YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.
-
Upload
daniela-jordan -
Category
Documents
-
view
216 -
download
0
Transcript of YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.
![Page 1: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/1.jpg)
Interaction of NPR1 with basic leucine zipper protein
transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene
YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG
By Di Wu and Brian Kahnamelli
![Page 2: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/2.jpg)
Introduction◦ What is SAR?◦ What did we know about NPR1 Before This Paper?◦ What did we want to learn about NPR1?
Yeast Two-Hybrid Screen◦ Mechanism of Action◦ Limitations of YTH
Why in Tomato? Experiments
◦ Yeast Two-Hybrid Screens◦ In Vitro Binding Affinity◦ Gel Shift Assays
Presentation Outline
![Page 3: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/3.jpg)
Basic Leucine Zipper Transcription Factors (bZIP)
Summary of Results Impact and Implications Future Research
Presentation Outline
![Page 4: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/4.jpg)
Do you know…How many potential diseases are there during the growth period of Rice?
More than 70!
Rice Blast
Rice Bacterial Blight
Rice false smut
![Page 5: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/5.jpg)
Why SAR is fascinating?
1, Broad-spectrum resistance2, Relatively long-term resistance3, “healthy” resistance
What is SAR?
Systemic Acquired Resistance
![Page 6: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/6.jpg)
How to study SAR genetically?
Forward genetic screen.
![Page 7: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/7.jpg)
NPR1 BackgroundGroup Screens Mutants
obtained The year when finished
Screening strategy
Ryals, Novartis
Non-immunity (NIM)
nim1-1 to nim1-6
1995 Infection assay after SAR elicitor treatment
Dong, Duke No PR-gene expression (NPR)
npr1-1 1994 BGL2::GUS reporter system
In 1997, NPR1 gene was mapped and the protein sequence was examined.
![Page 8: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/8.jpg)
Question Break
What do you know about NPR1 protein?
**Wonderful time to improve your Participation Grade**
![Page 9: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/9.jpg)
Structural features of NPR1
593 amino acids, 67 kD Two protein-protein interaction domains:
BTB/POZ and Ankyrin repeats Contains NLS Multiple phosphorylation sites Multiple conserved cysteine residues No DNA binding domain
npr 1-1
BTB ARD
S S
NLSnpr 1-2 nim 1-2
![Page 10: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/10.jpg)
Proposals to dissect NPR1 function in SAR signal pathway
SA receptor?◦ No SA binding activity
Subcellular localization? ◦ Accumulation in nucleus after SAR induction
Transcription factor?◦ No bona fide DNA binding domain
Screen for NPR1-interacting proteins (NIPs)
![Page 11: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/11.jpg)
Purpose◦ To test protein-protein interactions
Requirements◦ Reporter construct of interest in yeast◦ cDNA prey library with spliced activating domain
Activating domain interacts with RNA pol to transcribe the reporter gene
◦ cDNA bait construct with spliced Yeast DNA binding domain (BD) Binding domain interacts with promoter region of the reporter
gene Preparation
◦ Transfect yeast cells with both plasmids and grow on medium complementary to your reporter assay
Yeast Two-Hybrid Screen
![Page 12: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/12.jpg)
Yeast Two-Hybrid Screen
Bait Construct:•Plasmid Vector•cDNA sequence of interest•Binding domain
Prey Construct:•Plasmid Vector•cDNA sequence of interest•Activating domain
![Page 13: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/13.jpg)
Yeast Two-Hybrid Screen
Reporter GeneBD
ADPrey
Bait
RNA Pol
![Page 14: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/14.jpg)
Can you think of any limitations of the Yeast Two-Hybrid experiment?
Question Break
![Page 15: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/15.jpg)
False Positive Results◦ A) Bait already possess an Activating Domain◦ B) Means of selection is error prone◦ C) Prey possess a yeast binding domain – highly
unlikely False Negative Results
◦ A) Post Translational Modifications Ex. Phosphorylation
◦ B) Scaffold protein interaction◦ C) Internal Yeast Error
Protein Folding or Transcription error occurs
Limitations of the YTH Screen
![Page 16: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/16.jpg)
Tomato Library was better characterized than Arabidopsis Library
Tomato Library possessed a positive control◦ PTO-PTI◦ Remove some possibility of False Negative
The quality of a yeast two-hybrid experiment hinges on the quality of a library◦ Is what you’re finding legitimate??◦ Is what you’re not finding legitimate?
Tomato Library
![Page 17: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/17.jpg)
Experimentation
![Page 18: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/18.jpg)
Perform Yeast Two-Hybrid Experiment with known Tomato homologue of NPR1◦ Referred to as TomNPR1
Use NPR1 homologue of NPR1as bait◦ Transfect Yeast with gene, spliced to DNA binding
domain (BD) Screen cDNA Library for potential binding (Prey)
◦ Transfect the same yeast with gene Use of Leucine Drop out Plates
◦ Reporter genes allow yeast to produce Leucine and grow
Experiment 1 – Screen in Tomato Library
![Page 19: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/19.jpg)
Yeast Two-Hybrid Screen
Leucine or β-gal ActivityBD
ADPrey
TomNPR1
RNA Pol
![Page 20: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/20.jpg)
Researchers found NIF1 gene led to positive Y2H result◦ Leucine production, β-gal activity and colony
survival
Results
![Page 21: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/21.jpg)
Results – Figure 1a
![Page 22: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/22.jpg)
Results – Figure 1a
![Page 23: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/23.jpg)
Test each component alone to test for individual activity◦ None found alone
Sequence and Characterize NIF1◦ Search Genebank for homologous structures in
Arabidopsis◦ NIF1 codes for last 2/3 of a bZIP Transcription
Factor Found Three candidates: AHBP-1b (TGA2),
TGA6, and OBF5(TGA2)◦ All are bZIP Transcription Factors
Experiment 2 – Looking into Arabidopsis
![Page 24: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/24.jpg)
Experiment 2 – Looking into Arabidopsis
Figure 2. Sequence similarity between NIF1 and associated homologues
![Page 25: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/25.jpg)
Perform same experimentation in Arabidopsis to confirm that Tomato homologues respond under similar conditions
Only considering 3 possible candidates (bZIP proteins)◦ AHBP-1b, TGA-6, and OBF5 as prey◦ NPR1 as Bait
Experiment 2 – Looking into Arabidoposis
![Page 26: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/26.jpg)
All three bZIP proteins were capable of stimulating a Leucine and β-gal activity indicating protein-protein interaction
Results
![Page 27: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/27.jpg)
Results – Figure 1a
![Page 28: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/28.jpg)
Results – Figure 1a
![Page 29: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/29.jpg)
Results – Figure 1b
Conclude: All three TFs show increased function when compared to the negative control. NPR1 can potentially interact with all of these TFs.
![Page 30: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/30.jpg)
Because Yeast Two-Hybrid is error prone, confirmation by means of other experimentation is required
Researchers aimed to confirm results by performing an in vitro binding test◦ Ni-NTA Resin Pull down Assay (Co-Purification)
Experiment 3 – In Vitro Binding
![Page 31: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/31.jpg)
Experiment 3 – Protocol for pull-down assay
Poly-histidine Tag
NTAScaffold
Ni-NTA resin
![Page 32: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/32.jpg)
Poly-histidine Tag
NTAScaffold
Ni-NTA resinHis-tagged TGANPR1
Experiment 3 – Protocol for pull-down assay
![Page 33: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/33.jpg)
Results – Figure 3
NPR1 & AHBP-1b
Crude Extract
of NPR1
NPR1 & O
BF5
NPR1 & AHBP-1b
(alternate preparatio
n)
NPR1 & Resin
alone
(Neg. C
ontrol)
![Page 34: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/34.jpg)
Experiment 4 – Truncated NPR1 Aim to find regions of NPR1 involved in TGA
binding Create truncated NPR1 gene constructs Perform Yeast Two-Hybrid Screens with AHBP-1b
(TGA2) prey expressed along with truncated NPR1 bait◦ 1-177aa – amino term, 1st exon◦ 1-432aa – amino term, 1st exon, ankyrin repeat domain◦ 178-593aa – ankyrin repeat domain, carboxyl term◦ 1-593aa – Total Protein
Truncations along exon/intron boundries
![Page 35: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/35.jpg)
Active regions appear to be amino end in combination with ankyrin domains◦ 1-432 segment shows activity equal to WT◦ N-terminus alone shows little activity◦ Ankyrin Repeat alone shows little activity
Results
![Page 36: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/36.jpg)
Results – Figure 4a
Figure 4a. Specific regions of NPR1 appear to be more important in regards to binding affinity
![Page 37: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/37.jpg)
Introduce point mutations into highly conserved amino acids within the Ankyrin repeat domains ◦ npr1-1 – histidine 334 to tyrosine◦ npr1-2 – cysteine 150 to tyrosine
Perform Yeast Two Hybrid Screens with these mutants and observe activity
Experiment 5 – Introducing Point Mutations
![Page 38: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/38.jpg)
Base Switches:
Experiment 5 – Introducing Point Mutations
CysteineHistadine Tyrosine
![Page 39: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/39.jpg)
Mutations into conserved amino acids lead to complete abolishment of activity
Results
![Page 40: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/40.jpg)
Results – Figure 4b and 4c
Figure 4b. X-gal and Leucine drop out plates showing loss of activity in npr1-1 and npr1-2 mutants
Figure 4c. Immunoblot of NPR1 protein expression levels in WT and mutant constructs
![Page 41: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/41.jpg)
Basic leucine zipper (bZIP) transcription factors
Marc Jakoby et al. 2002
Primary structure of bZIP domain
Hydrophobic interaction surface of the helices
O'Shea et al. 1991
![Page 42: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/42.jpg)
Leucine Zipper TFs
Marc Jakoby et al. 2002
Binding DNA sequences with an ACGT core.
http://www.bmb.psu.edu/faculty/tan/lab/gallery_protdna.html
MADS-box TFs
Recognizing the CArG-box
![Page 43: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/43.jpg)
Basics about TGA familyPlant bZIP transcription factors are classified into 10 groups
Group D/ TGA/OBF family
Clade II (TGA2/AHBP-1b, OBF5/ TGA5, TGA6)
TGA2
Question: What phenotypes would you expect if the construct 35S::TGA2CT is introduced into col-0 background?
NT: N-terminal region
bZIP: required for DNA binding
CT: responsible for NPR1 binding
TGA factors bind specifically to variants of the palindrome TGACGTCA. Two of these sequences separated by 4 bps are called an activation sequence-1 (as-1).
![Page 44: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/44.jpg)
Aimed to characterize the function of AHBP-1b
PR-1 promoter region has as-1-like element◦ Known to interact with bZIP proteins
Test binding affinity of AHBP-1b to PR-1 promoter ◦ Radio-labeled promoter region◦ Non-labeled promoter region◦ Non-labeled as-1-like sequence
Experiment 6 – AHBP-1b analysis
![Page 45: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/45.jpg)
Electrophoretic mobility shift assay (EMSA)
![Page 46: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/46.jpg)
Question: How is TGA binding to PR1 promoter sequence possible even without NPR1?
as-1-like element: CTCTACGTCACTATTTTACTTACGTCATAGATG
Mutated version: CTCTAttctACTATTTTACTTAttctATAGATG
Results: Figure 5
![Page 47: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/47.jpg)
Band shift observed when AHBP-1b was present
Competitive binding seen between labeled and non-labeled promoter region
Non-competitive binding seen between labeled promoter region and mutated as-1-like element
AHBP-1b can specifically bind the PR-1 promoter region in vitro
Results
![Page 48: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/48.jpg)
Summary – What Have We Shown?
TomNPR interacts with NIF1 NPR1 interacts with TGA transcription
factors via Ankyrin repeat and N-terminus domain◦ Binding is specific and altered by single amino
acid changes TGA transcription factors interact with the
binding domains of PR genes◦ TGA2 binds to promoter region of PR1 specifically
![Page 49: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/49.jpg)
Research helped to further connect SA to SAR by connecting another link in the pathway◦ Showed potential for redundancy as seen in three
bZIPs capable of binding to NPR1 Added to body of knowledge regarding
NPR1
Impact and Implications
![Page 50: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/50.jpg)
Examine bZIP and NPR1 in vivo Loss of function and gain of function
mutants◦ Look at mutants lacking specific TGA TFs alone
and in combination◦ What else can NPR1 and TGAs activate?
Regulation◦ How is NPR1 activity regulated?
What else would you be interested in knowing?
Future Research
![Page 51: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/51.jpg)
TGA 2,5, and 6 have essential, redundant, and overlapping roles
TGA 5 over expression is sufficient to stimulate SAR
NPR1 regulation sensitive to redox changes
Future Research
![Page 52: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/52.jpg)
Future Research
![Page 53: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/53.jpg)
How to further confirm the physical interaction between TGA factors and NPR1 in vivo?
Co-immunoprecipitation
In vivo protein fragment complementation assay (PCA)◦ Bimolecular fluorescence complementation (BiFC)◦ Restoration of dihydrofolate reductase (DHFR) acitivity
![Page 54: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/54.jpg)
Protein fragment Complementation Assay (PCA) using DHFR enzyme
No interaction
interaction
I’m a protoplast.
Subramaniam et al. 2001 Nat. Biotechnol.
![Page 55: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/55.jpg)
Subramaniam et al. 2001 Nat. Biotechnol.
Protein fragment Complementation Assay (PCA) using DHFR enzyme
![Page 56: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/56.jpg)
![Page 57: YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli.](https://reader030.fdocuments.in/reader030/viewer/2022012922/56649db45503460f94aa4fa1/html5/thumbnails/57.jpg)
Questions?