Yours Magazine #72

.88:*�=

How to….<=G�:CFHB=;<H

>4:78�(4�:0

;�Get the best deals on savings;�Look younger in 10 minutes;�Mix food & medicines safely;�Take a cruise for £100

.88:*��

�>TZ�UF^�UTXYFLJ�́ �XJJ�NSXNIJ�KTW�IJYFNQX

‘The day I lost my

cool on TV’

8*59��4(9��

Fiona reveals

172 pages

FREE Pilates for beginners DVD

worth £11.99

‘ I typed up the D-Day plans’

‘ Strictly needs Arlene back!’

Paul O’Grady

Churchill’s Girl Friday

11 key looks you can wear

AUTUMN FASHION SPECIAL7 PAGES OF

BRAIN-BOOSTING

PUZZLES

Your vital foods for super health at 50, 60 & 70+

YOUR072-cover revise.indd 1 15/9/09 15:29:10yoursp001cover.pgs 15.09.2009 14:26 Rival Colour LTD BLACK YELLOW MAGENTA CYAN PANTONE 185 C

As part of the same bulletin, there was footage of Vladimir Putin proudly displaying his pecs as he performed the butterfl y stroke in icy Siberian waters. Fiona confesses: “I’m afraid I started imagining what it would be like if Gordon Brown did something similar. By the time the cameras were back on me, I was struggling to keep my composure.”

Presenting Antiques Roadshow is a very different challenge where composure isn’t quite so crucial. Fiona delights in the job and admits it has her laughing from dawn

It’s hard to imagine the calm and collected news queen losing her cool but in an exclusive Yours interview she reveals how she almost lost it live on air – thinking about Gordon Brown!

…with Fiona Bruce

toH eart

❤❤AH eart

❤❤

by richard Barber

fiona Bruce walks into the west London Greek restaurant and every head turns. She is instantly recognisable from her many TV appearances – but

it’s more than that. Wearing a fi lmy short-sleeved sprigged fl ower blouse and cotton pedal-pushers, her tall, slim frame is heightened by wedge-heeled pumps. Little wonder that conversations are put on hold while she sashays to her table.

Life is treating Fiona (45) very well at the moment, as she’s the fi rst to acknowledge. One of the BBC’s most prized assets, her fl awless reading of the Ten O’Clock News is complemented by her evident enjoyment of presenting The Antiques Roadshow, now back on the box until next spring.

She’s probably best known for her news presenting, which is something she values highly. “The Roadshow is an uncomplicated joy,” she says. “The News is a mixture: sometimes it’s sombre, sometimes it’s fun.”

And sometimes it brings her up short. A recent report involved Palestinian boys being taken into custody by Israeli forces and left hooded for up to 24 hours before being interrogated. “Some of them were barely into their teens. My son, Sam, isn’t much younger so naturally it gave me pause for thought. You’d be an automaton if it didn’t affect you.”

6 YOURS // EVERY FORTNIGHT

YOUR072-6-7 heart2heart.indd 6 14/9/09 13:23:43

YOURS // EVERY FORTNIGHT 7

PIc

S: b

RIa

N a

RIS

aN

d b

bc

to dusk. “Each week, I’m reunited with what now feels like a family team. And everywhere we go, the public could not be more pleased to see us.

“There was an incident recently which temporarily brought proceedings to a standstill. There was a woman in the crowd whom I think it’s fair to call a bit eccentric. The director had called for quiet when this woman suddenly piped up, ‘Oh, she looks so much worse than she does on the News, doesn’t she?’ I reacted in the only way possible. I burst into laughter.”

Fiona is having a ball. Each story, she says, has its own fascination – which must explain why around 5,000 members of the public bring along their curios for valuation at each Roadshow.

“There was a dental assistant convinced that the watercolour hanging on the surgery wall was worth a few bob. The dentist was too busy drilling and filling, he said, but told her to take it to the Roadshow, if she wanted. Our picture expert, Philip Mould, stopped in his tracks when he was walking past her in the queue. The painting turned out to be worth tens of thousands of pounds.”

Another couple were less fortunate: “They brought along a massive oil painting of which they were obviously hugely proud. They presented it with something of a flourish to Philip who had to break it to them gently that it was worth next to nothing. They left the painting there and went back home in high dudgeon.”

It’s hard to foresee a day when Fiona won’t be an integral part of the BBC – but she’s a woman and there has been much debate recently about ageism. She’s typically even-handed on the subject.

“Telly is a visual medium. Women are judged – more so than men – on our appearance, but only up to a point. You’re expected to make the best of yourself – and I don’t have any problem with that. But do women on TV have a shorter shelf-life than men? Probably. Is that fair? No. Am I worried about it? Emphatically not.

The Antiques Roadshow throws up all kinds of surprises, says Fiona, including priceless paintings

“Life is too short to fret about what’s round the next corner. I’m also a firm believer in the fact that there’s more to life than work. I’ve always held the view that work doesn’t love you back. What makes me happy is having a full life as well as an enjoyable career.

“I’m very privileged at the moment because I’m offered more work than I can accept. But, equally, it’s a tough old business and people get discarded for a whole variety of reasons. And sometimes it’s got nothing to do with your age or gender. It’s just that the world of telly has moved on. “Fashions change. In the meantime, you work as hard as you can. You do the best you can do. And then what will be will be.”

There seems little point in asking if everything in her garden is rosy. “Work is wonderful,” she says. “My family are wonderful.” (Fiona and her advertising boss husband Nigel have a son Sam (11) and seven-year-old daughter Mia.) “I’m healthy. They’re all healthy. Everything’s great.”

And Fiona can’t stop herself touching the wooden tabletop for good luck...

fiona shares a secret

‘This will sound so boring but my

treat to myself is to give the nanny

the day off and go and do something

with the kids. That’s what I aim for.

Well, that and the odd facial!’

Life is too short to fret

about what’s around the next corner. You do your best, then what will be will be

YOUR072-6-7 heart2heart.indd 7 14/9/09 13:24:06


womenwonder

By Alison James

Silla Carron is a tiny blonde lady of 60. She’s a devoted mother and grandmother,

a passionate supporter of Liverpool Football Club, and also happens to love tigers.

There’s nothing unusual about any of this, yet Silla is one of the most extraordinary women I’ve ever met. It’s thanks to her that Clarence Way estate in Camden, north London, where she’s lived for the past 16 years is now, by and large, a pleasant place to call home, with a thriving residents’ association, community hall, well-maintained areas of lawn, graffiti-less playgrounds, a five-a-side football pitch and even a crazy golf course.

Silla has taken on the drug dealers and gangs who used to terrorise the estate – in addition to her local authority, the police force and the Government. “I’ve got a very big mouth,” she laughs. “And I don’t take no for an answer.”

Silla was first galvanised into action when her granddaughter Lauren, now 13, was aged six.

“I was walking her across the estate to school one

morning and we passed a man injecting himself with heroin,” Silla recalls. “I went ballistic. None of us, but especially not a little kid, should have to live with something like that. We had junkies sleeping in the stairwells – often they would have vomited outside our front doors. There was a basketball court on the estate, but the local kids were too afraid to use it.

“Addicts who didn’t live on the estate used to buy their drugs in Camden and then come to the estate to shoot-up. Others would park up their cars, crank up their sound systems and buy drugs from the dealers. It was awful. I was tired of hearing people say, ‘It’s got nothing to do with me’. Someone had to do

She’s taken on drug dealers, gangs and governments – and won! Meet the amazing Silla Carron

something, or nothing would have changed. I could have asked to be moved, but I love my home and didn’t want to live anywhere else. And I thought, why should I?”

Silla started the tenants’ association and began to hassle Camden Council to provide money to tidy up the estate.

“To begin with, windows and doors needed replacing,

we needed play areas and improved security,” she says. “Funding from the local authorities is available for all kinds of projects and I started applying.”

To date, Silla has raised some £6 million for improvements and security. She represents her neighbours in court to clamp down

on criminal or anti-social behaviour and has been responsible for securing dozens of ASBOs on unruly youths. Dedicated street wardens patrol the estate and it’s a very different place.

“The wardens and the police are brilliant,” Silla says, as she shows me around the estate. “See the foliage that’s grown up around the trunks of those trees? It needs cutting back so that drug packages can’t be dropped there. I can get my police community support officers or wardens up here and I can get it logged. If I don’t get it logged, then nobody knows about it and it’s presumed there’s no problem.

“It’s an on-going thing. You can’t afford to rest on your laurels. At the moment, my big push is to get the Government to do something about the plant Khat which is chewed by the Somali community mainly. It has an amphetamine effect and can cause violent, unpredictable behaviour. We’ve had experience of it on the estate. It’s illegal in just about every western country except the UK. It should be banned here, too. Alan Johnson’s the eighth Home Secretary I’m going to have a go at, but I won’t rest until I’ve got somewhere.”

Over the years, Silla has

‘ How I saved my estate’

Silla discusses her estate’s

problems with the then

Home Secretary John Reid

PIc

S: R

OB

IN B

Ec

kH

am

; mIR

RO

RP

Ix; B

Bc

; Pa

YOUR072-26-27 Wonder women.indd 26 11/9/09 14:34:49

27YOURS // EVERY FORTNIGHT

been to Downing Street eight times and won several awards, including the Daily Mirror’s prestigious Pride of Britain award. She has also become ‘that woman off the telly’, appearing in the BBC award-winning documentary The Estate We’re In, a daytime series in which she helped the residents to turn around the troubled Wolseley Road estate in Plymouth. Another estate is to be given the ‘Silla treatment’ next spring.

Despite suffering from Crohn’s disease and having a pelvis injury as the result of an

accident many years ago, Silla is working harder than ever at Clarence Way. While she is liked and respected by her neighbours, there have been reprisals which would scare off the majority of people.

“My car has been keyed several times,” she says. “I’ve had excrement thrown at my windows and one drug dealer threatened me with murder. I told him to get in line! My daughter, Vicki, and granddaughter, Lauren, get frightened for me, but there’s no way I’m letting the dealers and the yobs take over. As a

her proudest momentNoel Edmonds presents Silla with her Pride of Britain award. Inset, she tells Tory MPs Michael Howard and David Davis about the problems of estate life.

teenager, I was a real rebel myself. It’s the reason why, over the years, I‘ve taken in kids whose parents can’t cope with them any more and I’ve given them a home. I give them a few rules and after a while, they start behaving better.”

I tell Silla we need people like her in mainstream politics.

“I have thought about it,” she smiles, “but then I realised that once I was part of all that, I’d lose my voice and my power to speak out. I can’t have that!”

‘Someone had to do

something or nothing

would have changed ’

YOUR072-26-27 Wonder women.indd 27 11/9/09 14:34:58


My lessons from lifeChris Graham, 59, was widowed at 30 with a young baby. Now, nearly 30 years later, she refl ects on how attitudes towards bereavement have changed…

// Live life to the full My husband, Colin, a

surveyor, was only 36 years old when he was admitted to hospital with stomach pains which had started on holiday in Malta. He’d always been such a fi t, sporty guy, apart from an operation eight years earlier to remove a growth behind his eye, probably caused by a rugby injury. ‘The problem’ was actually a tumour, which then spread to his liver. I was devastated. There was nothing anyone could do. I was at his side when he died, 12 days later.

// Celebrate lifeIt’s important to remember

the happy times. Although Colin’s funeral was a very heavy, sad service, today friends and family tell heart-warming stories and there is laughter and happy tears. Instead of going to a crematorium on anniversaries, why not make memory boxes with your

grandchildren, including photos and mementoes of happy times together.

// Reach out for helpOur attitude to death has

changed so much over the last 30 years. A couple of days after Colin’s funeral, I left my parents’ house and went back to my home with my baby. It was very much like ‘you’ve just got to get on with it’. There wasn’t a great deal of help, apart from going to your GP for tablets. Now there is a way through depression, despair and loneliness. This is why I’ve thrown myself into my work with the St Albans City and District Bereavement Network. They offer fantastic support through counselling, home visits and social groups.

// Learn to be a good listenerI like to think I have become

a more sympathetic person because of what I’ve been through. I was only 30 when I lost my husband, but in some

ways it’s harder for someone in their 70s when they lose a partner they have had in their lives for 50 years or more.

// Don’t lose touch with friendsIn many ways friends are

the new family – you can talk to them about anything.I’m still in contact with my friend Carol, who I’ve known since I was ten, and I’m fi rm friends with my next-door neighbours and with couples we used to mix with when Colin was alive.

// Don’t give up on fi nding love

You can never replace someone who dies,

but although I’ve had relationships over the years, I’ve never given up on fi nding a soulmate with whom to share the rest of my life.

// You can be alone without being lonely

I keep myself busy. I enjoy the fact that I can do what I want, when I want, and how I want, whether it’s going out dancing or to the cinema.

// Live for the dayThese days, I try not to

plan too much into the future. That’s because, 30 years ago, the future I thought I had was taken away. I live for the day, make the very best of it, and don’t worry about tomorrow.WHAT MADE YOU

WHO YOU ARE TODAY? My dad brought me up to be positive.

Tragically, I lost my wonderful husband at a very young age, but he left me with

our precious daughter and happy memories of the 11 years we shared together.

// Chris works for the St Albans City and District Bereavement Network. A remembrance service for anyone who has been bereaved, will be held at St Albans Cathedral on November 22. For details, contact: www.sabn.org.uk// Other bereavement support: Cruse Bereavement Care runs a helpline on 0844 477 9400. // Chris Graham was talking to Pam Francis P

IC: U

NP

/JO

EL C

HA

NT

WWWWWWWWHHWWWWWWWWHHMMMMMMMMyy ddddddddaaaaaaaa

TTTTTTTTrrrrrrrraaaaaaaa ggggggggiiiiiiiicccccccc aaaaaaaaaaaaaaaatttttttt aaaa aa aa vvvvvvvv eeeeeeee rrrrrrrr yyyyyyyy

oooooooouuuuuuuurrrrrrrr pppppppprrrrrrrr eeee eeee cccc cccc iiii iiii oooo oo oo uuuuuuuu ssssssss ddddddddaaaaaaaauuuuuuuu gggggggg1111111111 yy ee aa rr ss hhhhhhhh

YoursWOULD

LIKE TO

ASK…

YOUR072-37 life lessons.indd 37 10/9/09 11:33:12


Getting fi t is more enjoyable (and you’re more likely to stick with it) if you get the family involved. We’ve got lots of ideas to help you get healthy with the grandkids

Try some of these fun activities with the grandkids and you’ll all be feeling the benefi t

Water babies: Swimming is a great workout for the heart and lungs, and is especially useful if you have joint problems. Many pools now offer free swimming for the over-60s and the under-16s (check with your local authority). If your grandkids are confi dent swimmers, why not challenge them to a race? They’ll love it, especially if they can beat Gran!Old-fashioned fun: Hopscotch, skipping and piggy-in-the-middle kept us active when we were younger. Join in with your grandkids and get a workout while you play.Take a hike: Walking is a relatively easy way to get some extra exercise, whatever your fi tness level. If your little ones are slightly reluctant, you could turn your ramble into a game. Make a list of things that you’re likely to see along the way. The fi rst to tick off all the items is the winner. Do the hula: Come on, you remember how it’s done. Show the grandchildren your hula-hooping skills and they’ll be very impressed. Plus, you’ll have the added benefi t of burning calories and whittling down that waist.

Fungrandkids

with the

What do you give a sick pig?

RIB TICKLER

BBBB LLLLLLLLEE RR

Oink-ment

Our top fi tness kitWalk With Me comes with two Activity Meters (pedometers), which track your movements. You can download them on to a Nintendo DS and compare all the results. Buy from www.amazon.co.uk for £39.96

This traditional skipping rope is well-made with wooden handles. Why not have a jumping competition! Available for £1.99 from Hawkin’s Bazaar (0844 5575261 www.hawkin.com)

Boys will love this Ben 10 Frisbee and you’ll get a great workout – it’s £1 from Poundland. (call 0800 731 5622 for your nearest store).

1 Preheat the oven to 180°C/350°F/Gas Mark 4. Line and grease a 20cm (8in) square baking tin.2 In a saucepan, melt together: 80g (31⁄2oz) butter, 80g (31⁄2oz) brown sugar, 60g (21⁄2oz) golden syrup and 1⁄2 teaspoon salt.3 In a bowl, mix together: 130g (41⁄2oz) porridge oats, 35g (11⁄2oz) each of dried apple and dried apricots (chopped), 25g (1oz) each of dried cranberries, pumpkin seeds and desiccated coconut and 2 tablespoons of sunfl ower seeds.4 Stir in the butter and syrup mixture until combined. Spoon the mixture into the tin and press down fi rmly. Bake for 18-20 minutes until golden. Once cooled, cut into bars and store in the fridge.This project is taken from The Usborne Big Book of Holiday Things To Make and Do (£9.99) available from good bookshops or www.usborne.co.uk For stockists call 01865 883731.

Power-packed oat bars These high-energy fl apjack bars are ideal for the kids. They’re packed with nutritious pumpkin seeds

(full of Omega-3 fats, Vitamin E, magnesium and zinc) for boosting the heart and the immune system.

gggggggg

PPPPPPPPooTTTTTTTThhhhhhhheeeeeeeekkkkkkkkiiiiiiiidddddddd ssssssss

((((((((ffffffff uuuuuuuullllllll llll ll ll ooooooooffffffffoooooooorrrrrrrr bb bb bb bb oooooooo oooooooo ssssssss tttttttt iiiiiiii nnnnnnnn

PPPPPPPPSUPERSNACK

PIC

: JUP

ITE

R IM

AG

ES

FFFFFFFFNEW

uuuuuuuuyyyyyyyy ssssssss oooooo oo mmmm mm mm eeeeeeee ooooooootttttttthhhhhhhh tttt tt tt hh hh hh hh eeeeeeee gggggggg ffffffffeeeeeeee eeeeee ee ll ll ll ll iiiiiiii nnnnnnnn gggggggg

WWWWWWWWaaaaaaaatttttttt eeee ee ee rr rr rr rr bbbbbbbb aaaaaaaa bbbbbbbb iiiiiiii eeeeeeeewwwwwwwwoooorrrr rr rr kk kk kk kk oo oo oo oo uu uu uu uu tttttttt ffffffff oooooooo rrrrrrrr tttttttt hhhhhhhheeeeeeeesssssssspppppppp eeee ee ee cc cc cc cc iiiiiiii aaaaaaaa llllllll llllllll yyyyyyyy uuuuuuuu ssssssss eeeeeeeeMMMMMMMMaaaaaaaannnnnnnn yyyy yy yy pppppppp oooooooo oooooooo llllllll ssssssss nnnnnnnntttttttthhhhhhhheeeeeeee oo oo oo oo vvvvvvvv eeeeeeee rrrrrrrr -------- 66666666 00000000 ssssssss wwwwwwwwiiiiiiiitttttttt hhhhhh hh yy yy yy yy oooooooo uuuuuuuu rrrrrrrr llllllll oooooooo cccccccc aaaaaaaaaaaaaaaarrrrrrrreeeeeeee cc cc cc cc oooooooo nnnnnnnn fifififififififi dddddddd eeeeee ee nn nn nn nn tttttttt tttttttthhhhhhhheeeeeeee mmmm mm mm tttttttt oooooooo aaaaaaaa rrrrrrrr aaaaaaaa cccccccctttttttthhhhhhhheeeeeeee yyyy yy yy cccccccc aaaaaaaa nnnnnnnn bbbbbbbb eeeeeeee aaaaaaaa tttttttt OOOOOOOOlllllllldddddddd ---- -- -- ff ff ff ff aaaaaaaa ssssssss hhhhhhhh iiiiiiii oooooooo nnnnnnnneeeeeeeeddddaaaaaaaannnnnnnndddddddd pppppppp iiiiiiii gggggggg gggggggg yyyyyyyy -------- iiiiiiii nnnnnnnn --------

hhhhhhhh

iiiiiiiidddddddd ss iiiiiiiidddddddd ss

°°°°°°°°CCCCCCCC ////////33333333 555555 55 00 00 00 00 °°°°°°°° FFFFFFFF //////// GGGGGGGG aaaaaaaa ssssssss MMMMMMMM aaaaaaaa rrrrrrrr kkkkkkkk 44444444 ........ iiiiiiiinnnnnnnn)))))))) ss ss ss ss qq qq qq qq uuuuuuuu aaaaaaaa rrrrrrrr eeeeeeee bbbbbbbb aaaaaaaa kkkkkkkk iiiiiiii nnnnnnnn gggggggg tttttttt iiiiiiii nnnnnnnn ........hhhhhhhheeeeeeeerrrrrrrr :::: :: :: 88888888 00000000 gggggggg ((((((((33333333 11111111⁄⁄⁄⁄⁄⁄⁄⁄22222222⁄⁄⁄⁄⁄⁄⁄⁄22222222⁄⁄⁄⁄⁄⁄⁄⁄ oooooooozzzzzzzz)))))))) bbbb bb bb uu uu uu uu tt tt tt tt tttttttt eeeeeeee rrrrrrrr ,,,,,,,,

6666666600000000gggggggg (((((((( 2222222211111111⁄⁄⁄⁄⁄⁄⁄⁄22222222⁄⁄⁄⁄⁄⁄⁄⁄22222222⁄⁄⁄⁄⁄⁄⁄⁄ oooooooozzzzzzzz)))))))) gg gg gg gg oo oo oo oo llllllll dddddddd eeeeeeee nnnnnnnn ssssssss yyyyyyyy rrrrrrrr uuuuuuuu pppppppp

hhhhhhhheeeeeeeeeeddddddddssss ss ss zzzziiiiiiiinnnnnnnn cccccc cc )) )) )) ))

TTTTTTTTrrrrrrrryyyyyyyywwwwwwwwiiiiiiiittttttttbbbbbbbbeeee

Get fi t

YOUR072-63 Fun with.indd 63 10/9/09 11:34:58


?

I’m the eldest of six sisters, and we were brought up on a farm in Connecticut. My

dad worked for what became the CIA and, when I was 11, we moved to Austria. I was very hormonal so, when I was 12, my parents sent me to a boarding school in England called Arts Educational.

At 17, I married the actor, Peter Donat. We lived in Canada, where we did theatre together, and have three sons: Caleb, Chris and Lucas. As that marriage was breaking up after 15 years, I landed the part of Olivia Walton. I didn’t realise at the time how fortunate I was. Now I look back on it with such gratitude and fondness. A lot of people seem to think the show is nothing but sentiment and hugging and kissing and everybody getting married and having babies. That was towards the end. But in the beginning we were dealing with big issues like the book-burning in Germany and Jews emigrating to the United States, the dustbowl, the Depression, racism…

The Waltons has impacted many lives, mostly in a positive way – except for the mothers who’d call me up and say ‘My kids keep asking me ‘Why can’t I be like Olivia Walton?’ They weren’t pleased. We’d sometimes put in 12 to 14-

// Michael was talking to Peter Robertson

Michael Learned is best known for her part

as Olivia in The Waltons, left and above leftShe went on to play nurse Mary

Benjamin in a hospital drama

1981

Michael’s latest film role

is in An American Girl

2008

Whatever

My son, Lucas, was told by a casting director that my name always comes up for big movies, adding ‘People say “Yes, she’s a very good actress, but she’s Olivia Walton and we can’t kill off Olivia”.’ I think that’s less the case now, though. I’m busy all the time. I was recently in the movie, An American Girl, and in February I start rehearsals for a musical play I’ll be doing in Arizona. I want to keep on working… as long

as I can remember lines!I am now on my fourth marriage, to

an Irish-American lawyer named John. We’ve been together 20 years and I have a great life. I recommend husbands called John! We live in a two-bedroom house in Los Angeles with our rescue dog, Daisy. I see as much as I can of my three children and five grandchildren and hope to spend my 70th birthday in April with them.

The only memorabilia of The Waltons that I have is a box of old photos. Occasionally I get a royalty cheque, but over the years it has dwindled. Compared with what people make now we made nothing, but we were well-paid at the time. I got a house and put my kids through private schools. I’ve had a good life, so I don’t feel any bitterness.”

Michael Learned

happened to…PERSONAL

NAME: MICHAEL

LEARNED

AGE: 69

TV FIRST: THE W

ALTONS

BEST KNOWN FOR

:

THE WALTONS

CURRENTLY:

STILL PERFORMI

NG

Best of TV times

PIc

S:

RE

x F

Ea

TU

RE

S, G

ET

TY

Im

aG

ES

, kO

ba

l a

Nd

Pa

PH

OTO

S

hour days on the set, and it was a grind. At the end I’d be exhausted and feel like I hadn’t an ounce of blood left in my body, but the kids would get on the other side of the camera and make me laugh. We were so supportive of each other. In 1979, I left The Waltons and Olivia was seen developing tuberculosis and entering a sanitarium. The truth is, I didn’t want to do it any more. I was spending long hours on the set saying things like ‘Time for bed, kids’, ‘Pass the salt, please’, ‘More coffee, John?’. They didn’t really have anything for Olivia to do that was of interest, and I was frankly bored. So I asked them to release me and they did.

They didn’t kill me off, so they could bring me back if they wanted. And I did return for several specials. Two of my most memorable roles subsequently have been in hospital dramas: Nurse in the early Eighties and Scrubs a few years ago.

1977

YOUR072-76 Where are they now.indd 76 4/9/09 12:26:40


?

This fortnight we turn back the clock to remember what we wore as children…

PL

EA

SE

NO

TE

: WE

RE

SE

RV

E T

HE

RIG

HT T

O P

UB

LIS

H Y

OU

R C

ON

TR

IBU

TIO

N IN

AN

Y P

AR

T O

F T

HE

MA

GA

ZIN

E.

Fashionwe wore

1940…

Here’s a photo of my sisters and me, taken for the Sunday school anniversary. Gwyneth (15) was the oldest, Irene (13) in the middle, and I was the youngest, aged 9. Our mother had bought new dresses especially for the occasion – they were pale green with a pink trim.

Dilys Bartley, Buckley, Flintshire

1945…

This is me (right) with my sisters Iris (centre) and Jennifer. My dress is blue, knitted in a 3-ply silky material. Iris’ dress is similar but in yellow. Jennifer is wearing a smocked dress; she was too young to sit up by herself so if you look carefully you can see Mum’s hand behind her back holding her up.

Jean Worth, Torquay

1951…

I thought readers might like to see this photo of me and my sister Eileen on the beach at Skegness. I’m four years older than her, so I’m the taller one in the picture (although she’s taller than me now). We’re wearing typical beachwear of the day – that is, dresses tucked in knickers!

Christine Dickens, Castle Donington, Derbys

nnnnnnnn

,,,,,,,,eeeeeeee

TTTTTTTThhhhhhhhIIIIIIIIrrrrrrrriiiiiiii ssssssss ddddddddrrrrrrrreeeeeeeessssssssiiiiiiiillllllll kkkkkkkkssssssssiiiiiiiimmmmmmmmwwwwwwwweewwwwwwwwaahhhhhhhheeyyyyyyyyoooooooouuuuuuuu bbbbbbbbee

gggggggg ,,,,,,,, yyyy

1111111199 44 55 ……

rrrrrrrr

ssssssss!!!! eeeeeeee

yyyyss

yyyy

IIIIIIII tttt tt tt hhhhhh hh oooooooolllllllliiiiiiiikkkkkkkk eeeeeeee mmmmmmmmeeoooooooonnnn IIIIIIII’’ mmmmmmmmhhhhhhhheeeeeeeerrrrrrrrtttttttthhhhhhhh eettttttttaaaaaaaallllllll llllllllwwwwwwwweeooooooooffff ddddddddrrrrrrrreeeeeeee

We love to receive your fashion photos. And if we publish yours you’ll receive a £10 High Street voucher, which can be redeemed at many of your favourite stores. Please send as much detail as possible about the clothes and people shown in your photo (60 words please). We promise we’ll keep them safely and return them to you. Send to: Fashion We Wore, Yours, Media House, Peterborough Business Park, Peterborough PE2 6EA or email an image and details to yoursbauermedia.co.uk

1945…

Here’s a snap of my sister Nancy and me. I was seven and she was nine at the time. Our Aunty Syl did a lot of sewing and made many of our clothes. The dress I’m wearing had become too short and couldn’t be let down any further so my Aunty insisted on adding in a strip of contrasting material to make it longer. This was done to most of our dresses and skirts. Barbara Hewitt, Victoria, Australia

YOUR072-94 fashion we wore.indd 94 9/9/09 11:16:42


Why did you choose Petra?Geoff, my partner, had always wanted to visit the ‘rose-red’ city in Jordan. Designated a World Heritage site, it sounded like a once-in-a-lifetime experience, and we weren’t disappointed!

What are your must-see places?I loved the Treasury, the tomb of a king, which was carved into the sandstone rock face. You approach it, and the ancient city, through a narrow gap in the hills called the Siq. This opens up onto the Street of Facades, past an amphitheatre built in the fi rst century AD.

What are your must-do activities?I’d recommend a guided walking tour, split over a number of days as there’s so much to see. We marvelled at the skills of these ancient people, and the Romans who came later.

On the second day our guide took us up an almost vertical stairway to the Place of Sacrifi ce. From the top we could see Egypt, Israel and Jordan – stunning – and well worth the climb. Then came the three-mile descent

using a different path through narrow rock gaps, steep uneven steps with sheer drops to one side (and no hand rails!).

Where would you recommend eating?When we weren’t dining in the hotel

we went to Petra’s only restaurant to enjoy traditional fare such as

tagine and fresh fi sh.

What was your most memorable experience? On the last day we visited the Seven Pillars of Wisdom

in Wadi Rum, and ended the day at a Bedouin camp where

we enjoyed dinner and traditional singing under millions of stars.

Any hidden pitfalls to be aware of? Petra is not a place to visit if you don’t like walking and aren’t prepared to pay for the city’s horse and carriage taxi service. There is a bus, although this is a bit of a bumpy ride!

travel ✽

We’d love to hear about your travels. Please send your holiday review (300 words) with photographs (including one with you in it), with your name, age and address to: Sheena Correa at the Yours address on page 49 or email [email protected] with ‘Readers’ Travels’ in the subject line. We pay £50 for each story we publish.

The city

ccccccccii ee nn tt cccciiii tt tt yy yy ,, ,, hhhh iiiiiiiillllllll llll ll ll ss ss ss ss

oooooooo aaaaaaaatttttttt tttt tt tt hh hh hh hh ee ee eeee eeeeeeee,,,,,,,, aaaaaa aa nn nn nn nn dd dd dd dd tttttttt hhhhhhhh eeeeeeee

WWWWWWWWhh ee rr ee wwwwoooo uu uu llll dddd yyyyooooWWWWWWWWhhhhhhhheeeeeeee nnnn nn nn wwwwwwww eeeeeeee wwwwwwwweeee

wwwwwwwweeee ww ww ww ww ee ee ee ee nnnnnnnnttttttttoooooooo eeee ee ee nnnnnnnn

ttttttttaaaaaaaagggggggg iiiiiiii

WWWWWWWWmmmmmmmmOOOOOOOOnntttttttthhhhhhhheeeeeeee

iiiiiiiinnnnnnnn WWWWWWWWddddddddaaaaaaaayyyyyyyy aa aa aa aa tttttttt

wwwwwwwweeee ee ee ee ee nn nn nn nn jj jj jjjj oooo oooo yyyyyyyyssssssssiiiiiiiinnnnnnnn gggggg gg ii ii ii ii nnnnnnnn gggggggg uuuuuuuu nnnnnnnn dddddddd eeeeeeeerrrr

Top tipYou will need a visa

(£7.50), available from the Jordanian Embassy,

call 0207 937 3685 or go to www.jordanembassy/

uk.org)

FA

CTF

ILE

WO

RD

S: J

O W

ATE

RS

How to get there• Royal Jordanian From £463.10 (economy) return from Heathrow from Nov. Call 0207 878 6300• BMI From £251.70 (economy) from Heathrow from Nov. Call 0870 6070 555

Where to stay(All include breakfast and taxes)• Budget Petra Palace from £100pn. call +962 3215 6723• Mid-range Crowne Plaza from £170pn. Call 0871 423 4896• Luxury Moevenpick Hotel from £240pn. Call +962 3215 7111

Packages• Budget Voyages Jules Verne: 3* Discover Jordan Tour at £795. Call 0845 166 7003• Mid-range Voyages Jules Verne: 4/5* Discover Jordan Tour at £915. Call 0845 166 7003• Luxury Cox and Kings: Splendours of Jordan Tour at £1295. Call 0207 873 5000

Disabled accessHead for the Visitor’s Centre to get a permit (approx £22) to visit Petra on a horse and carriage.All prices correct at the time of going to press.

FACT FILE

iiiiiiii dd ii ff ff hhhhhhhh hhhhhhhh hhhhhhhh kkkkkkkk

Heather and Geoff

yyyyyyyycarved in

Reader Heather Rae (63) recently travelled to Petra in Jordan with her partner, Geoff

the rocks

YOUR072-103-104 Travel.indd 103 4/9/09 11:54:03

Cruise for under £100If the ongoing dreary weather is making you gloomy, snap up a bargain two-night mini-cruise to Amsterdam. Choose from the Abba Tribute Cruise on Oct 1 for £99 or the Comedy Cruise on Oct 10 for £79, both from Newcastle. You’ll enjoy the on-board entertainment and spend five and a half hours ashore. Call DFDS Seaways on 0871 522 9955 or visit www.dfds.co.uk

✽ xxxx

YOURS // EVERY FORTNIGHT104

The Isle of Wight has become renowned as a top foodie destination.The Priory Bay Hotel

near Seaview is a must to celebrate anniversaries or special occasions. The six-course tasting menu includes numerous seasonal island specialities such as Isle of Wight Blue Cheese, Dunsbury Lamb and Bembridge Lobster. Or else follow Wightlink’s Taste Trail, which takes in 20 foodie destinations to suit every pocket or palate. Highlights include the Newchurch garlic farm and Farmer Jack’s shop at Arreton Barns.

Salty’s restaurant in Yarmouth is the best place for a fish supper fresh from the sea, priced at £15 for 2 courses.TOP TIP Supersaver fares to the Isle of Wight start at £35 inc a car and up to four people. Call 0871 376 1000// The Priory Bay Hotel, Seaview, has two-night autumn deals (from Oct 1 2009) for £55 pppn inc return ferry crossing from Portsmouth or Southampton and complimentary afternoon tea. Call 01983 613146// For Isle of Wight Tourist Information: Call 01983 813813

The Autumn Woodland Deer Walk and Breakfast at Castle Drogo in Devon.Castle Drogo and its surrounding estate is located within Dartmoor National Park and was taken on by the National Trust 30 years ago. On October 18, you can join a guided walk around the castle’s 600-acre grounds during the fallow deer rut. This is a chance to see and hear deer, and find the signs of their life in the surrounding woods. Afterwards, enjoy a delicious home cooked full English breakfast in the new restaurant.Castle Drogo, Drewsteignton, near Exeter, Devon EX6 6PB// The Autumn Woodland Deer Walk and Breakfast, Oct 18, 7.30-10am. Adult £16 (inc breakfast), Children under 12 £10 (inc breakfast). Booking is essential. To book call 01647 433306 or visit www.nationaltrust.org.uk

In 1987, American Airlines saved $40 000 simply by eliminating one olive from each salad served in first-class!

Swine flu insurance Don’t let swine flu catch you out! Check that your travel insurance covers cancellation with a pay-out at least equal to the holiday cost. The Association of British Insurers says that you’ll need a diagnosis confirmed. For England, call the National Pandemic Flu Service 0800 151 3100 to make a claim. For Scotland, Wales and Northern Ireland, consult your GP.

DAYS OUT

TR

AVEL BAG

Cheap moneyThe popular money-saving website www.lovemoney.com recently chose the Caxton FX prepayment card as their best buy for travellers as it imposes no ATM withdrawal or commisson charges. Pay a one-off £10 fee and load it with money before you travel to make payments and withdrawals without fees. Call 0845 222 2639 or visit www.caxtonfxcard.com

Words: Jo Waters

Great views and great local food make the Isle of Wight an attractive holiday destination

Olive another one!

The Isle of Wight: Foodies’ Paradise

YOUR072-103-104 Travel.indd 104 4/9/09 11:54:30

Male, 60, hippy-type, slim build, enjoys nights in and out, seeks female, 50s, also hippy-type, to enjoy the good times for relationship. Lincs area SEPT2-209

Caring, active gent, 75, medium build, dog-lover, car owner, non-smoker, seeks lady of similar age for friendship. South Birmingham SEPT2-210

Gent, late 70s, widower, kind, caring, good sense of humour, seeks lady, medium build, 66-74, for friendship, maybe more. East Sussex area SEPT2-212

Elderly gent, seeks lady in 70s, interests include music, theatre, days out, holidays. North-East area SEPT2-213

Recent widower, 70, 5ft, 6in, fair hair, attractive, car owner. Enjoys humour, music, holidays, gardens – seeks lady friend. Yorks/East coast area SEPT2-214

Lady, 57, 5ft 4in, medium build, non-smoker, enjoys life. Likes music, walking and coast, would like to meet gent for friendship, maybe more. Cambs area SEPT2-215

Attractive lady, 64, non-smoker, limited mobility, likes countryside, Sixties music, animals, reading. Seeks gent for friendship, 56-65, non-smoker. West Mids area SEPT2-204

Lady, 70s, enjoys driving, National Trust visits, music, theatre and bridge, seeks optimistic gent to enjoy the golden years together. Warwickshire/Glos area SEPT2-205

Smart gent, 68, teetotal, non-smoker, enjoys gardening, seeks long-term relationship with caring and homely lady, photo please. Peterborough/Wisbech area SEPT2-206

Gent, 67, many interests, would like to meet lady, must have own car, 55-plus for outings and holidays. Who knows what could happen? Sheffi eld area SEPT2-207

Lincolnshire gent, 62, non-smoker, good-humoured, varied interests. Seeks genuine lady, 50-plus, for friendship, possibly more, who likes countryside, music, theatre. South Lincs/North Cambs area. SEPT2-208

Blonde and attractive lady, 60s, waiting for love to come along from kind gent, 60-70. You won’t be disappointed. North-West area SEPT2-216

Petite lady, early 70s, enjoys walking, gardening, travel and outings. Seeking gentleman companion with similar interests and with a good sense of humour. Hants area SEPT2-217

Active widow, non-smoker, sense of humour, seeks genuine gent for friendship, 65-plus, for shared interests and conversation. South Lincs area SEPT2-218

Young-at-heart widow, slim, good sense of humour, car owner. Seeks gentleman, medium build, late-70s, for companionship, travel and holidays. Lincs area SEPT2-219

Lady, 60s, seeks male company. Interests include dining in and out, dancing, travel including: USA, Canada, Iraq, Japan, Caribbean, Australia. Any area SEPT2-220

Widow, 60s, still looks reasonable, would love to meet nice, caring man for friendship. Photo available if wanted. Tayside area SEPT2-221

Happy lady, 53, non-smoker, seeks gent, 5ft 8in or taller, for friendship, days out. Must love animals, walking, beaches, countryside. Hants area SEPT2-222

Easy-going, cheerful lady, 81, young outlook, sense of humour, loves music, comedy, old fi lms, also many other hobbies, seeking gentlemen penpals. Any area SEPT2-223

Retired lady, early-60s, non-smoker, seeks travel companion for holidays at home and abroad. All letters answered. Devon area SEPT2-226

Smart, caring lady, 50s, slim, attractive, non-smoker, home-lover. Has many interests, such as countryside and cooking. Seeks caring gent, 50-60, for friendship, maybe more. South Derby/Leics area SEPT2-225

Fashionable woman, 54, blonde, lost without her knight to share life. Loves, Cornwall, countryside, trips out and DIY. Photo appreciated. Any area SEPT2-227

Young widow, 60, fi t and active, seeks gent to share my life. Interests include holidays, days out, dining out, theatre and dancing. Coventry area SEPT2-228

Active lady, 66, non-smoker, enjoys days out, meals out, country and westerns. Seeks similar-aged male, with car, for close friendship. Oxford area SEPT2-229

Happy, caring, positive lady, 52, had a few ups and downs, seeks male companion to share life with. Surrey area SEPT2-242


SSSSSSSSEE PP TT 22 -- 22 11 55aaaaaaaarr ee aa ........ SSSSSSSSEE PP TT 22 -- 22 00 88

How do I reply to an appeal?

If you would like to reply to an appeal, please see

our easy-to-follow steps on page 151.

How do I place an appeal?

Want to fi nd someone or something? Simply write

your details on the coupon on page 154.

Welcome to our FREE section devoted to bringing Yours readers together

friends

We can help you fi nd a new romance, a penfriend or simply someone to chat to

Find a friend

of YoursPLUS Find thousands

of new friends online at www.friendsofyours.com

Blue-eyed male, 70, slim, 5ft 6in, fi t, healthy, loves sport, history, countryside, wildlife, walking. Would love to meet slim lady, 5ft to 5ft 4in, age 60-70. Kent area SEPT2-201

Find a friend 149Do you have? 153Where are you? 154

Blonde lady, 66, non-smoker, likes country music. Would like to meet gent for walks, outings, meals and more. Must be caring and honest. West Sussex areaSEPT2-203

BBBBBBBBll7777777700hhhhhhhheehhhhhhhhiiwwwwwwwwWWWWWWWWssssssssll55555555KKKKKKKK

YOUR072-149-154-FOY.indd 149 7/9/09 09:19:58

Young-at-heart, widowed lady, early 70s, seeks kind gent, non-smoker, for companionship. Likes home life, gardening, holidays, days out. Dorset area SEPT2-224

Lady, 70, active, sincere, 5ft 2in, likes dogs, pop music and most things in life. Seeks caring, smart, honest, solvent gentleman, non-smoker, car owner who likes the same. Northants area SEPT2-230

Moving to Devon soon, would like to make new friends. Lady, 56, enjoys the coast, theatre, history, cooking, bird watching and patchwork. Devon area SEPT2-236

Female penfriends wanted for lady, 54. Enjoys gardening, reading, music, knitting, crochet, crosswords, puzzles, history. Any area SEPT2-231

Semi-retired widow, non-smoker, likes animals, occasional visits to art galleries and the ballet. Would like male friend, age 62-72. East Hants area SEPT2-232

Sincere, caring lady, non-smoker, enjoys gardening, walking, holidays, seeks gent, 61-66, non-smoker, for friendship, maybe more. Photo please, all letters answered. East Mids area SEPT2-233

Lady, 72, pleasantly plump, good sense of humour, car owner. Likes dancing, bingo, eating out, holidays home and abroad – give me a try. Somerset/Devon area SEPT2-237

Looking for friends in Cardiff, 60-70, lady, loves gardening, shopping, craft, cinema, days out, non-smoker. Cardiff area SEPT2-238

Widower, 62, nice personality, would like to meet lady, 50-65. Any area SEPT2-211

Honest, attractive, caring lady, young 60s, likes animals, countryside, cinema, outings, walking, reading and car-boots. Seeks sincere gent, non-smoker, for companionship. Any area SEPT2-234

Young-at-heart, pleasant, Cheshire lady, non-smoker, enjoys walking, countryside, and the coast. Seeks gentleman, 65-plus for friendship, companionship, maybe relationship. Cheshire/Wales area SEPT2-247

Attractive, slim female, young 51, loving, loyal nature, solvent, enjoys music, swimming, holidays. Seeks similar caring man, non-smoker, to share future happiness. Essex/Herts/London area SEPT2-246

Lady, 70s, happy disposition, would like male penfriends to exchange interests, enjoys photography, nature, philosophy, sport, writing, bird watching. Any area SEPT2-248


Find a friendLLLLLLLLaaggggggggoooooooooowwwwwwwweeeeeeeeaaFFFFFFFFii nn dd aa ff rr ii ee nn dd

friends

Cornish lady, 63, fashionable, good-looking, seeks smart, sincere male, 5ft 8in, 58-65, non-smoker for friendship. Cornwall area SEPT2-202

Once you have found a friend(s) who you would like to write to, follow these simple steps:1 Write a brief letter to the relevant box number/s introducing yourself and including your contact details.2 Write the box number and month on the envelope of your reply and send it to: Find a friend, Yours magazine, Media House, Peterborough Business Park, Peterborough, PE2 6EA.3 We will forward all letters, FREE OF CHARGE, every four weeks from the current issue date, for four issues only.

Please think of safety fi rst on meeting new friends. While we like to think that our readers are genuine, it’s always wise to take precautions. 1 We recommend your fi rst meeting is always held during daylight in a public place. 2 Tell a relative or friend where you’re going and what time you will return. 3 If the meeting hasn’t turned out the way you hoped, don’t be afraid to say so.

How to reply to an appeal

of Yours

iiiiiiiieeeeeeeennnnnnnn dddd dddd

Yours

SAYS

TAKE CARE

Come and visit our friendship and dating service, Friends of Yours, and start meeting new people online right now!

You can search in your local area, chat online, get your compatibility horoscope and make the most of your profi le with our hints and tips section.

Register today and you can start

browsing instantly at www.friendsofyours.com

www.friendsofyours.com

Find friendship & more at

✔ 100% private and confi dential ✔ Safe & secure ✔ Find friends

in your local area ✔ Pay by cheque

YOUR072-149-154-FOY.indd 151 7/9/09 09:20:05

Yours Magazine #72

Documents

Transcript of Yours Magazine #72