Xanthomonas axonopodis pv. citri uses a plantnatriuretic peptide-like protein to modifyhost homeostasisNatalia Gottiga,1, Betiana S. Garavagliaa,1, Lucas D. Daurelioa, Alex Valentineb, Chris Gehringc, Elena G. Orellanoa,and Jorgelina Ottadoa,2

aMolecular Biology Division, Instituto de Biología Molecular y Celular de Rosario, Consejo Nacional de Investigaciones Científicas y Tecnicas, Facultad deCiencias Bioquímicas y Farmaceuticas, Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina; and bSASHMI and cDepartment ofBiotechnology, University of the Western Cape, Bellville 7535, South Africa

Communicated by Frederick M. Ausubel, Harvard Medical School, Boston, MA, October 10, 2008 (received for review January 4, 2008)

Plant natriuretic peptides (PNPs) are a class of extracellular, sys-temically mobile molecules that elicit a number of plant responsesimportant in homeostasis and growth. The bacterial citrus patho-gen, Xanthomonas axonopodis pv. citri, also contains a geneencoding a PNP-like protein, XacPNP, that shares significant se-quence similarity and identical domain organization with plantPNPs but has no homologues in other bacteria. We have expressedand purified XacPNP and demonstrated that the bacterial proteinalters physiological responses including stomatal opening inplants. Although XacPNP is not expressed under standard nutrientrich culture conditions, it is strongly induced under conditions thatmimic the nutrient poor intercellular apoplastic environment ofleaves, as well as in infected tissue, suggesting that XacPNPtranscription can respond to the host environment. To characterizethe role of XacPNP during bacterial infection, we constructed aXacPNP deletion mutant. The lesions caused by this mutant weremore necrotic than those observed with the wild-type, and bac-terial cell death occurred earlier in the mutant. Moreover, when weexpressed XacPNP in Xanthomonas axonopodis pv. vesicatoria, thetransgenic bacteria caused less necrotic lesions in the host than thewild-type. In conclusion, we present evidence that a plant-likebacterial PNP can enable a plant pathogen to modify host re-sponses to create conditions favorable to its own survival.

bacterial plant pathogenesis � plant natriuretic peptides

Natriuretic Peptide (NP) systems have been identified inmany vertebrates and are commonly associated with organs

involved in cardiac and osmoregulatory homeostasis (1). Inhigher plants, NPs (PNPs) that are heterologues of animal NPselicit a number of responses that are essential in homeostasis andgrowth (2). These include cGMP dependent stomatal guard cellmovements and thus, plant gas exchange (3), regulation of netwater uptake (4), and tissue specific ion movements (5). Bysearching public databases, we found that Xanthomonas axo-nopodis pv. citri, the bacteria that causes citrus canker (6), has aPNP-like protein (XacPNP) that shares significant sequencesimilarity, identical domain organization, and conserved resi-dues, within the active domain, with an Arabidopsis thaliana PNP(AtPNP-A) (7) (Fig. 1A). Because no significant similaritybetween the X. axonopodis pv. citri protein and other bacterialproteins from GenBank was found, we proposed that theXacPNP may have been acquired by bacteria in an ancient lateralgene transfer event (7).

Here, we report that recombinant XacPNP is biologicallyactive and can alter physiological responses in plants. We alsoinvestigate its role during host pathogen interactions and exam-ine whether the pathogen may manipulate host responses tocreate conditions favorable to its own survival.

ResultsEffects of Recombinant XacPNP In Planta. To test whether thebacterial protein can induce PNP-like responses in plants, we

cloned, expressed, and purified a 115-aa XacPNP without thepredicted signal peptide (Fig. 1 A and D). The purified proteinwas tested for effects on plant photosynthetic responses in anindigenous Cape sage, a species that has previously been used totest responses to native and recombinant PNPs from differentspecies (8). Treatment with either XacPNP or AtPNP-A resultedin rapid and significant increase in stomatal conductance (Fig.1B) and, hence, stomatal opening occurred. In the case of thebacterial PNP, the effect was light intensity dependent and lesspronounced at higher irradiances. The increase in stomatalconductance caused by XacPNP and AtPNP-A concur withhigher leaf transpiration rates (Fig. 1C). These increases alsocorrespond to XacPNP- and AtPNP-A dependent increases inleaf photosynthetic rates (Fig. 1D). In addition, the efficiency oflight utilization during photosynthetic CO2 fixation was en-hanced, as evident in the higher apparent photon yield (Fig. 1E),while leaf dark respiration rates were 4-fold higher afterXacPNP, as well as AtPNP-A, application (Fig. 1F).

Moreover, to elucidate whether XacPNP elicits similar re-sponses as AtPNP-A, we analyzed both peptides for their abilityto promote stomatal opening (Fig. 2) and net water uptake(supporting information (SI) Fig. S1). Stomatal aperture eval-uated in orange leaves that were incubated in the presence ofXacPNP or AtPNP-A showed mean stomatal apertures of 3 �m,whereas apertures of 1.2 �m were observed in the control (Fig.2A). These XacPNP- or AtPNP-A-induced aperture changeswere prevented by the guanylate cyclase inhibitor, methyleneblue, suggesting cGMP dependent signaling. As a positive con-trol for opening the auxin analogue, naphthalene acetic acid(NAA) was used, and stomata closed with abscisic acid (ABA)(Fig. 2 A). Differences were statistically significant amongXacPNP, AtPNP-A, and NAA in comparison with buffer, meth-ylene blue, and ABA treatments (P � 0.01). To determinewhether XacPNP induces changes in stomatal aperture becauseof solute accumulation, we measured starch degradation inguard cells of detached abaxial leaf epidermis. Marked XacPNPand AtPNP-A dependent starch reduction occurred in guard cellchloroplasts (Fig. 2B), was statistically different from the controlincubation with buffer (P � 0.01), and coincided with stomatalopening. In protoplasts, net water uptake causes swelling inresponse to the cGMP analogue, 8-Br-cGMP, and it is also

Author contributions: N.G., B.S.G., L.D.D., A.V., C.G., E.G.O., and J.O. designed research;N.G., B.S.G., L.D.D., A.V., C.G., E.G.O., and J.O. performed research; C.G., E.G.O., and J.O.contributed new reagents/analytic tools; N.G., B.S.G., A.V., C.G., E.G.O., and J.O. analyzeddata; and N.G., A.V., C.G., E.G.O., and J.O. wrote the paper.

The authors declare no conflict of interest.

1N.G. and B.S.G. contributed equally to this work.

2To whom correspondence should be addressed. E-mail: ottado@ibr.gov.ar.

This article contains supporting information online at www.pnas.org/cgi/content/full/0810107105/DCSupplemental.

© 2008 by The National Academy of Sciences of the USA

www.pnas.org�cgi�doi�10.1073�pnas.0810107105 PNAS � November 25, 2008 � vol. 105 � no. 47 � 18631–18636

PLA

NT

BIO

LOG

Y

promoted by XacPNP and AtPNP-A. Swelling responses toAtPNP-A and XacPNP are shown to be cGMP-dependentbecause they are inhibited by guanylate cyclase inhibitors (Fig.S1 A). In addition, swelling caused by both the plant and thebacterial PNP is strongly inhibited in the presence of cyclohex-imide, indicating that de novo protein synthesis is required for theresponse (Fig. S1B).

Expression of XacPNP In Planta. A search for signatures in theXacPNP promoter has revealed that it contains an imperfect PIPbox (ATCGC-N15-TTCGC) at a conserved distance from the�10 promoter motif. PIP boxes are plant inducible promoterelements (PIP) that are recognized by the product of the hrpXgene, which regulates the expression of hrp genes involved inpathogenicity (9). We analyzed XacPNP expression in rich andminimal media and observed expression induction in onlyXVM2, a nutrient poor medium that simulates conditions in theapoplastic space to induce expression of virulence genes (9) (Fig.S2). Having established that XacPNP expression is induced inXVM2, we evaluated its expression in plant-pathogen interac-tions by using RT-PCR. RNA was obtained from bacteria

recovered from C. sinensis infected leaves at different times ofinfection. During infection, XacPNP expression was barely de-tected 2 days after X. axonopodis pv. citri infiltration andincreased over the time monitored (Fig. 3). To answer thequestion of whether or not a PNP-like molecule is functional inbacteria other than X. axonopodis pv. citri, we cloned XacPNPunder the control of its own promoter in the plasmidpBBR1MCS-5 (pBBR1XacPNP). This plasmid was conjugatedin X. axonopodis pv. vesicatoria, a pathogen that causes pepperbacterial spot, rendering it XavPNP�. Expression of XacPNP inX. axonopodis pv. vesicatoria in pepper leaves was hardly detect-able at the beginning of the infection process and subsequentlyincreased to the highest transcript levels at 7 days post-inoculation (Fig. 3). As a control for constitutive bacterialexpression, a fragment of 16S rRNA was simultaneously ampli-fied (Fig. 3), and to ascertain the absence of plant RNA inbacterial samples, controls with plant actin primers were carriedout (data not shown).

Analyses of XacPNP Mutant Strains in Citrus Canker. To furtherelucidate the role of the X. axonopodis pv. citri PNP-like gene in

Fig. 1. Structure and physiological testing of XacPNP. (A) The N-terminal contains the signal peptide (SP) that directs the protein into the extracellular space.In AtPNP-A, amino acids 33 to 66 convey the homeostasis regulating biological activity (in gray) and are aligned with X. axonopodis pv. citri PNP (XacPNP). Redarrows delineate the smallest tested recombinant PNP fragment that has significant biological activity. Asterisks (*) signify identical amino acids; colons (:) areconservative replacements; full stops (.) are semiconservative replacements; and lozenges (}) are cysteine residues in AtPNP-A that can form disulphide bridges.In the right, a fold model of XacPNP with six stranded double-� � barrel structure is shown. Conserved cysteine residues are represented with balls. (B) Stomatalconductance, (C) transpiration rates, and (D) photosynthetic rates of the youngest, fully expanded leaves of Plectranthus ecklonii Benth. over increasingirradiances, 0–350 �mol/m2s in the presence or absence of 2 �g of recombinant XacPNP or AtPNP-A. (E) In the inset, SDS/PAGE of the purified recombinant XacPNPstained with Coomassie blue. (E) Apparent photon yields and (F) dark respiration rates, in the presence or absence of XacPNP and AtPNP-A. The values representthe means of at least three experiments, with standard error bars.

18632 � www.pnas.org�cgi�doi�10.1073�pnas.0810107105 Gottig et al.

citrus canker, a XacPNP� mutant was generated by markerexchange, and it was genetically verified (Fig. S3). The XacPNP�

mutant strain was tested for its ability to trigger disease in citrusleaves. Both wild-type bacteria and XacPNP� induced diseaseupon infiltration at a concentration of 107 cfu/ml. No differenceswere observed in the onset of lesion formation or lesion size.However, large necrotic areas only appeared on the lesionsproduced by the XacPNP� (Fig. 4A), and the percentage ofnecrotic area was three times larger than that caused by thewild-type bacteria (P � 0.001) (Fig. 4C). Similar results wereobtained at lower concentrations of bacteria (104, 105, and 106

cfu/ml), as well as after infiltrating other tissues, such as maturefruit tissue (data not shown). XacPNP� was complemented byconjugating pBBR1XacPNP into this mutant (XacPNP�c). Wealso coinfiltrated XacPNP� with an XacPNP purified protein. Inboth cases, the lesions reverted to a significantly less necroticphenotype (Fig. 4B and C). Infiltrations with the X. axonopodispv. citri wild-type carrying pBBR1XacPNP (XacPNP�) results insimilar expression levels as the wild-type (Fig. S3C) and the X.axonopodis pv. citri coinfiltrated with a XacPNP protein, whichboth cause the same symptoms and similar percentages ofnecrotic area (Fig. 4 A–C). The lack of significant differencesamong coinfiltrated protein strains, XacPNP�, and wild-typeinfiltrations may be attributed to protein saturation, at whichtime no further enhancement of biological effects will occur. Wealso complemented an XacPNP� strain with an AtPNP-A gene,carried in a replicative plasmid, and obtained similar results aswith the XacPNP complemented mutant, suggesting that similarbiological responses are triggered by both proteins (Fig. S4). Tofurther quantify the leaf necrotic areas, we performed Evansblue staining, which allows reproducible quantification of thestain that is retained by dead cells. The results show that necroticorange tissue, caused by XacPNP� infection, absorbed morestain than tissue from wild-type infection, confirming a largernumber of dead cells in XacPNP�-induced lesion (Fig. 4D).Other diagnostic techniques to examine necrotic areas, such astrypan blue staining, ion leakage, and enzymatic activity, werealso used (Fig. S5) and have confirmed the larger necrotic areasproduced by XacPNP� infection. It is noteworthy that, in leavesinfiltrated with XacPNP�, the photosystem II maximum effi-ciency was significantly reduced (P � 0.001) (Fig. 4E), and thatthis reduction was prevented by bacteria carrying the XacPNPgene. In addition, net water flux through the leaf was signifi-cantly (P � 0.01) increased in the presence of both XacPNP and

AtPNP-A (Fig. 4F). Such increased fluxes under unchangedatmospheric conditions are the consequence of lower leaf waterpotential, as confirmed by leaf xylem water potential measure-ments (results not shown). When wild-type, XacPNP�, andXacPNP�c bacterial growth on citrus leaves was analyzed,growth was �1010 cfu/cm2 at 14 days, after infiltration, for all ofthe strains tested (Fig. 4G). After 14 days, growth curves showedthat XacPNP� dependent cell death was significantly differentfrom that of other strains (P � 0.05) (Fig. 4G), arguably becauseof the fact that bacteria could not grow on the large area of deadtissue that covers almost the entire lesion at this stage. Growthcurves of wild-type and XacPNP�, coinfiltrated with recombi-nant protein, showed that the presence of XacPNP does not alterbacterial growth (Fig. 4H).

Role of XacPNP in Pepper Bacterial Spot. To answer the question ofwhether or not PNP function in Xanthomonas is restricted to aparticular and exclusive host, we investigated the role of XacPNPin a different compatible interaction. To this end, we infiltratedpepper plants with X. axonopodis pv. vesicatoria that wereexpressing XacPNP (XavPNP�) and wild-type bacteria. Weobserved that XavPNP� caused significantly smaller lesions,with less necrosis, than either the wild-type bacteria or thecontrol conjugated with the empty vector pBBR1-MCS5 (P �0.001), thus making the response similar to the X. axonopodis pv.citri response (Fig. 5 A, C, and D and Fig. S5). We also observedthe same XacPNP effect when we coinfiltrated X. axonopodis pv.vesicatoria with purified XacPNP protein (Fig. 5 B and C).Growth, in planta, of XavPNP�, as well as wild-type coinfiltratedwith XacPNP protein, was significantly reduced (P � 0.05) by atleast one order of magnitude as compared with wild-typebacteria and Xav (pBBR1-MCS5) (Fig. 5E), while all strainsshowed the same growth kinetics in culture media (SB andXVM2, data not shown). These results show that XacPNP is ableto modify host responses to the benefit of the pathogen, even ina different plant host; but, in this case, the aggressive colonizingstrategy is compromised.

DiscussionPlant natriuretic peptides induce many physiological responses,including the modulation of homeostatic processes such as K�,Na�, and H� net fluxes (5), and protoplast H2O uptake (4).Recently, it has been shown that, in Arabidopsis, significantincreases in AtPNP-A expression occur in response to both

Fig. 2. Stomatal guard cell assay and analysis of starch. (A) Quantification ofstomatal apertures in epidermal peels of C. sinensis plants incubated withcontrol Buffer (1), 5 �M XacPNP or AtPNP-A (2 and 3, respectively), 5 �MXacPNP or AtPNP-A with 10 �M methylene blue (4 and 5, respectively); andcontrols with NAA (6) or ABA (7). Bars are the means � SEM of apertures of�60 stomata, and the results are representative of three independent exper-iments. The significance of the differences was P � 0.01. (Right) Representa-tive images of stomatal apertures, with or without XacPNP, are shown. (B)Quantification of Lugol staining of the starch present in cells incubated withcontrol Buffer (1), and 5 �M XacPNP or AtPNP-A (2 and 3, respectively). Datawere analyzed and represented as A. (Right) Representative stomata stainedwith Lugol’s in the presence or absence of XacPNP.

Fig. 3. Analysis of the expression of XacPNP in planta. RT-PCR of XacPNP withRNA obtained from either X. axonopodis pv. citri wild-type (XacWT) that wererecovered from inoculated orange leaves or X. axonopodis pv. vesicatoria thatwere recovered from inoculated pepper leaves, and which were both conju-gated with the vector pBBR1XacPNP (XavPNP�) and analyzed at differenttimes of infection (0, 0.25, 1, 2, 3, and 7 days). As constitutive controls, afragment of 16S rRNA was amplified by using the same RT-PCR conditions(bottom gels).

Gottig et al. PNAS � November 25, 2008 � vol. 105 � no. 47 � 18633

PLA

NT

BIO

LOG

Y

abiotic (e.g., osmotic stress and K� starvation) and biotic stimuli(10). The finding that X. axonopodis pv. citri, but not any otherbacteria, has a PNP-like gene raises the question of the advan-tage that the bacteria might gain from this acquisition.

Infections cause changes in host carbohydrate metabolism,and biotrophic pathogens have been reported to trigger down-regulation of photosynthetic genes. However, host measures areaimed at starving the pathogen without weakening defenseresponses, at which time the pathogen will attempt to manipulatehost carbohydrate metabolism to its own advantage (11). Thereare a number of indications that point to a role of XacPNP in host

homeostasis regulation. First, the ‘‘late’’ induction of the gene inthe minimal medium and the plant leaf suggests sensing of, andadapting to, low nutrients in the host environment. Second, weshow that, in the presence of XacPNP, photosynthesis is sus-tained during infection, and, with it, the generation of assimi-lates. Thirdly, we provide direct evidence that XacPNP causesstarch degradation in guard cells with a consequent rise in solutecontent, which, in guard cells, causes stomatal opening and canlead to increases in net water flux through the leaf. It has beenshown previously that PNPs promote radial water movementsfrom the xylem to the surrounding tissue (12) and that PNPs

Fig. 4. Effects of the XacPNP mutant, and expression of XacPNP, on pathogenicity. (A) X. axonopodis pv. citri wild-type (XacWT), knocked out strain XacPNP�,and complemented knocked out strain XacPNP�c and XacPNP� were inoculated at 107 cfu/ml into the intercellular spaces of fully expanded orange leaves. Arepresentative leaf is shown seven days after inoculation. (B) Orange leaves were coinfiltrated with 5 �M XacPNP purified protein and either XacWT or XacPNP�.A representative leaf is shown seven days after inoculation. (C) Means of the percentages of necrotic areas of orange leaves infiltrated with: XacWT (1), XacPNP�

(2), XacWT coinfiltrated with XacPNP protein (3), XacPNP� (4), XacPNP�c (5), XacPNP� coinfiltrated with XacPNP protein (6), and XacPNP protein (7). Valuesrepresent means of 40 infected leaves photographed and analyzed; error bars represent standard deviations. (D) Evans Blue staining of necrotic areas of orangeleaves infiltrated with 10 mM MgCl2 (1), XacWT (2), XacPNP� (3) and XacPNP� (4). In each case, values represent means of three samples; error bars representstandard deviations. (E) Photosystem II maximum efficiency (F�v/F�m) was measured in leaves infiltrated with 10 mM MgCl2 (C), XacWT and XacPNP�. In each case,values represent means of three samples; error bars represent standard deviations. (F) H2O net flux was measured in orange leaves in the presence of 20 �l of50 mM Tris/HCl (pH 8.0) (C), 2 �g of XacPNP or AtPNP-A in 20-�l buffer, spread on the lower leaf surface. Each experiment was done with four leaves per treatment,and the data are mean � SEM of three independent experiments. (G) Bacterial growth of XacWT, XacPNP�, XacPNP�c, and XacPNP� in orange leaves inoculatedas described in (A). (H) Growth of XacWT bacteria, XacPNP� bacteria, and these same two bacteria, coinfiltrated with XacPNP protein (XacWT�P and XacPNP��P,respectively) in orange leaves.

Fig. 5. Effects of XacPNP expression on the pathogenicity of X. axonopodis pv. vesicatoria. (A) X. axonopodis pv. vesicatoria wild-type (Xav), XavPNP�, andXav(pBBR1-MCS5) [named in the figure as Xav(pBR1)] were inoculated, 107 cfu/ml, into the intercellular space of fully expanded pepper leaves. A representativeleaf is shown two days after inoculation. (B) Pepper leaves were coinfiltrated with Xav and 5 �M XacPNP purified protein, and, as controls, 50 mM Tris/HCl pH8.0 (B) and 10 mM MgCl2 (mock). A representative leaf is shown two days after inoculation. (C) Means of the percentages of necrotic areas of pepper leavesinfected with: XavPNP� (1), Xav coinfiltrated with XacPNP protein (2), Xav (3), Xav(pBR1) (4), and XacPNP protein (5). Values represent means of 40 infected leavesphotographed and analyzed; error bars represent standard deviations. (D) Evans Blue staining of necrotic areas of pepper leaves infiltrated with 10 mM MgCl2(1), Xav (2), and XavPNP� (3). In each case, values represent means of three samples; error bars represent standard deviations. (E) Bacterial growth of Xav,XavPNP�, Xav(pBBR1-MCS5), and Xav coinfiltrated with XacPNP protein in pepper leaves inoculated as described in A. Values represent means of three samples,and error bars are standard deviations.

18634 � www.pnas.org�cgi�doi�10.1073�pnas.0810107105 Gottig et al.

cause net H2O uptake into the protoplast (4, 13). Accordingly,we prove that XacPNP promotes water uptake into protoplastsin a cGMP-dependent manner, similar to what occurs withAtPNP-A, suggesting that XacPNP employs a similar biologicalmechanism operating via the same second messenger as At-PNP-A. Our results are, thus, compatible with the idea that X.axonopodis pv. citri bearing XacPNP, as well as the purifiedbacterial peptide, can influence cell turgor and draw water to theinfected tissue. Furthermore, the performance of the photosys-tem II depends on the leaf water status, and leaf drying causesreduction in quantum yield (14). We, therefore, argue that thesignificantly improved performance of the photosystem II in thepresence of XacPNP is, at least in part, because of the improvedwater status.

Having established that XacPNP can influence host ho-meostasis, we were interested to see effects on host responsesand in particular tissue necrosis. Homeostatic perturbationscaused by infections are likely to shorten the life of the plant leaf(15, 16) to the detriment of the pathogen, particularly inbiotrophs. When expressing XacPNP, X. axonopodis pv. citrireduces the damage to the host, at least, in part, through themaintenance of photosynthesis and PNP dependent net H2Oflux, and, thus, favors pathogen survival. Depending on theirlifestyle, pathogens can either suppress or promote host celldeath to induce disease susceptibility (17). In X. axonopodis pv.citri, a biotrophic pathogen, suppression of cell death will enableprolonged infection and, thus, prolonged survival. Conversely, inX. axonopodis pv. vesicatoria that has to switch to a necrotrophiclifestyle to enhance pathogen multiplication and dispersal (18),the suppression of tissue necrosis, observed by the expression ofXacPNP, may limit its growth.

Because AtPNP-A has been implicated in abiotic and bioticstress responses in Arabidopsis, and AtPNP-A expression iscorrelated with defensive gene expression and is up-regulated inmutants with elevated salicylic acid levels (10), we cannot ruleout the possibility that XacPNP can cause a direct suppressionof plant defense responses to favor pathogen survival and tissuecolonization. However, when we have analyzed the expressionlevels of several genes involved in defense responses in orangeleaves incubated with XacPNP, we have observed no changes ascompared with the controls (Garavaglia et al. unpublishedresults). These findings suggest that the bacterial protein isprincipally involved in the regulation of homeostasis.

The origin of the PNP-like gene in X. axonopodis pv. citri isdifficult to establish with certainty; however, the incongruousphylogeny is compatible with the hypothesis of horizontal genetransfer. While horizontal gene transfer is the predominantmechanism of genome ‘innovation’ and variation in both virusesand bacteria, the sources of the acquired genes in the latter aretypically either different strains or species rather than hostorganisms (19). Legionella pneumophila appears to be an excep-tion (20, 21); however, the biological roles of its eukaryotic-likegenes remain a matter of speculation. In addition, there isphylogenetic evidence for horizontal gene transfer from fila-mentous ascomycete fungi to the distantly related oomycetes,and, specifically, to pathogens, so as to modify genomes dynam-ically and, thereby, facilitate responses to changing environmen-tal conditions and help invasion of host organisms (22). Anexample of molecular mimicry was recently reported in anotherplant-pathogen interaction where the nematode Heterodera gly-cines used a polypeptide, similar to a CLAVATA3/ESR-relatedpeptide, to control the balance between meristem cell prolifer-ation and differentiation, thus enabling it to modify plant celldifferentiation to improve its food supply (23).

Taking into account that X. axonopodis pv. citri is not free-living, we suggest that (i) XacPNP is acquired by the bacteria andsubsequently acquires and/or modifies its promoter, and (ii)XacPNP indeed possesses a conserved PIP sequence (24) to

enable expression during plant-pathogen interaction and, thus,contribute to the optimal adaptation of this strain to the specifichost environment. The fact that XacPNP can be induced indifferent bacteria suggests that its promoter is not dependent onhighly specific signals from either one particular host or closelyrelated hosts. Taken together, our results demonstrate that X.axonopodis pv. citri uses a PNP-like gene to modulate hostresponses that improve its survival conditions in the plant tissue,supporting a hypothesis of molecular mimicry that we will test inthe future.

Materials and MethodsDetailed descriptions of protein purification, RNA preparation, RT-PCR, con-struction of bacterial variants, and cell death measurement assays are given inSI Text.

Bacterial Strains, Culture Conditions and Media. E. coli cells were cultivatedat 37°C in Luria Bertani (LB) medium. X. axonopodis pv. citri Xcc99–1330 andX. axonopodis pv. vesicatoria Xcv Bv5–4a strains were grown at 28°C in SilvaBuddenhagen (SB) (25), or XVM2 (9). Antibiotics were used as previouslyreported (25).

Recombinant DNA and Microbiological Techniques. All DNA manipulationswere performed with standard techniques (26), unless otherwise specified.Genomic DNA from X. axonopodis pv. citri was isolated by using the cetyltri-methylammonium bromide procedure (27), and bacterial conjugation wasperformed as previously described (28).

Protein Purification. The coding region for the mature XacPNP was amplifiedby PCR with NPNPB (5� ATCAGGATCCGACATCGGTACAATTAGTT 3�) andCPNPH (5� ATACAAGCTTTTAAATATTTGCCCAGGGCG 3�) oligonucleotides,cloned into a pET28a vector (Novagen), and expressed in E. coli BL21(DE3)pLysas an His-tag N-terminal fusion protein. The protein was purified by usingNi-NTA agarose resin (QIAGEN). Recombinant AtPNP-A (At2g18660) was pre-pared as described previously (29).

Determination of Physiological Parameters. Plectranthus ecklonii Benth. wasgrown in potting soil inside an atmospherically controlled greenhouse withday-light conditions. Then, 5 �M solutions of either XacPNP or AtPNP-A wereapplied and spread on the adaxial and abaxial leaf surfaces. Photosynthesiswas quantified as previously detailed (30) in the youngest, fully expanded leafof each replicate (n � 3). Readings were taken with a portable infrared gasanalyzer (LCA-Pro, ADC, Herts SG12 9TA). Photosynthetic light-responsecurves were determined by varying the light source on the instrument be-tween 0–1,600 �mol/m2s. Photosynthetic water-use efficiency (A/E) was cal-culated where A was the photosynthetic rate and E was the leaf transpirationrate. The apparent photon yield was the slope of the light-limiting part of thelight response curve. Responses were analyzed with ANOVA, and, for differ-ences between treatments, the means were separated by using a post hocStudent Newman Kuehls (SNK) multiple range test. Photosystem II maximumefficiency (F�v/F�m) in control and infected leaves was determined as detailedpreviously (31), and analyzed by using a one-way ANOVA with the Bonferronimultiple comparison test. Gravimetric measurements of net water flux weredone on single leaves, with their petioles in water, in sealed containers. PNPsin 20 �l of H2O were added and spread on lower leaf surfaces with a micropi-pette tip. Transpiration at ambient light, 25°C, and after a 1-h treatment, wasquantified and analyzed with one-way ANOVA. Each experiment had fourreplicate leaves and was repeated three times.

Stomatal Guard Cell Assay and Analysis of Starch. C. sinensis plants were grownin a growth chamber in incandescent light at 28°C with a photoperiod of 16 h.Segments of abaxial epidermis from leaves kept in darkness were floated onBuffer A (10 mM Mes, 10 mM KOH, pH 6.15) for 2 h, at 25°C, and in darkness.Epidermis was transferred to Buffer A containing 50 mM KCl and 100 �MCaCl2, with or without treatment, and exposed under incandescent light (� �

430 nm at 35W m�2) at 25°C for an additional 2 h. Treatments included theaddition of 1 �M naphthalene acetic acid (NAA), 50 �M abscisic acid (ABA), or5 �M either XacPNP or AtPNP-A, with or without 10 �M methylene blue (MB).Pore widths of �20 stomata from three separate segments of each treatmentwere measured under the microscope with a calibrated ocular micrometer.Analysis of starch stained with 10% Lugol’s iodine solution was done asdescribed previously (15). The results were analyzed by using a one-wayANOVA and Bonferroni multiple comparison test.

Gottig et al. PNAS � November 25, 2008 � vol. 105 � no. 47 � 18635

PLA

NT

BIO

LOG

Y

RNA Preparation and RT-PCR. X. axonopodis pv. citri , cultured in either SB orXVM2, were harvested, and total RNA was isolated by using TRIzol reagent(Invitrogen). RNA preparations of bacteria from inoculated leaves, at differentpost infection times, were done as described previously (32). After treatmentwith DNase (Promega), cDNA was synthesized from 1 �g of total RNA by usingMMLV RT (Promega) and the oligonucleotide, dN6; and PCR was done by usingNPNPB and CPNPH oligonucleotides.

Construction of Bacterial Variants. The XacPNP deletion mutant (XacPNP�) wascreated by marker exchange mutagenesis as described previously (25).XacPNP� mutants were verified by PCR and Southern blot (Fig. S3). Comple-mentation of XacPNP� was done by amplifying the XacPNP and its promoterregion by PCR and cloning the product in the broad-host-range vector,pBBR1MCS-5 (25), rendering pBBR1XacPNP. This plasmid was transferred tothe XacPNP� strain, rendering XacPNP�c. The same plasmid was conjugated toX. axonopodis pv. citri and X. axonopodis pv. Vesicatoria, rendering XacPNP�

and XavPNP�, respectively.

Plant Material, Inoculations, and Cell Death Measurements. Orange (Citrussinensis cv. Valencia) was used as the host plant for X. axonopodis pv. citri, andpepper (Capsicum annuum cv. grossum) as host plant for X. axonopodis pv.vesicatoria. All plants were grown in a growth chamber in incandescent light

at 28°C with a photoperiod of 16 h. Bacterial infiltrations and in planta growthassays were performed as described previously (25) and were analyzed byusing multifactorial ANOVA and a Tukey multiple comparison test. The per-centages of necrotic areas in lesions were calculated as necrotic area perinfected area. Areas were measured from digitalized images of forty infectedleaves, using Adobe Photoshop software, and analyzed by using one-wayANOVA with a Bonferroni multiple comparison test. For evaluation of viabil-ity, lesioned tissue was stained with Evans Blue as previously described (33).Leaf disks from one-week infiltrated orange, or pepper, leaves were sub-merged in 1 ml of 0.25% Evans Blue and incubated for 20 min. Then, they werewashed several times with water to remove excess and unbound dye, and afterdisk homogenization, bound dye was extracted with 1% SDS. The extracteddye was measured spectrophotometrically at 600 nm. The results were ana-lyzed by using a one-way ANOVA and Bonferroni multiple comparison test.

ACKNOWLEDGMENTS. We thank Catalina Anderson (INTA Concordia, Argen-tina) and Gaston Alanis and Ruben Díaz Velez (Proyecto El Alambrado) for thecitrus plants. N.G., E.G.O. and J.O. are staff members of and B.S.G. and L.D.D.are fellows of the Consejo Nacional de Investigaciones Científicas y Tecnicas.This work was supported by Agencia Nacional de Promocion Cientıfica yTecnologie (ANPCyT) Grants PICT01–12783 (to E.G.O.), PICT2006–00678 (toJ.O.), and PICT2006–1073 (to N.G.) and the South African National ResearchFoundation.

1. Takei Y (2001) Does the natriuretic peptide system exist throughout the animal andplant kingdom? Comp Biochem Physiol B Biochem Mol Biol 129:559–573.

2. Gehring CA, Irving HR (2003) Natriuretic peptides–a class of heterologous molecules inplants. Int J Biochem Cell Biol 35:1318–1322.

3. Pharmawati M, Maryani MM, Nikolakopoulos T, Gehring CA, Irving HR (2001) CyclicGMP modulates stomatal opening induced by natriuretic peptides and immunoreac-tive analogues. Plant Physiol Biochem 39:385–394.

4. Maryani MM, Bradley G, Cahill DM, Gehring CA (2001) Natriuretic peptides andimmunoreactants modify the osmoticum-dependent volume changes in Solanumtuberosum L. mesophyll cell protoplasts. Plant Sci 161:443–452.

5. Ludidi N, Morse M, Sayed M, Wherrett T, Shabala S, Gehring C (2004) A recombinantplant natriuretic peptide causes rapid and spatially differentiated K�, Na� and H�

flux changes in Arabidopsis thaliana roots. Plant Cell Physiol 45:1093–1098.6. Graham JH, Gottwald TR, Cubero J, Achor DS (2004) Xanthomonas axonopodis pv. citri:

Factors affecting successful eradication of citrus canker Mol Plant Pathol 5:1–15.7. Nembaware V, Seoighe C, Sayed M, Gehring C (2004) A plant natriuretic peptide-like

gene in the bacterial pathogen Xanthomonas axonopodis may induce hyper-hydration in the plant host: A hypothesis of molecular mimicry. BMC Evol Biol 4:10.

8. Rafudeen S, et al. (2003) A role for plant natriuretic peptide immuno-analogues inNaCl- and drought-stress responses. Physiol Plant 119:554–562.

9. Wengelnik K, Bonas U (1996) HrpXv, an AraC-type regulator, activates expression offive of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. JBacteriol 178:3462–3469.

10. Meier S, Bastian R, Donaldson L, Murray S, Bajic V, Gehring C (2008) Co-expression andpromoter content analyses assign a role in biotic and abiotic stress responses to plantnatriuretic peptides. BMC Plant Biol 8:24.

11. Berger S, Benediktyova Z, Matous K, Bonfig K, Mueller MJ, Roitsch T (2007) Visualiza-tion of dynamics of plant-pathogen interaction by novel combination of chlorophyllfluorescence imaging and statistical analysis: Differential effects of virulent and avir-ulent strains of P. syringae and of oxylipins on A. thaliana. J Exp Bot 58:797–806.

12. Suwastika IN, Gehring CA (1998) Natriuretic peptide hormones promote radial watermovements from the xylem of Tradescantia shoots. Cell Mol Life Sci 54:1161–1167.

13. Wang YH, Gehring C, Cahill DM, Irving HR (2007) Plant natriuretic peptide active sitedetermination and effects on cGMP and cell volume regulation. Functional PlantBiology 34:653.

14. Brodribb TJ, Holbrook NM (2003) Stomatal closure during leaf dehydration, correlationwith other leaf physiological traits. Plant Physiol 132:2166–2173.

15. Guimaraes RL, Stotz HU (2004) Oxalate production by Sclerotinia sclerotiorum dereg-ulates guard cells during infection. Plant Physiol 136:3703–3711.

16. Prats E, Gay AP, Mur LA, Thomas BJ, Carver TL (2006) Stomatal lock-open, a conse-quence of epidermal cell death, follows transient suppression of stomatal opening inbarley attacked by Blumeria graminis. J Exp Bot 57:2211–2226.

17. Abramovitch RB, Martin GB (2004) Strategies used by bacterial pathogens to suppressplant defenses. Curr Opin Plant Biol 7:356–364.

18. O’Donnell PJ, Jones JB, Antoine FR, Ciardi J, Klee HJ (2001) Ethylene-dependent salicylicacid regulates an expanded cell death response to a plant pathogen. Plant J 25:315–323.

19. Pallen MJ, Wren BW (2007) Bacterial pathogenomics. Nature 449:835–842.20. Cazalet C, et al. (2004) Evidence in the Legionella pneumophila genome for exploita-

tion of host cell functions and high genome plasticity. Nat Genet 36:1165–1173.21. de Felipe KS, et al. (2005) Evidence for acquisition of Legionella type IV secretion

substrates via interdomain horizontal gene transfer. J Bacteriol 187:7716–7726.22. Richards TA, Dacks JB, Jenkinson JM, Thornton CR, Talbot NJ (2006) Evolution of

filamentous plant pathogens: Gene exchange across eukaryotic kingdoms. Curr Biol16:1857–1864.

23. Wang X, et al. (2005) A parasitism gene from a plant-parasitic nematode with functionsimilar to CLAVATA3/ESR (CLE) of Arabidopsis thaliana. Mol Plant Pathol 6:187–191.

24. Koebnik R, Kruger A, Thieme F, Urban A, Bonas U (2006) Specific binding of theXanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX toplant-inducible promoter boxes. J Bacteriol 188:7652–7660.

25. Dunger G, et al. (2007) Xanthan is not essential for pathogenicity in citrus canker butcontributes to Xanthomonas epiphytic survival. Arch Microbiol 188:127–135.

26. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. a laboratory manual. (ColdSpring Harbor Laboratory Press, Cold Spring Harbor, NY).

27. Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA.Nucleic Acids Res 8:4321–4325.

28. Dunger G, Arabolaza LN, Gottig N, Orellano EG, Ottado J (2005) Participation ofXanthomonas axonopodis pv. citri hrp cluster in citrus canker and in non-host plantsresponses. Plant Pathol 54:781–788.

29. Morse M, Pironcheva G, Gehring C (2004) AtPNP-A is a systemically mobile natriureticpeptide immunoanalogue with a role in Arabidopsis thaliana cell volume regulation.FEBS Lett 556:99–103.

30. Valentine A, Osborne B, Mitchell D (2002) Form of inorganic nitrogen influencesmycorrhizal colonization and photosynthesis of cucumber. Sci Hort 92:229–239.

31. Baker NR, Rosenqvist E (2004) Applications of chlorophyll fluorescence can improvecrop production strategies: An examination of future possibilities. J Exp Bot 55:1607–1621.

32. Mehta A, Rosato YB (2003) A simple method for in vivo expression studies of Xan-thomonas axonopodis pv. citri. Curr Microbiol 47:400–403.

33. Baker CJ, Mock NM (1994) An improved method for monitoring cell death in cellsuspension and leaf disc assays by using evans blue. Plant Cell, Tissue and Organ Culture39:7–12.

18636 � www.pnas.org�cgi�doi�10.1073�pnas.0810107105 Gottig et al.