehhehehhehheeheehhe bbbb b bbbbbbbb eseeseseseseseesesessseseseesssessssttt t t t ttt t tt t edededededeeedeeee ucucucucatatioiooonanan ll babargrgaiainsns i inn ththe e cocoununtrtry.y.” ” FoForr nininene c cononononoononononononoonooononnnnnno seseessesesesecucucucucucuccuutiiitiiiititititititiiit veveveveveveveee y yyy y yyeaeaeaaaeearsrssssrsrsrsrs,, ,UNUNC C AsAshehevivillllllllllllllllllllllleeeee’e’e’’e’eee’eeee’eeeeeeee s s sssss ss ss EnEnEnEnEEnnEnnvivivivivivviviviv roroorororooonmnmmnmnmnnmn enenenennentatataatatallll StStSStStttStStudududuuduuuduuuu ieieieieeees s s s ss ss s PPrPrPrPrPrPPPrrP ogogogogogogoggrarararararararaaam mm mmmmmmmm hhhahhhahhhhahahhhhhahahaas s s ssssss bebebeebebebebebebebeeebebebeebebebeeeenenenneeneneneneeenene nnnnnnnnnnn nnnn nnnnnnnamamammamamamamamaamamammmmmamamamammeddedededededeedededeeededededded ttttttttt tt tttt ttooo ooo oo o ooo o oo ththththththththththththththththhthheeeee eeee eeeeeeeeeeeee lililililliistststststststststttttttttt ooo oo o o oo of ff ff prprppppp e-e-prprofofofoffoffffffofffffffffffffo eeseseseseseseseesseeeeeee sisisisisisisiononononoononnno alalaalaalaall ppp p ppprorororrororrororo--grgramams s wiwithth u unuuuunususususssusususususususuususuuualalallaaalalaalallalalalalaala ssssss ssstrrtrtrtrtrtrtrttrtrtrtrtrtrtrtrtrrrrreneenenennnenenenennnnnenenenne gtgtgtgtgggtgtgtggttgtgthhhhhhhhhhhhhhhhh h ininninininiiinininininninnnnnn p ppp p pppppp p p p prerererererererereeereeeeeepapapapapapapapapapapapapapapapapap ririririririririririririrrririrrringngngngngngngnggngngngngnnggngngngnnnggn sssssssssss s ssss sstutututututtututtuutututuutututuututudedededeededeeedededededeeeeedeentntntntntnnttntntnttntntnnntnn sssssssssss s ss fofofofofoffofofoofofff r r rrr rr cacacacacaaccaccaarererererererereererererereerrs.s.sss. - -- - T TTTT TTThehehehehhehehh F F FFFFFFFFFFisisisisisisisssskekekekekkekkkekeke G GGGGuiuuiuuu dedddedeededeee t t tttt ttt to o oooo CCoCoCCCCCoCoCoCCoolllllllllllllllll egegegegegegeggegeegegeggesesesesssesesessesseses, 20202020202020020202001313333 EdEditioi n n (J(Jululy y 20012122)))

UNNC C AsAshevillee is listed amamong AmA erica’s “green” ccollllegeges aandnd uuniniversrsittiees.s - TThehe PPririncncettonon RRevevieiew’w’ss ““G“Guide to 3222 Grreeenn Colllegegese for 2012” (April 2020112))

UUNC Asheevivillllee is among jjusu t 75 iinsn titutions nationwiw dee nnoteded aas s a a “B“Beest VaV lue”e” p pubublic coollegge. - TThee PPrinceton Reevieww’s’s “20011 BBest Value CoC lleges” (Februuarry y 22012)

UUNC Asheevville e isis o onene o of f ththe e nanatitionon’s’s 5 0 bebest values inn ppppppp bubububbblililic cccc coollllegggggess, , iwithth t thehe fi fif fththhhh l lowowowowowesestt tototatall cost of f faattendinnnnnnnngg gg g g gggg pepepepepepepepp rrr rrr yeyeyeyeyyeyy arararararara , , ,,,,, annananananddddd d thththththeee eeee eieieighghghgg ththth ll lowowowesesest t t t avavavavererereragagagagaggggee e e e dededededd btbttbttbt a aa a amomomomooomomomomonnngngnngngnggg g gg ggrrarar duduatatatatateses. . -- Kiplppppp inininnii gegeer’’s ss s PePP rsrsrssr onalalalal F Financee MMagazinene ( ( (((((((JaJaJJaJaanunuuuunun arararararra yyyy y y yyy 2022020202022202020121222212122212))))))

UNUNUNUNUNUUNUNNC C C CCCCCCCC AsAsAsAsAsAsAsAsAsAsAshehehehehehheeheh viviviviviv lllllllllllee e e ee rarararaaaarararraanknknknknknkkkknkkkssssss ss eeeiiiieeieighghhghghhhhhhghghgg tththththththhhthth i i in nnn ththttthtththeeeee e ee nanananananananann titititititititittt ononoooonnooono a aaaa aaa aamomomomomomomoomm ngngngngng PPPPubububbblililil ccc c c LiLiLiLLLiLiLiLLL beebeebeeeeebbbb raalll l AAArrrrtstststststststs C CCCCCCCCCC ooooololoololo lleeeeeleleegegegegegeeegeg s,s,s,s,s,s,s,s, aa nnndnnnndndnd i i issss ss ss tththhhhhhhe eeeeeee oononono lyyyyy N N NN NNorrth CaCaCaCaCaCaCaCaCaCaCaarororrororororororororor lililiililiililinananannanaaaanana ii iiiiinsnsnsnsnssnsnsn tititttitiitttitittit tutututuuuuuutt titititittititionononnnnnononnnnnoonon lllll lll ll isisisiiisiisi tetetettteetttt ddd d ddd d ddd aaamamamamamaaamononononnnonnnnongg g gggg NaNaNaNNNNaNNNaNaN ttitititttiiiononononooo alalalla L L L LLibibibibbbibibbererererererererereraalalalaaaa AAAA AArtrtrtrttsss ssss CoCoCoCoCoCoCoCCoColllll egegegegeseeseseseeses whooooooooooseseseseesesesse ssssssstutututuuuututut denntttttttsss s s ggrrrrrgrrrrgg aaaaadddaddddduauauauauauauau tteteete wwwwwwittttti h hhh h ththththththttht e eeeeeeleleeeleleeeeeasasaaaaasaaasasasasastt ttt t t t ttt t tttt amamamamamamammmaaamamaamououououououountntnttntntnn ooooooof fff ff dedededededededdd btbtbbtbtbtbbtbtt. .. - - - U.U.U.UUUUUU S.S.S.S.SSSS. N NN NNNNewewewwws ss & &&&&&&&& & WoWWoWoWoWoWorlrlrlrrlrr d d dddddddd ReReReReReReReReReR popopopopopooorrrtrtrtrtrtttrtrr ’ssss’s’’s’’s’s’ “““AmAAmAmAmAmmmmAmmeeeeere ica’s Best Colleges” ((SeSeptpteemmmmmbebebebebebeb rrrr 2000000011111111111))))))))

UNUNUNUNUNNNNNNNNC C C C C AsAsAsAsAsAsAsAsAssAsAsAsssAsA hehehhehehehheheheheehehheeeevivivivivvvivvivvivivivillllllllllllllllllle ee eee iiiiiiisisisisis o oo o onenenneneenenneeeee ooooo oo ooooffffff fff ff f AAAAAmAmAmAmAmAmAmAmAmAmAmerererererrerreriiiiiiciccic ’’’’’’’a’’a’aaa sss ss “1“1“1“1““1“1“1“1“1110000 000 0000 0000 BBBBeBeBeBeBeBeBeBeBeBeBe tststststststtstststss CCC C CCCCCCCCCCCCCC lllolololoololololoolololo lllleleleeeeleelelelleegegegegeggegegegegegegeegegges ss s s fofoof r r hthhhthe e e MoMMoMooMMoMooMoonnneneeeeenen y.y.y.yyyyy.yyyyy”””” ” ---- - BaBaBaBaBaaaBaBaBaBaBBBaBaBaaBanknknknknkknknnnknknknnknknnkrarararararararr teteeeeteteteteeteee.cccccc.cc.ccc.c.c.comomomommmmommmmomm, a aaaaa lelelll adadadadadaddadadddddinininnnininggg gggg g g g gg g g gggg gg ooononononononoonnlilililililineeneneneenene sosososoosoososourururuururuuururururururrrrururrurrcecececcececececcecceccececececececececeececececcecee o ooo oo o o o oo o offffff f f fff ff f fifififi fi fifi fifi fi fifififi fi fi fifififififinananananananananananannannanananannnanaaaancncncncnncncncncncncncnnncnnn iaiaiaiaaiaiaaiaiaaaaaaial ll ll ll llllllll ininninnnfofofooofooooooooooormrrmrmrmrmrmmmmrmrrmmmrmmmmmrr atatatattatataataaaatatattattataaa iooioioooiooooioioioooioiooooi nnnn nn nnn nnnnnnn (J(J((J(J(J((J(J(J(((J(J(J(J(Junununnnnunnuunununnnunnununneeee e eee e eeeee e eee 20202020202020202202020202002220222201111111111111111111111))))))))))))))))

AdAdAdAdAdAdAdAdAdAdAdAdmimimimimimimimmmmimmimimmimmiisssssssssssssssssssssssssss ioioioioioioioioioiiioioioiooioioooonsnsnsnsnnnsnnssnnsnnnssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshssssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 1111009000909090090909009009090999990-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 1211122212222221111221212121221221121250500505050500050500505000505050550050505555555050000 ( (((((( ( ((((( ((( (((FFFFaFaaFFaFFFaFaFaFaaFaFaFaaFaFaaaaallllllllllllllllllllllllllllllllllllllllll 2222222222 2 2 22222 2 222222 010100101101010101010100110100010101010100101011010110110 1)1)1)111)1)))1)111))1))))111)1))1)1

AnAAAAAAAnAAnAAAnAnAnAnAnAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TuTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $5$5$5$55$ ,3,33,3,333333,333333333333393933939393939939939939999939999 (((((( ( ((((((( (((((202020202020202020202020202222222 11111111111111111111111--1111-1-1-1-1-1-1-1-- 2)2)2)2)22))))22)2)2))

AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 9999999999,9999999999,9,00020202022002002020020200020202020200020022000002222202202000020255555555555 5555 5 555555555 (((2(2(2(2(2(2(2(2(2001010111111-1-1-1-11-11-11 122212122222222222))))))))))))) ))) )

AvAAAAAvererererererraaggggagagagagaaaagagagggee e eeee e AAnAnAnAnnununununnnnnn alalalalallllllllll HHHHHHHHH ououuusisisisiingngngng a aaaaaa anndnddddddndddddddnddndndnddd MMM MMMMMMMMMMMMMMM MM MMMMM Meaeaaaeaeaeaaeaaaeaeaeaaaeaeaeallllllll l llll PlPlPlPlPlPlPPPPPP ananan FFFFFFFFFFFFeeeeeeeeeeeeeeeeeeeees:s:s:s: $$$$ $$$$$$$$$$ $$ $$$$7,7,7,7,30330303 222 2 2 2 (2(2(222(22(222(2222(22222(( 0000001011010000 1-11111 1212121221222) )

FiFiFFFFFFFiFFiFiFFFiFiFiFinananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvviviivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennnttttststststttststts’ ’’ fi fi finannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..

Page 30: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

30 /// F E A R T H E D O G ///

Dr. Anne Ponder became the sixth Chancellor of the University of North Carolina at Asheville in October 2005. She began her tenure by leading a campuswide collaboration to create a dynamic and viable fi ve- to seven-year strategic plan and revised mission statement.

With this focus, UNC Asheville has made major strides as a national leader in the liberal arts and has become a one of the top choices for students seeking a rigorous and multi-faceted educational experience.

During her tenure, the university was chosen as the fi rst national headquarters for the Council of Public Liberal Arts Col-leges and several majors in Religious Studies and Anthropology have been added to the curriculum. Dr. Ponder has encouraged innovative collaboration that resulted in a UNC-Chapel Hill satellite pharmacy education program. Building new partnerships with local governments, scientifi c agencies and non-profi t organizations have resulted in agreements with Mission Hospital Sys-tems, the City of Asheville, the Renaissance Computing Institute and others for enhanced learning and research opportunities for students and faculty. This emphasis on collaboration, one of Chancellor Ponder’s hallmark traits, also led to the cultivation, with other campus and community leaders, of some of the largest multi-million donations in the university’s history.

Chancellor Ponder oversaw the largest building projects in UNC Asheville’s history, including New Hall classroom building; Sam Millar Facilities Management Complex; Zeis Science and Multimedia Building; and the Wilma M. Sherrill Center, which houses the North Carolina Center for Health & Wellness and the Kimmel Arena. In each of these projects, environmental sustainability has been a key feature, as dictated by the university’s strategic plan. These green efforts – combined with countless others across campus – have earned the university a host of awards, including repeated recognition as one of the lowest energy consuming agencies in the state.

A strong advocate for community service, Dr. Ponder is a member of the Mission Hospitals Audit Committee, the Asheville Community and Economic Development Alliance, the Children’s Welfare League and the WNC Community Foundation’s Women for Women. She also is a board member for the non-profi t Kendal Corporation.

Before becoming Chancellor at UNC Asheville, Dr. Ponder served for 10 years as president of Colby-Sawyer College, a private liberal arts col-lege in New Hampshire. Prior to that appointment, she held teaching and administrative posts at Elon College (now Elon University), Guilford Col-lege and Kenyon College.

Chancellor Ponder, who holds a doctorate in English from UNC-Cha-pel Hill, is a nationally known expert on institutional effectiveness, stra-tegic planning, and fundraising and resource development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education and wrote the chapter on strategic planning in the American Council on Education’s book “Leading America’s Branch Campuses.”

A native of Asheville, Chancellor Ponder is the daughter of the late Eleanor and Herschel Ponder, both of whom trace their Asheville family roots to the 1780s. She is married to award-winning writer and publisher Christopher Brookhouse.

DR. ANNE PONDERCHANCELLOR - UNC ASHEVILLE

Page 31: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

31/// F E A R T H E D O G ///

Janet R. Cone is in her ninth year as Director of Athletics at UNC Asheville. She also serves the school as Senior Administrator for University Enterprises. This past year was highlighted by the men’s basketball team’s winning the Big South Conference championship for the second year in a row. The Bulldogs set a school record for conference and overall wins. Asheville advanced to the NCAA Tournament where it nearly pulled off one of the greatest upsets in NCAA history when the 16th-seeded Bulldogs lost a close game to top-seeded Syracuse. In addition, the school successfully hosted the Big South Conference men’s basketball tournament with a national television audience and sellout crowd watching the championship game in the school’s brand-new Kimmel Arena. Cone oversaw the successful opening of the Wilma Sherrill Center which houses the Kimmel Arena. She worked to bring the top-ranked UNC Chapel Hill men’s basketball team to open Kimmel against the Bulldogs in a game that was nationally televised. That game was also sold out. The Sherrill Center had more than 100,000 visitors the past year as its hosted various events

from concerts to graduation.

Other successes included the men’s tennis team’s fi nishing in second place in the Big South Conference, its highest league fi nish ever, the volleyball team’s advancing to the semifi nals of the Big South Tournament for the eighth time in the last nine years, and the women’s tennis, men’s tennis and women’s track and fi eld teams being honored for their work in the classroom.

Cone guided the athletic department through a successful certifi cation process by the NCAA. In addition, she brought back women’s swimming as a varsity sport for the fi rst time in more than 35 years.

In the 2010-11 year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.

Three years ago, Chancellor Anne Ponder appointed Cone to the position of Senior Administrator for University Enterprises. In this position, Cone oversees the Sherrill Center, manages specifi c community relationships and serves as a member of UNC Asheville’s major gifts team. She is a member of the Chancellor’s Senior Staff.

In 2009, Cone helped to create the Asheville Buncombe Regional Sports Commission to bring athletic events to the Asheville area. Her leadership helped secure the return of the Southern Conference men’s and women’s basketball tournament to Asheville in March 2012.

Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club which recognizes student-athletes who make a 3.0 or better grade point average each semester. More than 900 student-athletes have made the club during Cone’s nine years, and in 2009-10, a record number of student-athletes earned that distinction.

During that same time period, more than 800 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes earned this impressive academic distinction.

Cone has overseen construction projects that have dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center/Kimmel Arena was completed in the spring of 2011. Funded partly through a $35 million state appropriation, Cone helped raise more than $ 7 million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation, attract major speakers and performances, and have a new home for the men’s and women’s basketball teams. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that were completed in the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past three seasons, and this past spring hosted the Big South Conference men’s and women’s tennis championships for the fi rst time in school history.

JANET R. CONEDIRECTOR OF ATHLETICS • SENIOR ADMINISTRATOR FOR UNIVERSITY ENTERPRISES

Page 32: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

32 /// F E A R T H E D O G ///

Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends. In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi t from each and every day.”

In 2006-07, three different UNC Asheville teams won Big South Conference championships and advanced to the NCAA Tournament. In May 2006, the baseball team completed an amazing run with its fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against topseed UNC Chapel Hill in the College Cup. In March 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.

The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics website, and the implementation of internet broadcasts and video-streaming for six different sports.

Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September 2008, she began a four-year term on the NCAA Division I Leadership Council.

Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.

In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.

Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.

Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach beginning in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.

Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.

Cone was born and raised in Summerville, S.C. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame in 2007. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.

A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.

Page 33: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

33/// F E A R T H E D O G ///

TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS SENIOR WOMEN’S ADMINISTRATOR

Terri Brne is in her seventh year of service to the UNC Asheville Athletics Department. She serves as Associate Director of Athletics for Internal Affairs and as Director of Compliance and Sport Oversight. She joined the UNC Asheville Athletic Department in the fall of 2006. In the summer of 2011, Terri became the school’s Senior Woman Administrator. Brne is responsible for the interpretation of rules by the NCAA and Big South Conference and is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. Brne serves as the Game Administrator for men’s and women’s basketball. Terri also oversees men’s and women’s soccer plus baseball and assists with men’s and women’s basketball. In addition, she works with the Big South Conference whenever UNC Asheville hosts a league tournament. This past year saw Brne help the athletic department pass its NCAA certifi cation and host both the men’s basketball and men’s and women’s tennis Big South tournaments. The Illinois native was an assistant basketball coach at both South Dakota and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance for all sports. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her masters’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.

MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS FOR EXTERNAL AFFAIRS

Mike Gore is in his 27th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.

UNC ASHEVILLE SUPPORT STAFF

Page 34: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

34 /// F E A R T H E D O G ///

Judith BohanBusiness Manager

James WestfallAssistant

Athletic Trainer, ATC

Harmon TurnerTicket Manager

Tim WhiteHead

Athletic Trainer, ATC

Lydee BenoitAssistant Volleyball

Coach

Betsy BloseStaff Assistant

Dr. Herman HoltFaculty AthleticsRepresentative

Rebecca Nelms-KeilDirector of Student

Athlete Affairs

Erin Punter-SpenceDirector of Marketing

and Promotions

Matt PellegrinDirector of Athletics

Media Communications

ASHEVILLE SUPPORT STAFF

Eric LinnellAssistant

Athletic Trainer, ATC

Brett CareyAssistant Men’s

Basketball Coach

Aaron SandersDirector of Bulldog Athletic Association

Joe Burnette Assistant Men’sSoccer Coach

Tom HandAssistant

Tennis Coach

Janell CraytonAssistant Women’s Basketball Coach

Russ GardinerAssistant Women’sBasketball Coach

Kevin EasleyAssistant Men’s

Basketball Coach

Joel WilliamsAssistant Track & Field

Coach

Adam PuettAssistant Cross Country Coach

Honey BrownAssistant Women’sBasketball Coach

Donna PeekAdministrative

Assistant

Brady BurreshDirector of Facilities

Jim WallaceAssistant

Athletic Trainer, ATC

Omar AhmadHead Strength &

Conditioning Coach

Page 35: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

35/// F E A R T H E D O G ///

Brenda Mock KirkpatrickWomen’s Basketball

2nd year as head coach

Michele DemkoWomen’s Soccer

4th year as head coach

Matt KernMen’s Soccer

4th year as head coach

Tom SmithBaseball

5th year as head coach

Jesse NormanCross Country/Track

7th year as head coach

Elizabeth LykinsWomen’s Swimming

2nd year as head coach

Lise GregoryTennis

7th year as head coach

Nick McDevittMen’s Basketball

1st year as head coach

Frederico SantosVolleyball

3rd year as head coach

UNC ASHEVILLE HEAD COACHES

Page 36: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

36 /// F E A R T H E D O G ///

Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.

In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.

The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.

In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.

In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.

UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.

1990-2003

2004-Present

ROCKY

Page 37: 2013 UNC Asheville Track & Field Guide

/// UNC ASHEVILLE BULLDOGS ///

37/// F E A R T H E D O G ///

For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:

Champions in Athletics, Leaders in Life.

For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics

Justice Center, CPO #2600One University Heights

Asheville, NC 28804Phone: (828) 251-6459

Fax: (828) 251-6386www.uncabulldogs.com

“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”

--Rich Davis ’93, Jan Davis Tire Store

“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”

--Pat Britz ’90; former men’s soccer player

BULLDOG ATHLETICS ASSOCIATION

Page 38: 2013 UNC Asheville Track & Field Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

38 /// F E A R T H E D O G ///