Zagor c 2001

Received:5 January 2001

FoodMicrobiology, 2001, 18, 441^451 doi:10.1006/fmic.2001.0422Available online at http://www.idealibrary.com on

Indigenous wine killer yeasts and theirapplication as a starter culture inwine

fermentation

T. Zagorc1, A. MaraŁ z2, N. Cadez1, K. PovheJemec1, G. PeŁ ter

3,M. Resnik4, J. Nemanicí

4 and P. Raspor1,*

Wine yeast strains were isolated from seven fermentations of the red wines ‘Refosí k’ and ‘Teran’, pro-duced in the southwestern part of Slovenia. Among 613 isolated yeast strains, 22 expressed killer ac-tivity against the supersensitive strain Saccharomyces cerevisiae. Killer strains were isolated atdi¡erent stages of wine fermentation but did not dominate in any of them. Species identi¢cation wasbased on the combination of RFLP analysis of an ampli¢ed rDNA region and biochemical^physiologi-cal tests. Killer isolates were identi¢ed as S. cerevisiae, Pichia anomala, Pichia kluyveri, Pichia pijperi,Hanseniaspora uvarum and Candida rugosa. Electrophoretic karyotyping was used to di¡erentiatestrains of the same species. Fermentation properties of four S. cerevisiae strains that possessed stablekiller activity were characterized in fermentations of Malvasia must by studying their population dy-namics and chemical composition and by sensory analysis of thewines produced. In order to comparethe results, spontaneous fermentations and fermentations induced by commercial yeast starters wereperformed concomitantly. The local killer strain SS12/10 showed the best fermentation properties andproduced winewith favourable characteristics. # 2001Academic Press

ORIGINAL ARTICLE

1University ofLjubljana,Biotechnical Faculty,Department of FoodScience andTechnology,Jamnikarjeva101,1000 Ljubljana,Slovenia2Szent IstvaŁ nUniversity, Faculty ofFood Science, SomloŁ iuŁ t14-16,1118Budapest, Hungary3Szent IstvaŁ nUniversity, NCAIM,SomloŁ i uŁ t14-16,1118

Introduction

The fermentation of grape juice into wine is acomplex microbiological process involving in-teractions between yeasts, bacteria, fungi andtheir viruses. Because of their metabolic activ-ity, yeasts play a central role in the must fer-mentation process. During natural fermen-tat-ion, many di¡erent yeast strains undergosequential substitution. The inoculation with

*Corresponding author. Prof. Dr Peter Raspor,Fax: +386 1 2574092. E-mail: [email protected]

Budapest, Hungary4Agricultural Instituteof Slovenia,Hacquetova17,1000Ljubljana, Slovenia

0740-0020/01/080441 +11 $35.00/0

yeast starter cultures dramatically changesthe microbiology of the wine fermentation pro-cess (Fleet and Heard 1993).

Some yeast strains secrete protein or glyco-protein toxins that are lethal to sensitivestrains of di¡erent species and genera andhavebeen designated as killer yeasts. Killer activitywas found among the genera Saccharomyces,Candida, Cryptococcus, Debaryomyces, Hanse-niaspora, Kluyveromyces, Pichia,Williopsis andZygosaccharomyces. Killer yeast strains havebeen isolated from many di¡erent environmen-tal niches (lakes, rivers, fruits and vegetables)as well as from the fermentation of various

# 2001 Academic Press

442 T. Zagorc et al.

foods and beverages. Ecological studies indi-cate that killer activity could be a mechanismof competition, with the production of a toxiccompound by one yeast cell excluding othersfrom its habitat (Starmer et al. 1987, Jacobset al. 1991,Yap et al. 2000).

The genetic determinants of killer activitycan be either chromosomal or extra chromoso-mal, in the form of linear DNAplasmids or dou-ble-stranded RNA virus-like particles. Thekiller phenotype in Saccharomyces cerevisiae isassociated with the presence of two double-stranded RNA molecules: the M genome codesfor toxin and immunity, while L dsRNA en-codes the protein coat for both molecules (Tip-per and Bostian 1984).

Several surveys have been conducted to veri-fy the incidence of killer yeasts in spontaneousmust fermentation. The studies have shownthat killer yeasts are distributed di¡erently invarious wine-producing areas.The incidence ofkiller yeasts varies with respect to the fermen-tation stage and vintage period, di¡ering be-tween the ¢rst vintage and successive ones.Analysis of karyotypes usually shows a mixedkiller population within a wine fermentationinwhich killer yeasts were present.The highestfrequency of the killer phenotype has beenfound among strains S. cerevisiae.The distribu-tion of killer strains is in£uenced by the pHvalue of the must (Kitano et al. 1984, Cansadoet al. 1991, Vagnoli et al. 1993, Hidalgo andFlores 1994).

The enological interest in killer yeasts arisesbecause these yeasts, when present, might dom-inate a wine fermentation.When a killer yeastpossesses positive enological characteristicsand is used as a starter culture, the wine pro-duced can be excellent and the fermentationprocess ‘self-protected’. When selecting killeryeast for a starter culture, it is important totest the strains in their natural environment(i.e. must/wine) since killer strains can showdi¡erent characters in large-scale wine fer-mentation than in laboratory tests with arti¢-cial media (Silva 1996).

The aim of our work was to study indigenouswine killer yeasts: their distribution in se-lected red wine fermentations, their identitydetermined by a combination of molecular andclassical methods, and their fermentation

properties with potential use as starter cul-tures.The local strains used as starter cultureshave already been the object of some fermenta-tion studies (Regodon et al. 1997, Pe¤rez-Coello1999).We performed fermentation experimentswith Malvasia must either inoculated with se-lected indigenous killer yeasts or commercialstarter yeasts, or fermented spontaneously inorder to study microbiological, chemical andsensory properties of must/wine during the fer-mentation processes.

Materials and Methods

Yeasts strains

All strains are stored in the Culture Collect-ion of Industrial Microorganisms (ZIM, Ljubl-jana).

Reference strains

Candida rugosa var. rugosa CBS 613T, Hanse-niaspora uvarum NRRLY-1614, Pichia anomalaNCAIM 1109, P. kluyveri var. kluyveri CBS 188,S. cerevisiaeATCC18824,S. cerevisiae S6 (super-sensitive strain for broad range killer activity),S. cerevisiae ATCC 42917 (K1), S. cerevisiaeNCYC 738 (K2).

Yeast isolates

Indigenous wine yeast strains (497 isolates)were isolated during fermentations of thered wines ‘Teran’ (wineries G, M and S) and‘Refosí k’ (wineries D, K and J). In winery S,spontaneous fermentation (SS) and induced fer-mentation (SI) were conducted concomitantly.The starter culture SI possessed a neutral phe-notype. One hundred and sixteen yeast strainswere isolated from a smear taken from thewinery equipment. Samples were spread onYEPD agar plates (0?5% yeast extract, 0?5%peptone,1% glucose, 2% agar) in di¡erent dilu-tions and incubated for 2 days at 258C.

Assay of the killer phenotype

YEPD agar containing 0?003% (w/v) methylen-blue was bu¡ered to pH 3?0, 4?2 and 4?7 with a

Killer yeasts inwine fermentation 443

0?1M citrate-phosphate bu¡er and inoculatedwith the sensitive strain S. cerevisiae S6.The yeast strains were streaked on top of theseeded YEPD agar. The plates were incubatedat 208C for 3 days (Stumm et al. 1977). Strainswere designated as killers when a clear zoneof inhibition margined by blue-coloured cellssurrounded the inoculated strains. In interac-tion assays, the plates were seeded with killerisolates, and killer strains be-longing to typeK1 and K2 were streaked on top.

dsRNA characterization

Extraction of dsRNA was carried out bythe method of Fried and Fink (1978). Samplesof extracted nucleic acids were separatedby 1?5% agarose gel electrophoresis at aconstant current of 100mA. The nature ofthe dsRNA bands was determined by thedigestion of RNA by 1 mgml71 RNase A(Sigma, St. Louis, USA).

Ampli¢cation of rDNA sequence

Total DNA isolation of the strain was per-formed as described previously by Smole-Mozí ina et al. (1997).

The DNA ampli¢cations were performed inPerkin Elmer PCR System 2400.They were car-ried out in a 20 ml reaction volume containing5^15 ng yeast DNA, 16PCR bu¡er, 20 mM eachof dNTP, 2mM MgCl2, 20 pmol of each primerand 1U of Taq DNA polymerase (PerkinElmer, Wellesley, USA). The primer pair usedfor the ampli¢cation of the 18S-ITS1-5?8S-ITS2rDNA sequence was: NS1 (5’ GTAGTCA-TATGCTTGTCTC 3’) and ITS4 (5’TCCTCCGCTTATTGATATGC 3’) (White et al.1990). Parameters of ampli¢cation were as fol-lows: denaturation at 958C for 2min, followedby 35 cycles (30 s at 958C, 30 s at 608C and 3minat 728C) and by a ¢nal elongation step of 7minat 728C. PCR products were restricted with theendonucleases, HaeIII, MspI and RsaI (Roche,Diagnostics, Mannheim, Germany). Restrictedfragments were separated by electrophoresis in1?5% agarose gels and 16TAE bu¡er, stainedwith ethidium bromide (0?5 mgm171) and docu-mented on Polaroid 667 ¢lm.

Karyotype analysis by pulsed ¢eld gelelectrophoresis (PFGE)

Yeast chromosomes were isolated by the meth-od essentially described by Carle and Olson(1985) and modi¢ed by Raspor et al. (2000). Latelogarithmic phase cultures were embedded ina low melting point agarose and sequentiallydigested with Novozym (Sigma) and Protei-nase K (Roche, Diagnostics).The electrophore-tic karyotyping was performed by the CHEFapparatus LKB-pulsaphorTM (Pharmacia LKB,Uppsala, Sweden). Yeast chromosomes were se-paratedbyelectrophoresisusing1%agarose gelsin a 0?56TBEbu¡er at 128C. Conditions for elec-trophoresis of Saccharomyces strains were as fol-lows: pulse times of 60 s for 15h, 90 s for 8h and100 s for 1h at 180V, and for non-Saccharomycesstrains: pulse times 150 s for 24h, 300 s for 24h,and 600 s for 20h at100V.Gelswere stainedwithethidium bromide (0?5mgml71) and documentedon Polaroid 667 ¢lm.

Biochemical and physiological tests usedfor identi¢cation

Instructions for the preparation of materials,selection of tests and testing conditions werefollowed as described by Barnett et al. (1990).The results were evaluated by the PC programfor yeast identi¢cation (Barnett et al. 1996).

Fermentation of Malvasia must

Experiment: Nine small-scale fermentationswere performed in glass fermenters containing9 l of must.The initial pH value of the must was3?28 and the concentration of sugars was227gl71. No sulfur was added to the must. Indi-genous yeast strains, SS7/11, SS7/16, SS12/10 andSI7/9, were chosen as starters in four fermenta-tions on the basis of their stable killer activity.Commercial starter yeasts, N96, NT7, VIN13and NT45 (AnchorYeast, CapeTown, SouthAfri-ca), induced a further four fermentations of Mal-vasia must of the same origin. One sample ofMalvasiamustwas left to ferment spontaneously.

Inoculum: Single colony cultures were culti-vated in a YM medium (0?3% yeast extract,0?3% malt extract, 1% glucose) until they


reached the late exponential phase. Cells wereharvested by centrifugation and diluted for ¢-nal concentrations in must 105 cellsml71. Com-mercial starters were prepared according tothe instructions of the producer and added inthe same concentration to the must.

Sampling: Samples (40ml) of Malvasia must/wine were taken from the center of the fermen-ter. The samples for chemical analysis werecentrifuged and stored frozen.The results pre-sented refer to the following sampling points:(i) must before the inoculation; (ii) end of fer-mentation (the sugar content remained con-stant). Samples (1ml) were plated on YEPDagar plates in di¡erent dilutions. During ninefermentations, 1919 strains were isolated: mustbefore inoculation (160), spontaneous fermen-tation A0 (120), four fermentations with localkiller starters (852) and four fermentationswith commercial killer starters (787). All iso-lates were tested for their killer activity usingreplica plating method. The isolates from thelast stage of fermentation were also character-ized by karyotyping.

Chemical analyses

Ethanol, methanol, higher alcohols and ethylacetate were determined by gas-chromato-graphic analyses, carried out using a Hewlett-Packard 5890 gas chromatograph. Winesamples (1 ml) with 2-methyl-2-propanol as aninternal standard were injected directly. AHP-INNOWAX column (60m60?25mm with0?25 mm ¢lm thickness) was used.The tempera-ture programme was: 358C/10min, then 58C/min to 1008Cand, ¢nally, 408C/min to 2008C. In-jector and detector temperatures were 2008Cand 2508C, respectively. Hydrogen N-48 at1mlmin71was the carrier gas.

Sugars and organic acids were determinedusing a Hewlett-Packard 1100 liquid chromato-graph with Bio-Rad HPX-87H column.The mo-bile phase used was 0?007M H2SO4. Organicacids and sugars were detected by a UV detec-tor and bya detector of the refraction index, re-spectively (OIV 1993).

Total and free sulfur dioxides were determinedaccording to the methodology of OIV (1993).

Sensory evaluation: The sensory analysis ofMalvasia wines was performed 6 months afterthe end of alcoholic fermentation by highlyskilled wine tasters according to the Buxbaummethod (details available at: http://www.hr/wine/cbuxbaum.html). Results were expressedin the grading of 0 to 20 points, where 20 pointsrepresented the best results. The assessmenttook place in standard sensory analysis cham-bers (ISO 8589).

Results and Discussion

Killer yeasts in the production of the redwinesTeran and Refosí k

Our study of killer yeast distribution was fo-cused on the production of the red wines Re-fosí k and Teran, produced in the SW area ofSlovenia.The occurrence of killer yeast strainswas followed in six wineries with long wine-making traditions. The production capacitiesof the individual wineries di¡ered from smallproduction for domestic use to market-saleproduction. Red wine technology di¡ers fromthe production of white wines through a stepinvolving the maceration of crushed grapesthat occurs with extensive air and equipmentcontact.Therefore, a moreheterogeneous popu-lation of yeasts can be expected.

During seven fermentations of Teran andRefosí k, killer yeasts were found at 11 out of 28sampling points (Table 1). Among the 497 yeaststrains isolated during the fermentations, 19strains expressed killer activity against thesensitive strain S. cerevisiae S6, in laboratoryconditions. On the ¢rst dayof maceration, eightkiller strains were isolated. They all belongedto the non-Saccharomyces species and wereidenti¢ed as Pichia anomala, Pichia kluyveri,Hanseniaspora uvarum and Candida rugosa.The macerated grapes were pressed on day 7of fermentation. At this stage, three killerstrains were isolated in wineries D and SS andfurther three killer strains were isolated fromthe late fermentation phase in wineries D,K and SI. All of them were identi¢ed as

Table 1. Frequency of killer strains among all isolates at four consecutive sampling times during thefermentation processes of Refosí k andTeran wines

Refosí k wines Teran wines

Technological stage Day J D K SS SI G M

Crushing of grapes 0 21/0* 19/1 22/0 19/0 17/2 8/0 14/5Middle fermentation 7 13/0 26/1 16/0 17/2 19/0 18/0 16/0Late fermentation 10 20/0 23/1 19/1 20/0 19/1 16/0 20/0End of fermentation 12 11/0 19/2 14/0 15/2 20/0 18/1 18/0Total 65/0 87/5 71/1 71/4 75/3 60/1 68/5

*First number indicates the total number of yeast isolates, while the second number that of killer strains.

Figure 1. MspI-RFLPof the ampli¢ed 18S-ITS1-5.8S-ITS2 sequence of killer isolates and the strains com-pared to RFLP-database of type strains; Sc S. cerevisiae, Pa P. anomala; Pk P. kluyver; Hu H. uvarum;Cr Candida rugosa, 1. SS7/11; 2. SS7/16; 3. SS12/10; 4. SS12/11; 5. D8/5; 6. D10/4; 7. SK1; 8. SK2; 9. SK3; 10. SI7/9;11. K8/4; 12. G12/6; 13. M1/7b; 14. M1/9; 15. M1/10; 16. M1/11; 17. M1/12; 18. D1/5; 19. D12/1; 20. SI1/3; 21. SI1/8;M.marker.


S. cerevisiae. At the end of fermentation, on the12th day, ¢ve killer strains were present andidenti¢ed as P. pijperi, P. kluyveri and S. cerevi-siae.

Rapid molecular identi¢cation of thekiller strains was performed by restrictionfragment length polymorphism (RFLP) analy-sis of ampli¢ed 18S-ITS1-5.8S-ITS2 rDNAregions (Guillamo¤n et al. 1998, Granchiet al. 1999). RFLP patterns of killer strainsobtained by restriction enzymes, HaeIII,MspI and RsaI, were compared with RFLPpatterns of the type yeast strains from ourdatabase. The RFLP database containedrestriction patterns of 54 yeast type strainsthat have been isolated frequently duringthe winemaking process according to Barnettet al. (1990). Figure 1 represents the rDNA-MspI restriction patterns of killer isolates andthe RFLP of appropriate type strains from the

database. We were able to match 20 RFLPpatterns of killer isolates with the RFLP pat-terns in the database. Based on that, we identi-¢ed strains belonging to S. cerevisiae, P.anomala, P. kluyveri, H. uvarum. Identi¢cationresults obtained from molecular database werecon¢rmed by 7^12 selected biochemical andphysiological tests, suggested for con¢rmationof individual species by Barnett et al. (1996).Results of biochemical and physiological tests(not shown) con¢rmed the accuracy of molecu-lar identi¢cation. However, there were two ex-ceptions where the RFLPs obtained did notmatch. To identify the isolates SI1/8 and D12/2,it was necessary to perform the biochemicaland physiological tests required for identi¢ca-tion according to Barnett et al. (1990).The kill-er isolate D12/2 was identi¢ed as P. pijperi and,for this species, we have not determined anytype strain. The RFLP patterns of the isolate


SI1/8 and C. rugosa CBS 613T did not matchwith each other, although the isolate SI1/8 wasidenti¢ed as C. rugosa by the biochemical^phy-siological testing.

Table 2. Species identity and characteristics of isoand M dsRNA; the strength of killer activity at di¡eractive); sensitivity (þ) and resistance (7) of killer isoand K2 at pH 3.

Identity anddeposition number

dsRNA

Isolate L M

SS7/11 S. cerevisiae ZIM1640

þ þ


þ þ


þ þ


þ þ

SI7/9 S. cerevisiae ZIM1709

þ þ

D8/5 S. cerevisiae ZIM1325

7 7

D10/4 S. cerevisiae ZIM1349

7 7

G12/6 S. cerevisiae ZIM1614

þ 7

K8/4 S. cerevisiae ZIM1423

7 7

SM1 S. cerevisiae ZIM1506

þ þ


7 þþ


þ þ

M1/7b P. anomala ZIM1520

7 7

M1/9 P. anomala ZIM1521

7 7


7 7


7 7


7 7

D1/5 P. kluyveri ZIM1314

7 7

D12/1 P. kluyveri ZIM1367

7 7

D12/2 P. pijperi ZIM1368

7 7

SI1/3 H. uvarum ZIM1676

þ þ

SI1/8 C. rugosa ZIM1681

7 7

Among the 116 yeast strains isolated from asmear taken from the equipment in winery S,isolates SM1, SM2 and SM3 possessed killeractivity (Table 2). All three strains were identi-

lated killer strains; presence (þ) or absence (7) of Lent pH (þ þ þ strong, þ þ medium, þ weak, 7 notlates in interaction assay with killer strains type K1

Activity at pH Interreaction

3 4 5 K1 K2

þ þ þ þþþ þþ þ 7

þþ þþ þ 7 7

þþþ þþþ þþþ 7 7

7 þ 7 7 7

þþþ þþþ þþ þ 7

7 þ 7 7 7

7 þ þ 7 7

7 þ 7 þ þ

7 þþ þþ þ 7


þ þþþ þþ þ þ


þ þþ 7 þ þ

þ þþ 7 þ þ

þ þþ 7 þ þ

7 þ 7 þ þ

þ þþ 7 þ þ

7 þþ þ þ þ

7 þþ þ 7 7

7 þ 7 þ þ

7 þ 7 7 7

7 þ 7 þ þ

Figure 2. Karyotype patterns of killer isolates(a) M. marker; S. cerevisiae strains: 1. SS7/11; 2. SS7/16; 3. SS12/10; 4. SS12/11; 5. D8/5; 6. D10/4; 7. SK1; 8.SK2; 9. SK3; 10. SI7/9; 11.K8/4; 12. G12/6; 13.marker.(b) 1^5 P. anomalaM1/7b, M1/9, M1/10, M1/11, M1/12;6.-7. P. kluyveri D1/5, D12/1; 8. H. uvarum SI1/3; 9. C.rugosa SI1/8;M.marker.


¢ed as S. cerevisiae. Strains SM1 and SM3 pos-sessed stable and strong killer activity thatwas coded by dsRNA molecules. Strain SM2did not contain dsRNA, however it also had astrong and stable killer character. Based on in-teractions of killer isolates and the K1/K2 tox-in-producing strains, it can be concluded thatstrains SM1 and SM3 belonged to killer typeK2, since killer strains of S. cerevisiae belong-ing to the same type do not interact with eachother.

Killer activity of isolated strains was ana-lysed several times during their storage. Thisshowed that all the non-Saccharomyces andsome Saccharomyces strains rapidly lost their

killer activity, although all isolates indicatedvery strong killer activity at the time of isola-tion.Table 2 represents the results of killer ac-tivity determined after 2 years of storage (inglycerol at 7208C), when four strains were se-lected for starters in small-scale fermenta-tions. The interaction test of killer isolatesand killer type K1 and K2 strains was per-formed at pH 3 (the pH of the must). AllP. anomala strains were sensitive to both toxintypes, as well as the strain P. kluyveriD1/5, iso-lated at the early stages of fermentation. StrainP. kluyveri D12/1, isolated at the end of fermen-tation, was resistant to both toxins, whereasP. pijperi D12/2 was sensitive to both of them.Strain H. uvarum was resistant, while thestrain C. rugosa was sensitive to both toxintypes. Strains of S. cerevisiae reacted di¡er-ently to killer toxins K1 and K2. Several weresensitive to K1 (Table 2), while two strains(G12/6 and SM2) were sensitive to both toxins.The result indicated that the isolated killerstrains S. cerevisiae belonged to K2 or someother type of killer toxin, di¡erent to K1 type.

S. cerevisiae killer strains exhibited very het-erogeneous electrophoretic patterns (Fig. 2(a)).They di¡er in the size of large chromosomes(2200^1010 kbp) as well in the size of middlechromosomes (860^700 kbp). Karyotypes of ¢veP. anomala strains belonged to three di¡erentgroups. P. anomala isolates M1/7b, M1/10 andM1/12 exhibited identical karyotypes, whereasthe karyotypes of C. rugosa, H. uvarum andP. kluyveri had speci¢c patterns for their gen-era (Fig. 2(b)).

Fermentation characteristics of four selectedkiller yeasts in fermentation of Malvasiamust

Nine small-scale wine fermentations of Malva-sia must were monitored. Chemical and sen-sory properties of four wines produced bylocal killer strains, possessing stable killer ac-tivity, were compared to the wines produced bycommercial starter cultures and by sponta-neous fermentations. All 1919 isolates weretested for their killer activity, whereas only150 strains from the end phase of spontaneousfermentation and by local strain-induced fer-mentation were characterized by karyotyping.

Figure 3. Karyotype patterns of yeast isolatesfrom Malvasia fermentation. (a) M. inoculatedstrain SS7/16; 1^15 isolated strains at the end of in-duced fermentation. (b) M. marker; 1^15 isolatedstrains at the end of spontaneous fermentation.


All strains from four consecutive samplingpoints of inoculated fermentations (local andcommercial starter cultures) showed verystrong killer activity, indicating that they wereable to suppress the original yeast populationofMalvasia must e¡ectively. Genetic identi¢ca-tion allowed us to follow the succession of in-oculated strain. Presented in Fig. 3(a, b)respectively, are examples of strains in the lastphase of SS7/16 -induced fermentation and thestrains in the last phase of the spontaneousfermentation. Isolates from the end-stage ofinoculated fermentation (Fig. 3(a), lines 1^15)possessed identical karyotype patterns to thepattern of inoculated strain SS7/16 (Fig. 3(a),line M) con¢rming that inoculated strain com-pletely dominated over the indigenous yeast po-pulation of Malvasia must.

Strains isolated from spontaneous fermenta-tion showed signi¢cant chromosomal poly-morphism (Fig. 3(b)), they di¡ered mostly inthe size of larger chromosomes, between 2200and 860 kbp. An extensive study of successionof di¡erent strains S. cerevisiae in ¢ve indepen-dent spontaneous fermentations of Malvasiawas the object of a parallel study (Povhe Jemecet al. 2001), which showed a considerable het-erogeneity of S. cerevisiae strains during theprocess of wine fermentation.

Recent work comparing the e¡ects of di¡er-ent starter cultures and indigenous yeasts hasshown that there are signi¢cant di¡erencesin the chemical composition of the resultingwines (Egli et al. 1999). Our results do not to-tally support these observations. Strains dif-fered mostly in their ability to ferment sugarsof the must. The results (Table 3) showed thatthe strains SI7/16 and SS12/10 possessed goodfermentation character, since the amount of re-sidual sugar was reduced by 98%, whereas inthe spontaneous fermentation, and in the fer-mentations inoculated with strains SS7/11 andSS7/16, the sugar content was only reduced byabout 90%. Commercial starters possessed anexcellent ability to ferment all available sugars.All the wines produced were rich in ethanol,although some di¡erences were observed,which were due to the strains’ sugar fermenta-tion ability.The amount of glycerol synthesizedduring fermentation was higher in the winesobtained by commercial starters (7?3 g l71)

than in spontaneous or in the fermentations in-duced with local strains, where it reachedconcentrations 5?9 g l71 and 6?1^6?8 g l71, re-spectively.

The initial amounts of free and total SO2,naturally present in Malvasia must were4?4 g l71 and 23 g l71, respectively. Di¡erentconcentrations of the ¢nal SO2 re£ected thestrain’s speci¢c metabolism of sulfur com-pounds, since there was no sulfur added to themust at the beginning of fermentation. Theorganic acid content was slightly higher inwines obtained with indigenous starters com-pared to those obtained with commercialstarters, whereas it was lower in spontaneousfermentation. Volatile compounds of allwines showed the most variable pattern. Strain

Table 3. Concentration of metabolic compounds in wines obtained in spontaneous alcoholic fermenta-tion and with the application of commercial and indigenous yeast starters

Must Wines

Sponta-neous

Commercial Indigenous starters

Compound A0 X*+SD SS7/11 SS7/16 SI7/9 SS12/10

Ethanol (vol %) n.d. 12?7 13?7+0?12 12?1 11?9 13?6 13?5Acetaldehyde (mg l71) n.d. 18?2 24?2+7?84 24?5 17?9 37?1 23?6Ethylacetate (mg l71) n.d. 31?5 32?3+4?14 39?9 27?8 28?7 35?8Methanol (mgl71) n.d. 50 55+5?77 55?0 50?0 50?0 60?0n-Propanol (mg l71) n.d. 16?7 27?4+3?04 19?6 22?3 19?7 19?4i-Butanol (mg l71) n.d. 31?2 33?0+9?52 54?3 54?8 31?2 78?6i-Amylalcohol (mg l71) n.d. 195 236+28?6 270 284 216 376Total SO2 (mg l71) 23 15?4 12?3+2?3 12?5 14?6 14?6 11?2Free SO2 (mg l71) 4?4 4?8 4?3+0?6 3?9 3?7 3?6 3?0Glucose (g l71) 113 1?3 0 2?0 1?0 0?0 0?0Fructose (g l71) 114 20?3 0 24?6 22?7 4?6 6?1Titr. Acids (g l71) 9?1 8?7 9?2 10?6 10?7 10?4 9?9Citric acid (g l71) 0?2 0?56 0?65+0?08 0?9 0?8 0?9 1?0Tartaric acid (g l71) 5?0 3?4 3?3+0?16 3?5 3?5 3?3 3?6Malic acid (g l71) 4?0 3?4 3?6+0?20 4?2 4?2 4?2 5?0Lactic acid (g l71) 0 0?18 0?092+0?06 0?16 0?15 0?15 0?18Acetic acid (g l71) 0 0?41 0?51+0?22 0?62 0?54 0?49 0?47Glycerol (g l71) 0 5?9 7?3+0?7

6?16?1 6?8 6?1

Sensory testPlace 8 3^6 7 9 2 1Points n.d. 16?81 17?15^16?92 16?82 16?80 17?20 17?29

*X+SD: the meanvalue of a compound inwines obtainedwith 4 commercial starters with its standard devia-tion.**n.d. not determined.


SS12/10 produced 376mgl71 i-amylalcoholand 78?6mgl71 I-butanol, the largest amountsfound, which may have had a bene¢cial im-pact on the wine. Acetaldehyde produced dur-ing the wine fermentation is known to bestrain-speci¢c, however, the concentrationsin the fermentations of Malvasia did notvary signi¢cantly (17?9^37?1mgl71) althoughstrains of di¡erent origin were used. On thecontrary, Pe¤rez-Coello et al. (1999) observedsigni¢cant di¡erences (18?3^670?9mgl71)among strains tested in fermentations of Aire¤nvariety must.

Sensory tests of wines also did not show sig-ni¢cant di¡erences since the maximal and theminimal points of the wines di¡ered by only0?49 points. Wine produced by strain SS12/10achieved 17?29 points and ¢rst place in theranking, whereas the wine produced by strainSS7/16 16?80 points and the last place.The result

is in accordance with the lower content of high-er alcohols in the case of strain SS7/16. Accord-ing to our experience while conducting thisexperiment, simply modifying the parametersof the individual fermentation process couldproduce better wines.This is already the objectof another study.

Conclusions

The strain S. cerevisiae is responsible for alco-holic fermentationof must intowine, but yeastsof other genera are also important in theearly phase of fermentation (Yap et al. 2000).It was interesting that non-Sacharomyces killerstrains were identi¢ed at the late fermentationstage of red wines. Five di¡erent non-Sacharo-myces species were isolated at di¡erent phasesof fermentation, which could be due to speci¢c


red wine technology that allows longer expo-sure to air and equipment.

As several authors suggested, it might beof bene¢t to use selected indigenous yeaststrains, which are supposed to have an optimalfermentation performance since they areadapted to the must in each area. Since we hada pool of killer yeasts belonging to S. cerevisiaeall isolated from the same wine-producing re-gion, we tried to examine this hypothesis.Other authors have performed numerous exclu-sion tests to select a S. cerevisiae with the bestenological properties (Pe¤rez-Coello et al. 1999).Our approach was straightforward, since weused indigenous killer wine yeast isolates di-rectly as a starter culture in fermentation ofthe white wine Malvasia. In accordance withour ¢rst fermentation trials, we can concludethat the fermentation characteristics of indi-genous killer yeast strain SS12/10 were as goodas those of commercial starters and is appropri-ate for further use as a starter culture.

Winemakers have to consider the question ofwhether to use starter cultures or not. Many ofthem do prefer to use starter cultures, sincethis gives them a sense of ‘security’. The ques-tion as to whether indigenous yeast startershave a greater positive impact on the ¢nal pro-duct than commercial starters is still open todebate and the system ‘starter culture: must/wine’ has to be considered separately for everyindividual system.

Acknowledgements

This work was supported by the Hungarian-Slovenian S & T Cooperation Program 12/98and by the Slovenian Ministry of Science andTechnology (Project L4-8849-0490). Theauthors thankT. J.Van derWesthuizen (AnchorYeast) and Piet Loubser (Institute for Viticul-ture and Oenology, Stellenbosch, South Africa)for the starters.

References

Barnett, J. A., Payne, R. W. and Yarrow, D. (1990)Yeast: characterization and identi¢cation. Cam-bridge, Cambridge University Press.

Barnett, J. A., Payne, R. W. and Yarrow, D. (1996)Yeast Identi¢cation PC Program,Version 4, Cam-bridge, Cambridge University Press.

Cansado, J., Longo, E., Calo, P., Sieiro, C.,Velazquez,J. B. andVilla,T. G. (1991) Role of killer characterin spontaneous fermentations from NW Spain:ecology, distribution and signi¢cance. Appl.Microbiol. Biotechnol. 34, 634^647.

Carle, G. F. and Olson, M. V. (1985) Separation ofchromosomal DNA molecules from yeast byorthogonal-¢eld-alternation gel electrophoresis.Nucleic Acids Res. 12, 5647^5664.

Egli, C. M., Edinger,W. D., Mitrakul, C. M., Henick-Kling, T. (1998) Dynamics of indigenous and in-oculated yeast populations and their e¡ect onthe sensory character of Riesling and Chardon-nay wines. J. Appl. Microb. 85, 779^789.

Fleet, G. H. andHeard, G.M. (1993) Yeastsö growthduring fermentation. In: Wine Microbiology andBiotechnology (Ed. G. H. Fleet) pp. 27^54. Phila-delphia, Harwood Academic Publishers.

Fried, H. M. and Fink, G. R. (1978) Electron micro-scopic heteroduplex analysis of killer double-stranded RNA species from yeast. Proc. Natl.Acad. Sci. USA, 75, 4224^4228.

Granchi, L., Bosco, M., Messini, A. and Vincenzini,M. (1999) Rapid detection and quanti¢cation ofyeast species during spontaneous wine fermenta-tion by PCR-RFLP analysis of the rDNA ITS re-gion. J. Appl. Microbiol. 87, 949^956.

Guillamo¤n, J. M., Sabate, J., Barrio, E., Cano, J. andQuerol, A. (1998) Rapid identi¢cation of wineyeast species based on RFLPanalysis of the ribo-somal internal transcribed spacer (ITS) region.Arch. Microbiol. 169, 387^392.

Hidalgo, P. and Flores, M. (1994) Occurrence ofthe killer character in yeasts associated withSpanish wine production. Food Microbiol. 11,161^167.

ISO 8589 (1988) Guide for the installation of a cham-ber for sensory analysis.

Jacobs, C. J., Fourie, I. and vanVuuren, H. J. J. (1991)Characterization of killer yeast isolates fromChenin blanc grapes and grapes skins. S. Afr.Enol.Vitic. 2, 57^63.

Kitano, K., Sato, M., Shimazaki, T. and Hara, S.(1984) Occurrence of wild killer yeasts in Japa-nese wineries and their characteristics. J. Fer-ment.Technol. 62(1), 1^6.

OIV. Recqueil des methodes d’ analyse desboissons spiritueuses, des alcohols, de la fractionaromatique des boissons. (1993) pp. 117^122, OIVParis.

Povhe Jemec, K., Cadez, N., Zagorc, T., Bubic, V.,Zupec, A. and Raspor, P. (2001) Yeast populationdynamics in ¢ve spontaneous fermentations ofMalvasia must. FoodMicrob. 18, 247^259.

Pe¤rez-Coello, M. S., Briones Perez, A. I., UbedaIranzo, J. F. and Martin Alvarez, P. J. (1999)Characteristics of wines fermented with di¡er-ent Saccharomyces cerevisiae strains isolated


from the La Mancha region. Food Microb. 16,563^573.

Raspor, P., Smole Mozina, S. and Cadez, N. (2000).Identi¢cation of yeasts from grape/must/wine sys-tem. In Methods in Biotechnology,Vol. 14. FoodMi-crobiology Protocols (Eds J. F.T. Spencer and A. L.Ragout de Spencer) pp. 243^257,Totowa, HumanaPress.

Regodon, J. A., Pe¤rez, F.,Valde¤s, M. E., DeMiguel, C.and Ramirez, M. (1997). A simple and e¡ectiveprocedure for selection of wine yeast strains.FoodMicrob. 14, 247^254.

Silva, G. A. da (1996) The occurrence of killer, sensi-tive, and neutral yeasts in Brasilian Riesling Ita-lico grape must and the e¡ect of neutral strainson killing behaviour. Appl. Microbiol. Biotechnol.46, 112^121.

Smole Mozina, S., Dlauchy, D., Deak, T. and Raspor,P. (1997) Identi¢cation of Saccharomyces sensustricto andTorulasporayeasts by PCR ribotyping.Lett. Appl. Microbiol. 24, 311^315.

Starmer,W. T., Ganter, P. F., Aberden,V., Lachance,M. and Pha¡, H. J. (1987) The ecological role ofkiller yeasts in natural communities of yeasts.Can. J. Microbiol. 33, 783^796.

Stumm, C., Hermans, M. H., Middelbeek, E. J.,Croes, A. F. and Dde Vires, G. J. M. L. (1977)Killer-sensitive relationships in yeast fromnatural habitats. Antonie Van Leeuwenhoek 43,125^128.

Tipper, D. J. and Bostian, K. (1984) Double-strandedribonucleic acid killer systems in yeasts. Micro-biological Reviews 48(2), 125^156.

Vagnoli, P.,Musmanno, R. A., Cresti, S., diMaggio,T.and Coratza, G. (1993) Occurrence of killer yeastsin spontaneous wine fermentation from the Tus-cany region of Italy. Appl. Environ. Microbiol.59(12), 4037^4043.

White,T. J., Bruns,T., Lee, S. andTaylor, J. (1990) Am-pli¢cation and direct sequencing of fungal ribo-somal RNA genes for phylogenetics. In PCRProtocols. A guide to methods and applications(Eds M. A. Innis, D. H. Gelfand, J. J. Sinisky andT. J.White), pp. 315^322. London, Academic Press.

Yap, N. A., de Barros Lopes, M., Langridge andHenschke, P. A. (2000) The incidence of killer ac-tivity of non-Saccharomyces yeasts towards indi-genous yeast species of grape must: potentialapplication in wine fermentation. J. Appl. Micro-biol. 89, 381^389.

Zagor c 2001

Documents

Transcript of Zagor c 2001