Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden...
-
Upload
domenic-mccoy -
Category
Documents
-
view
215 -
download
0
Transcript of Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden...
![Page 1: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/1.jpg)
www.strandls.com
Colorblindness
![Page 2: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/2.jpg)
www.strandls.com
Ishihara Cards
2
• Typically 5% of people cannot spot the hidden numbers in these cards
• Usually, these 5% are males!!
![Page 3: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/3.jpg)
www.strandls.com
Pinning the Problem Down
3
• The hidden number is in green
• The noise around it starts green, but you mix in increasing amounts of red
• At what point does the number become recognizable
• Trials with many hidden numbers suggest I need more red than others to recognize the hidden number
• If I mixed blue instead of red, there wasn’t a difference between me and others
![Page 4: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/4.jpg)
www.strandls.com
What is Color?
4
• Newton’s experiments indicate there are at least 2 types of yellows
• One pure (Y1)
• Another obtained by combining red and green (Y2)
• Y2 splits when it goes through a prism, Y1 doesn’t
• Why does the eye see both as yellow?
Y1Y2
![Page 5: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/5.jpg)
www.strandls.com
Color Sensors in the Eye
5
• 3 sensors together detect many many colors
• Red (L) and green (M) sensor responses overlap substantially
• Blue (S) is further away
• Both red and green sensors respond to pure yellow (Y1)
• And of course, both respond to a red-green mixture (Y2)
• So both yellow elicit roughly the same response
![Page 6: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/6.jpg)
www.strandls.com
Discriminating Red and Green
6
• What if the red and green hills were to come close?
• At an extreme, if they became the same, then red and green will appear the same! Could this be the explanation? What made this happen?
![Page 7: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/7.jpg)
www.strandls.com
Color Sensing Cells
7
• Color sensors reside in the cone cells in the retina of the eye• Inside each such cell in a copy of the genome
![Page 8: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/8.jpg)
www.strandls.com
The Genome
8
• 23 pairs of books with 6 billion A,C,G,T characters in all• In each pair, one book or chromosome comes from each parent• The last pair X,Y determines gender. Males XY, Females XX• The Green and Red sensor recipes are on X!
![Page 9: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/9.jpg)
www.strandls.com
Genes: The Recipe Carriers
9
• Recipes for the creation of color sensor molecules and several other molecules are written in the genome
• The chunk of text containing this recipe is called a gene• There are 20,000 genes, each carrying the recipe for one or more proteins
![Page 10: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/10.jpg)
www.strandls.com
Interrupted Recipes
10
• Recipes in the genome are not continuous• Exons carry the recipes• Intervening Introns are skipped when the recipe is executed • Green and Red recipes are almost identical, just 15 differences confined to
exons 2, 3, 4 and 5
S or Blue
L and M
![Page 11: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/11.jpg)
www.strandls.com
My Recipes and Yours
11
• We differ in just roughly 1 in a 1000 places; so a few million differences in all!
• Eg., in exon 3 of the green sensor recipe, I have G where many have an A
![Page 12: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/12.jpg)
www.strandls.com
Cooking up New Recipes: Crossing-Over
12
• Which of her two X chromosomes does a mother give to her child?
• Neither. She produces a mosaic using a crossing-over procedure.
![Page 13: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/13.jpg)
www.strandls.com
Lopsided Cuts while Crossing-over?
13
• Which of her two X chromosomes does a mother give to her child?
• Can crossing-over cut the two X chromosomes in different places, as in the first cut here?
• Typically not, because the character sequences at the two places must be very similar, unlike what is shown.
![Page 14: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/14.jpg)
www.strandls.com
Crossing over for the Red-Green Genes
14
• The red and green genes are right next to each other in the genome
• There are actually 2 green genes next to each other, only the first recipe is executed
• Crossing-over can create new recipes as shown
![Page 15: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/15.jpg)
www.strandls.com
Lopsides Cuts: Red and Green Genes?
15
• These cuts can actually happen because the red and green genes have almost identical character sequences
• And this can lead to the creation of some new hybrid red-green recipes.
![Page 16: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/16.jpg)
www.strandls.com
Hybrid Red-Green Recipes
16
• There are just two genes in the first case, four in the second
• In both cases, note the red-green hybrid gene
![Page 17: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/17.jpg)
www.strandls.com
Hybrid Red-Green Recipes
17
• There are just two genes in the first case, four in the second
• In both cases, note the red-green hybrid gene
• This could bring the two sensor peaks closer, as we say earlier!
![Page 18: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/18.jpg)
www.strandls.com
A Peek at My Recipes: NGS
18
• Start with many cells, so many copies of the genome
• Tear each copy randomly into tiny shreds (or reads) of about 100 characters each
• Tens of millions to a billion shreds! We know the sequence of each.
• We have to now assemble this jigsaw back! Not easy!
ACTCTGCGTGGCTCTTCCCCTGAA
ACTCTGCGTGGCTCTTCCCCTGAA
CACTGCACTGGAATGATCAAAACACACG
![Page 19: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/19.jpg)
www.strandls.com
Solving the Jigsaw Puzzle
19
• The Reference Sequence to the rescue: the genome sequence of 5 healthy individuals
• Any two genomes differ roughly in 1 in 1000 characters, so very similar to each other
• Search for each read in the reference sequence, with some allowance for error: Read Alignment
![Page 20: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/20.jpg)
www.strandls.com
Variations in Recipes
20
• Once all the reads are placed at their rightful places along the reference sequence..
• Differences between the reference and the genome being sequenced stand out
• These are called variants
![Page 21: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/21.jpg)
www.strandls.com
Reads Aligned to the Red and Green Genes
21
• No reads on the second green; all these reads have gone to the first green, because the sequences are identical
• No reads on exons 1 and 6 of the green gene; all these reads have gone to the red gene, because the sequences are identical
• Exons 2, 3, 4 and 5 are different between red and green, so reads can be assigned unambigously
![Page 22: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/22.jpg)
www.strandls.com
Which of these possibilities matches the data? And with what confidence?
Fraction on Red for Exons 2,3,4,5
22
1 2 3 4 5 6 1 2 3 1 2 3 4 5 6
L M/L M
4 5 6
50%,50%,50%,50%
1 2 3 4 5 6 1 2 3 4 5 6
L/M M 100%,100%,0%,0%
1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6
L M/L M
1 2 3 4 5 6
M
33%,33%,100%,100%
41 2 3 4 5 6 1 2 3 5 6 1 2 3 4 5 6
L M/L M
1 2 3 4 5 6
M33%,33%,33%,100%
![Page 23: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/23.jpg)
www.strandls.com
Could Be Worse: Only 2 Colors!
23
![Page 24: Www.strandls.com Colorblindness. Ishihara Cards 2 Typically 5% of people cannot spot the hidden numbers in these cards Usually, these.](https://reader036.fdocuments.in/reader036/viewer/2022062802/56649eab5503460f94bb04d5/html5/thumbnails/24.jpg)
www.strandls.com
Thank you
24