([WUDFHOOXODUQXFOHDVHVRI Streptococcus equi VVS ... · $%675$&7 7KHSDWKRJHQ Streptococcus equi VVS...

1

Extracellular nucleases of Streptococcus equi ssp. zooepidemicus degrade host neutrophil 1

extracellular traps and impair macrophage activity 2

3

4

Fang Ma,a Xiao Guo,a Hongjie Fana,b, # 5

6

College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China a; 7

Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious 8

Diseases and Zoonoses, Yangzhou, China b 9

10

Running Head: Extracellular nucleases of SEZ 11

12

#Address correspondence to Hongjie Fan, [email protected]. 13

14

AEM Accepted Manuscript Posted Online 4 November 2016Appl. Environ. Microbiol. doi:10.1128/AEM.02468-16Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

ABSTRACT 15

The pathogen Streptococcus equi ssp. zooepidemicus (SEZ) is associated with a 16

wide range of animals, including humans, and outbreaks frequently occur in pigs, equines 17

and goats. Thus far, few studies have assessed interactions between the host immune 18

system and SEZ and how these interactions explain the wide host spectrum of SEZ. 19

Neutrophils, the first line of innate immunity, possess a defense mechanism called 20

neutrophil extracellular traps (NETs), which primarily consist of DNA and granule 21

proteins that trap bacteria via charge interactions. Extracellular nucleases play important 22

roles in the degradation of DNA backbone of NETs. Here, two related extracellular 23

nucleases, nuclease and 5’-nucleotidase (named ENuc and 5Nuc in this study), were 24

identified as being encoded by SESEC_RS04165 gene and SESEC_RS05720 gene (named 25

ENuc and 5Nuc, respectively), and three related gene deletion mutants, specifically, 26

ΔENuc, Δ5Nuc and double mutant ΔENucΔ5Nuc, were constructed. The ΔENuc, Δ5Nuc 27

and ΔENucΔ5Nuc strains demonstrated lower virulence than wild-type SEZ when the 28

mouse survival rate was evaluated post-infection. Furthermore, wild-type SEZ more 29

frequently traversed the bloodstream and transferred to other organs. Wild-type SEZ 30

induced fewer NETs and was able to survive in NETs, whereas only 40% of 31

ΔENucΔ5Nuc cells survived. SEZ degraded NETs DNA backbone and produced 32

deoxyadenosine, primarily through the action of ENuc and/or 5Nuc. However, double 33

mutant ΔENucΔ5Nuc lost the ability to degrade NETs into deoxyadenosine. 34

Deoxyadenosine decreased RAW264.7 cell phagocytosis to 40% of that of normal 35

macrophages. 36


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

IMPORTANCE 37

Streptococcus equi ssp. zooepidemicus (SEZ) cause serious bacteremia in its hosts. 38

However, little is known about how SEZ interacts with the host innate immune system, 39

particularly innate cells found in the blood. SEZ is capable of evading NETs-mediated 40

killing via the actions of its potent extracellular nucleases, ENuc and 5Nuc, which 41

directly degrade NETs DNA backbone to deoxyadenosine. In previous studies, other 42

pathogens have required the synergism of nuclease and 5’-nucleotidase to engage in this 43

self-protective process; however, ENuc and 5Nuc both possess nuclease activity and 44

5’-nucleotidase activity, highlighting the novelty of this discovery. Furthermore, 45

deoxyadenosine impairs phagocytosis but not the intracellular bactericidal activity of 46

macrophages. For the first time, we describe a novel mechanism for SEZ extracellular 47

nucleases in NETs degradation, which may provide new insights into pathogen immune 48

evasion mechanism and the prevention and treatment of bacterial disease. 49

50

Keyword: zoonoses, bacteremia, host-pathogen interactions, immune evasion, 51

pathogenic mechanism 52

INTRODUCTION 53

Streptococcus equi ssp. zooepidemicus (SEZ) is a zoonotic pathogen belonging to 54

Lancefield group C, which includes Streptococcus equi ssp. equi and Streptococcus equi 55

ssp. ruminatorum. Streptococcus equi ssp. equi is an important horse pathogen causing 56

strangles, a serious and highly contagious disease of the upper respiratory tract (1). SEZ 57


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

is thought to be the ancestor of Streptococcus equi ssp. equi and infects a wild range of 58

animal species, including humans, who contract the disease through contact with infected 59

animals and via the consumption of contaminated dairy products (2, 3). Recent SEZ 60

outbreaks in Sweden (2009/10) and Brazil (1997/98) led to significant suffering and 61

economic loss (4). The widespread nature of SEZ may be related to its strong ability to 62

evade the immune systems of its hosts. 63

Neutrophils are regarded as the first line of immune defense against bacterial 64

infection (5) and kill microbes by releasing antimicrobial proteins into extracellular space 65

via degranulation or by phagocytosing invading microbes (6, 7). However, neutrophils 66

also kill pathogens by unleashing neutrophil extracellular traps (NETs) (8). NETs respond 67

to bacteria, fungi, viruses, other chemical compounds, and even host factors such as 68

activated platelets and IL-8. Upon neutrophil activation, the nuclear envelope 69

disintegrates, and DNA fibers burst into extracellular space (9). 70

To survive in the host, many bacteria produce extracellular DNases to degrade NETs 71

DNA backbone such as Sda1 of Streptococcus pyogenes and EndA of Streptococcus 72

pneumoniae (10, 11). These enzymes allow bacteria to evade the host immune system. In 73

recent years, the involvement of many extracellular nucleotidases in the interaction 74

between NETs and bacteria has been identified. For example, adenosine synthase A 75

(AdsA) of Staphylococcus aureus acts as a nucleotidase to convert the NETs degradation 76

products into deoxyadenosine, which activates caspase-3-mediated apoptosis in 77

macrophages and monocytes (12). However, few studies have assessed the interaction 78


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

between NETs and SEZ, and the mechanism underlying SEZ-mediated bacteremia 79

remains unclear. 80

Therefore, in this study, we aimed to assess the interaction between NETs and SEZ 81

to determine whether the actions of extracellular nucleases contribute to NETs evasion 82

and the spread of SEZ in the host. Here, we found two genes, SESEC_RS04165 gene and 83

SESEC_RS05720 gene (named ENuc and 5Nuc in this study), encoding putative 84

extracellular nucleases. ENuc are predicted to encode nuclease (ENuc) and 5Nuc are 85

predicted to encode 5’-nucleotidase (5Nuc). The properties of the two related 86

extracellular nuclease genes are characterized and their role in immune evasion are 87

confirmed. 88

MATERIALS AND METHODS 89

Bacterial strains, cells and experimental animals. The bacterial strains and 90

plasmids used in this study are listed in Table 1. The wild-type SEZ strain ATCC35246 91

(hereafter referred to as WT SEZ) was purchased from the American Type Culture 92

Collection (ATCC) and grown in Todd-Hewitt broth (THB) medium (Difco, BD, 93

Franklin, NJ, USA) at 37°C on a gentle rocking shaker. Escherichia coli strains were 94

grown in Luria-Bertani (LB) broth at 37°C. When necessary, the antibiotic were used at 95

the following concentrations to screen transformants: 100 µg/ml spectinomycin (Sigma 96

Aldrich, St. Louis, Mo, USA) for SEZ, 50µg/ml spectinomycin for E. coli, 50 µg/ml 97

ampicillin (Sigma Aldrich) for E. coli, 50 µg/ml kanamycin (Sigma Aldrich) for E. coli. 98

RAW264.7 cells (ATCC® TIB-71TM) were purchased from ATCC. The cells were 99


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

cultured in Dulbecco’s modified Eagle’s medium (DMEM; Wisent, Canada) 100

supplemented with 10% fetal bovine serum at 37°C in 5% CO2. 101

Four-week-old female ICR (Institute of Cancer Research) specific-pathogen-free 102

mice were purchased from the Comparative Medicine Center of Yangzhou University. 103

All experimental protocols were approved by the Laboratory Animal Monitoring 104

Committee of Jiangsu Province. Animals showing signs of illnesses were humanely 105

euthanized with 100% CO2. 106

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) 107

analysis. Total RNA was extracted from WT SEZ in the logarithmic phase using TRIzol 108

reagent (Gibco-BRL, Thermo Fisher Scientific, altham, MA, USA). Briefly, the bacteria 109

were washed 3 times with phosphate-buffered saline (PBS). One milliliter of TRIzol 110

solution was added to the bacterial precipitate, which was shaken for 15 s to lyse the 111

bacterial cells; after that, 200 μl of chloroform was added. The mixture stood at room 112

temperature for 2 min and was then centrifuged at 12000 × g for 15 min. Two hundred 113

microliters of the upper phase (avoiding the middle layer containing DNA) was collected, 114

and 500 μl of isopropyl alcohol was added to precipitate the RNA. The suspension was 115

centrifuged to collect the RNA and washed twice with 75% ethanol. Seven genes 116

predicted to be extracellular nucleases were chosen based on genomic information for 117

Streptococcus equi ssp. zooepidemicus ATCC 35246 (NC_017582.1) in the NCBI 118

database. qRT-PCR was performed to determine the transcript concentrations of these 7 119

predicted extracellular nucleases genes: ENuc, 5Nuc, SESEC_RS02695, SESEC_RS03220, 120


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

SESEC_RS04065, SESEC_RS04270 and SESEC_RS05625 (Table 2). All primers used are 121

listed in Table 3. The results were analyzed using the 2−ΔΔCt method. 122

Cloning and purification of recombinant ENuc and 5Nuc. Cloning and 123

purification of the recombinant protein ENuc (rENuc) were performed as previously 124

described (13). ENuc was cloned by PCR using the primers ENucF and ENucR (Table 3) 125

and the WT SEZ genome as a template. The cloned ENuc was digested with BamHI and 126

XhoI and cloned into the pET-32a (+) vector (Invitrogen, Thermo Fisher Scientific, 127

altham, MA, USA). After sequencing (Shanghai Sunny Biotechnology Co., Ltd., China), 128

the recombinant plasmid pET32a-ENuc was transformed into E. coli Rosetta cells with 129

ampicillin selection. The recombinant E. coli was incubated at 37°C until reaching the 130

exponential growth phase, and then protein expression was induced for 6 h with the 131

addition of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Sigma Aldrich). Cells were 132

harvested, washed and suspended in ice-cold binding buffer (20mM Tris, 200mM NaCl, 133

pH7.4). 134

Protein purification procedures were performed at 4°C. Bacteria were homogenized 135

by ultrasonication for 30 min. The resulting crude extract was centrifuged at 10000 × g 136

for 30 min. Recombinant rENuc were purified using a 1 ml Ni-Sepharose™ 6 Fast-Flow 137

column (GE Healthcare, Uppsala, Sweden). 5Nuc was cloned into pET-28a (+) vector 138

(Invitrogen) to improve its expression; purification of 5Nuc recombinant protein (r5Nuc) 139

were performed as mentioned above. 140

Construction of gene deletion mutants. The construction of ENuc and 5Nuc single 141

gene deletion mutants (hereafter called ΔENuc and Δ5Nuc) and double gene deletion 142


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

mutant (ΔENucΔ5Nuc) was performed as previously described (14). Briefly, the upstream 143

and downstream sequences surrounding ENuc were amplified from WT SEZ 144

chromosomal DNA using the primer combinations ENuc-L-F/ENuc-L-R and 145

ENuc-R-F/ENuc-R-R (Table 3). The upstream and downstream flanking sequences of 146

ENuc were ligated between the SalI and BamHI sites of the thermosensitive suicide 147

vector pSET4s to yield the recombinant plasmid pSET4s-ΔENuc, which was 148

electroporated into WT SEZ (15). The plasmid pSET4s-ΔENuc and the bacterial genome 149

exchanged genetic fragments twice via intermolecular recombination. Putative deletion 150

mutants were screened by PCR performed with the primer combination ENucF/ENucR 151

(Table 3). The mutant Δ5Nuc was constructed on the WT SEZ background using the 152

process mentioned above, and the double mutant ΔENucΔ5Nuc was constructed using the 153

same process on the ΔENuc background. 154

Isolation and purification of neutrophils. Murine neutrophils were isolated from 155

the fresh, heparinized venous blood of healthy ICR mice as previously described, with 156

some modifications (16). Briefly, whole blood was centrifuged at 400 × g for 30 min, and 157

then the top layer of plasma was discarded. Red blood cells were treated with lysis buffer 158

(Tris-NH4Cl). White blood cells were suspended in 0.85% NaCl. Three milliliters of 65% 159

Percoll were gently overlaid in a 15-ml tube (BD Falcon), followed by a 3-ml layer of 55% 160

Percoll; finally, the cell suspension was carefully overlaid as the top layer. The Percoll 161

gradient was centrifuged at 1000 × g for 30 min, and the cells at the plasma interface 162

were carefully removed and discarded. The cells between the 55% and 65% Percoll layers 163

were collected, washed in RPMI 1640 medium (Gibco) and resuspended in RPMI 1640 164


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

medium. Neutrophil purity was confirmed by performing flow cytometry, and cell 165

viability was detected by performing Trypan blue staining and counting cells in a 166

chamber slide (Invitrogen). 167

Isolation and purification of monocytes from blood. Blood from the ICR mice 168

was diluted in PBS and overlaid on a Histopaque® 1077 solution (Sigma Aldrich) via 169

gradient centrifugation at 400 × g for 20 min (17). The upper layer was aspirated, and 170

monocytes were enriched in the interphase. Then, the cells were washed with PBS, 171

suspended in RPMI 1640, and seeded into 24-well plates for further study. 172

Mouse survival assay. A mouse survival assay was carried out to assess the 173

virulence of WT SEZ, ΔENuc, Δ5Nuc and double mutant ΔENucΔ5Nuc. Fifty ICR mice 174

were divided into 5 groups, with 10 mice in each group. The positive group was 175

challenged with WT SEZ at a dose of 105 colony forming units (CFU) via intraperitoneal 176

injection. The experimental groups were challenged with 105 CFU of ΔENuc, Δ5Nuc and 177

ΔENucΔ5Nuc via intraperitoneal injection. The negative control group was challenged 178

with PBS. The symptoms of the mice were documented for 7 days post-infection. 179

Bacterial dissemination assay. Bacterial dissemination was evaluated as described 180

previously (18). Mice were inoculated with 104 CFU of WT SEZ, ΔENuc, Δ5Nuc and 181

double mutant ΔENucΔ5Nuc, with 5 mice in per group, via intravenous injection into the 182

caudal vein to ensure the direct interaction of bacteria and neutrophils; this dose of 183

bacteria causes asymptomatic infection. Bacterial burdens were enumerated in the blood, 184

liver, lung and spleen at 24 h, 48 h, 72 h and 96 h to evaluate bacterial proliferation. At 185

each time point, mice were euthanized. Livers, spleens, lungs, and blood were harvested, 186


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

weighed and homogenized in 1 ml of PBS. After that, the mixture was serially diluted 187

and plated on THB agar plates. 188

NETs bactericidal assays. Bactericidal assays were carried out to compare the 189

survival abilities of WT SEZ, ΔENuc, Δ5Nuc and double mutant ΔENucΔ5Nuc in the 190

presence of NETs, as described elsewhere (19). For the NETs bactericidal assays, 191

neutrophils were activated with Phorbol-myristate-acetate (PMA; Sigma-Aldrich) for 3 h, 192

after which cytochalasin B (Sigma Aldrich) was added to a final concentration of 10 193

μg/ml to suppress cell phagocytosis. WT SEZ bacteria and the three mutant strains were 194

grown to the logarithmic phase in THB, washed 3 times with sterile PBS, and added to 195

neutrophils at an MOI of 100 at 37°C under a 5% CO2 atmosphere. After incubation for 196

90 min, The remaining neutrophils were lysed with 0.02% Triton X-100 (Sigma Aldrich), 197

and the contents were serially diluted and plated on THB agar plates to determine the 198

number of viable bacteria. For the blank control, the same number of CFU for each 199

bacterial strain were plated without incubation. The percent bactericidal activity was 200

calculated as ([CFU/ml in blank control] – [CFU/ml in experimental group])/ [CFU/ml in 201

blank control] × 100%. 202

Nuclease activity assay. To detect the function of ENuc and 5Nuc, nuclease assays 203

were performed as described previously (20, 21). Briefly, 10 μl of calf thymus DNA 204

(Sigma Aldrich) at a dose of 100 ng/μl was mixed with reaction buffer (300 mM Tris; 3 205

mM MgCl2; 3 mM CaCl2, pH 7.0) in a total volume of 200 μl. The reaction was initiated 206

by adding 0.1 µM rENuc or r5Nuc protein and DNase I (Sigma Aldrich). DNase I and 207

reaction buffer were used as a positive control and negative control, respectively. After 208


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

incubation at 37°C for 1 h, the reaction was halted with the addition of EDTA at a final 209

concentration of 50 mM. The remaining DNA was visualized using GoldView Nucleic 210

Acid Stain (Vazyme Biotech Co., Ltd, Nanjing, China) under UV light. To further study 211

the function of ENuc and 5Nuc in SEZ, WT SEZ and the three mutant strains were 212

collected in the logarithmic phase of growth and washed 3 times with PBS. Thereafter, 10 213

μl of bacterial suspension at a dose of 106 CFU/ml was incubated with 1 μg of calf 214

thymus DNA in reaction buffer in a total volume of 50 μl at 37°C for 3 h. The remaining 215

DNA was detected as described above. DNase I and reaction buffer were used as a 216

positive control and negative control, respectively. 217

Nucleotidase activity and reverse phase high-performance liquid 218

chromatography (rpHPLC). To digest nucleotides and DNA, reaction buffer (300 mM 219

Tris; 3 mM MgCl2; 3 mM CaCl2, pH 7.0) was mixed with 1 mM nucleotides or 1 µg of 220

calf thymus DNA (Sigma Aldrich) and 0.1 µM rENuc, r5Nuc protein or bacteria at dose 221

of 106 CFU/ml in a total volume of 500 µl, followed by incubation at 37°C for 1 h. The 222

enzymatic reaction was stopped by adding EDTA at a final concentration of 50 mM. To 223

assess NETs digestion, 0.5 µM rENuc, r5Nuc or bacteria at a dose of 107 CFU/ml was 224

incubated with NETs for 3 h. The solution was centrifuged at 800 × g for 10 min, and the 225

supernatant was collected. 226

The production of deoxyadenosine and adenosine was determined by rpHPLC. 227

Samples underwent chromatography on a 250-mm × 4.6-mm column (BDS Hypersil C18, 228

5-µm particle size; Thermo Fisher Scientific). The mobile phase was a solution of 70% 229

65 mm K3PO4 mixed with 30% methanol, pH 6.8. The reaction samples were eluted with 230


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

the mobile-phase solution for 20 min for deoxyadenosine or 15 min for adenosine at a 231

flow rate of 0.8 ml/min. Peaks were detected at a UV absorbance of 260 nm. Commercial 232

nucleosides (Sigma-Aldrich) were used as a standard sample. 233

Phagocytosis assay. A phagocytosis assay was performed according to a previously 234

described method with modifications (22). RAW264.7 cells in 24-well plates were 235

pretreated with 50 μM deoxyadenosine for 1 h. WT SEZ was cultured to the 236

mid-exponential phase and washed 3 times with PBS. The RAW264.7 cells were then 237

washed 3 times with DMEM without fetal bovine serum. Semi-confluent monolayers 238

were infected with 100-μl suspensions containing 106 CFU/ml WT SEZ. The control 239

group comprised RAW264.7 cells without deoxyadenosine pretreatment. Each 24-well 240

plate was concentrated at 800 × g for 10 min and incubated for 2 h at 37°C in 5% CO2. 241

Cells were washed 3 times with DMEM, followed by treatment with 242

penicillin-streptomycin at a concentration of 100 µg/ml for 1 h to kill extracellular 243

bacteria. The cells were again washed 3 times with DMEM, and 100 μl of trypsin and 900 244

μl of sterile deionized water were added to release all bacteria. CFU numbers were 245

determined by plating serial dilutions. WT SEZ without incubation was plated on THB 246

agar as the initial concentration, and the percent bactericidal activity in the control group 247

was set as 100%. The percent bactericidal activity in the treatment group was calculated 248

as (bactericidal CFU in the treatment group)/ (bactericidal CFU in the control group) × 249

100%. 250

To study the effects of deoxyadenosine on macrophages, we designed the following 251

assay. Briefly, cells were pretreated with or without 50 μM deoxyadenosine for 1 h and 252


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

then incubated with WT SEZ for 2 h; following this, extracellular bacteria were killed 253

with 100 µg/ml penicillin-streptomycin for 1 h, 2 h, 3 h and 4 h, and the number of viable 254

bacteria on THB agar was calculated for each time point. The number of surviving 255

bacteria after antibiotic killing for 1 h was considered the total number of viable 256

intracellular bacteria. RAW264.7 cells without treatment were used as controls. The 257

bactericidal percentage was calculated as follows: ([CFU/ml at n h] - [CFU/ml at n+1 h])/ 258

(CFU/ml at 1h) × 100%. 259

Neutrophil and monocyte bactericidal assays. Cells isolated from murine blood 260

were pretreated with or without 50 μM deoxyadenosine; following this, WT SEZ bacteria 261

cultured to the mid-exponential growth phase were washed 3 times with PBS and added 262

to murine blood cells. The mixture was incubated for 90 min and lysed with 0.02% Triton 263

X-100 on ice. The CFU of viable bacteria were determined by plating serial dilutions on 264

THB agar. 265

Statistical analysis. All experiments were repeated at least 3 times. The GraphPad 266

Prism 5 Software package (GraphPad Software, La Jolla, CA, USA) was used to perform 267

statistical analyses. Values of p <0.05 were considered statistically significant. 268

RESULTS 269

Determination and identification of ENuc and 5Nuc. Seven genes in WT SEZ are 270

predicted to encode related extracellular nucleases according to a literature search in the 271

NCBI database (listed in Table 2); however, it is unknown whether these genes are 272


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

transcribed. Therefore, qRT-PCR was performed to study the transcriptional levels of 273

these genes. mRNA expression levels at 2 h were set as 1-fold, and all 7 genes were 274

transcribed during growth, particularly by 10 h (early in the stationary phase). However, 275

the expression of ENuc and 5Nuc was significantly higher by 10 h (p <0.001) than that of 276

other nuclease genes. At 10 h, ENuc and 5Nuc transcription levels were 165 times and 67 277

times higher, respectively, than their transcription levels at 2 h (Fig. 1A). 278

ENuc (2781-bp ORF; NCBI Gene ID, SESEC_RS04165) and 5Nuc (2007-bp ORF; 279

NCBI Gene ID, SESEC_RS05720) are uncharacterized genes encoding a nuclease and a 280

5’-nucleotidase, and their corresponding proteins are designated ENuc and 5Nuc. ENuc 281

contains a Gram-positive cocci surface protein LPXTG motif, a signal peptide, and three 282

predicted extracellular nuclease domains, including two motifs similar to the OB fold of 283

Bacillus subtilis YhcR: a sugar-nonspecific nuclease (YhcR_OBF_like; accession, 284

cd04486; E-value = 2.72e-13 and 2.13e-12) and an exonuclease-endonuclease-phosphatase 285

domain (accession, cl00490; E-value = 4.48e--30). 5Nuc contains an LPXTG motif, a 286

peptide and two 5’-nucleotidase metallophosphatase domains in the amino-terminal 287

region (accession, cl13995; E-value = 1.26e--121) and a 5’-nucleotidase domain (accession, 288

pfam02872; E-value = 3.18e-32) in the carboxyl-terminal region. All data available from 289

the NCBI were analyzed. 290

Virulence comparison. The virulence of the three gene deletion mutants decreased 291

to varying degrees compared with WT SEZ (p<0.001). Half of the mice challenged with 292

double mutant ΔENucΔ5Nuc survived for 7 days post-infection. All mice in the WT SEZ 293

group died between 24 h and 72 h post-infection. In contrast, mice challenged with 294


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

ΔENuc and ΔENucΔ5Nuc exhibited no obvious symptoms during the first 3 days 295

post-infection; however, all mice challenged with ΔENuc eventually died between 84 h 296

and 120 h post-infection, suggesting ENuc contributes to bacterial survival during the 297

early stage of infection. Mice challenged with Δ5Nuc began to die at 48 h post-infection, 298

and 20% of mice in the Δ5Nuc group survived, indicating an important role for 5Nuc in 299

bacterial proliferation during infection (Fig. 1B). Clearly, ENuc and 5Nuc are important 300

virulence factors during SEZ infection, and ENuc may play a role in early infection, 301

while 5Nuc appears to be more active than ENuc. All mice challenged with PBS survived, 302

and the data are not shown in Fig. 1B. 303

Roles of ENuc and 5Nuc in NETs entrapment evasion. To study the functions of 304

ENuc and 5Nuc, we cloned these two genes from the genome of WT SEZ and ligated 305

them into the vectors pET-32a (+) and pET-28a (+), respectively. Recombinant proteins 306

were purified from E. coli Rosetta. rENuc and r5Nuc both degraded calf thymus DNA 307

within 1 h at 37°C. Notably, double mutant ΔENucΔ5Nuc lost its ability to degrade calf 308

thymus DNA compared with WT SEZ, ΔENuc and Δ5Nuc (Fig. 2). Thus, the expression 309

of ENuc and 5Nuc allows WT SEZ to acquire the ability to degrade extracellular DNA. 310

Deoxyadenosine derived from the degradation of NETs DNA backbone is toxic to 311

host immune cells. To determine whether ENuc and 5Nuc degrade DNA into 312

deoxyadenosine, deoxyadenosine production was analyzed using rpHPLC. Recombinant 313

rENuc and r5Nuc degraded calf thymus DNA, which mimics the DNA backbone of 314

NETs, and NETs DNA and produced deoxyadenosine (Fig. 3A–G). WT SEZ, ΔENuc and 315

Δ5Nuc also produced deoxyadenosine following NETs interaction, but the double mutant 316


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

ΔENucΔ5Nuc did not (Fig. 3H-K). Additionally, WT, ΔENuc and Δ5Nuc degraded calf 317

thymus DNA to produce deoxyadenosine (see Fig. S1 in the supplemental material). Thus, 318

ENuc and 5Nuc, which possess both nuclease activity and 5’-nucleotidase activity, 319

appear to be the primary nucleases that allow SEZ to evade entrapment of NETs. 320

Recombinant rENuc and r5Nuc both exhibited 5’-nucleotidase activity and 321

hydrolyzed adenosine triphosphate (ATP), adenosine diphosphate (ADP) and adenosine 322

monophosphate (AMP) to produce adenosine (Fig. 4). Adenosine is an 323

immunomodulatory molecule that suppresses neutrophil functions such as degranulation. 324

Therefore, the ability of ENuc and 5Nuc to generate adenosine enhances the virulence of 325

SEZ. 326

Survival in different organs. NETs degradation contributes to SEZ-induced 327

bacteremia and spread to the organs from the blood. In particular, WT SEZ showed a 328

greater tendency to break through blood barrier and cause bacteremia. At 24 h 329

post-infection, only mice challenged with WT SEZ demonstrated bacterial loads in the 330

blood, lung, spleen and liver, indicating that the mutant strains were less able to survive 331

and cross the blood barrier. Mice challenged with ΔENuc showed bacterial loads at 48 h 332

and 72 h, but mice challenged with Δ5Nuc only showed bacteria loads at 48 h, suggesting 333

an increased tendency for ΔENuc to spread to the organs from the blood. The nuclease 334

activity of 5Nuc appear to be more potent than ENuc, which is consistent with the 335

virulence of ΔENuc and Δ5Nuc. Importantly, at 72 h post-infection, mice challenged with 336

ΔENuc demonstrated bacterial loads equivalent to those in mice challenged with WT SEZ; 337

however, at 96 h post-infection, WT SEZ was better able to survive in organs such as the 338


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

lung, liver and spleen. Thus, not only dose WT SEZ demonstrate a superior ability to 339

transfer to organs but also impedes clearance by the host. Mice challenged with double 340

mutant ΔENucΔ5Nuc did not exhibit bacterial loads from 24 h to 96 h, suggesting 341

bacteria were killed by the host immune system at an early stage in the blood due to the 342

lack of ENuc and 5Nuc (Fig. 5). 343

Bactericidal capacity of NETs. WT SEZ resists killing by NETs. The bactericidal 344

activity of NETs after incubation with WT SEZ was negative, facilitating bacterial 345

replication and increased numbers of WT SEZ. However, approximately 30% of ΔENuc, 346

50% of Δ5Nuc and 60% of ΔENucΔ5Nuc were killed following incubation with NETs for 347

90 min (Fig. 6). In addition, fibrous structure of NETs DNA backbone was only found in 348

gene deletion mutant strains and NETs concentrations induced by ΔENuc and Δ5Nuc 349

were 2 and 5 times higher than that induced by WT SEZ. Importantly, NETs 350

concentrations induced by ΔENucΔ5Nuc were more than 7 times higher than that induced 351

by WT SEZ (see Fig. S2 in the supplemental material). Weaker ability to induce NETs 352

formation by WT SEZ compared with gene deletion mutants may attribute to the DNA 353

degradation activities of ENuc and 5Nuc, which contributes to bacterial survival in NETs. 354

Therefore, ENuc and 5Nuc play important roles in protecting bacteria against killing by 355

NETs, aiding SEZ proliferation and spread to deep tissues. 356

The effects of deoxyadenosine on RAW264.7 phagocytosis. To evaluate the 357

cytotoxic effects of the NETs degradation product deoxyadenosine on immune cells, 358

RAW264.7 cells and neutrophils and monocytes obtained from blood were employed. 359

Phagocytosis and the bactericidal capacity of RAW264.7 pre-treated with 360


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

deoxyadenosine decreased by almost 60% (Fig. 7A). Surprisingly, in an intracellular 361

killing assay, the intracellular killing activity of RAW264.7 cells pre-treated with 362

deoxyadenosine was equivalent to that of RAW264.7 cells without pre-treatment (Fig. 363

7B). Thus, deoxyadenosine primarily impairs the phagocytosis of macrophages but does 364

not affect the intracellular killing process. Furthermore, deoxyadenosine did not influence 365

the bactericidal activity of monocytes (Fig. 7C). 366

The effects of deoxyadenosine on neutrophil function. To evaluate the effects of 367

deoxyadenosine on neutrophils, two assays were designed. In the first, we tested the 368

influence of deoxyadenosine on bacterial killing activity, and in the second we tested the 369

effects of deoxyadenosine on NETs formation induced by PMA. Based on the results of 370

both assays, deoxyadenosine did not affect neutrophil function (Fig. 8). Purified 371

neutrophils comprised greater than 90% of total cells, and viability was nearly 90% over 372

4 h in vitro in study (see Fig. S3 in the supplemental material). Thus, our experiments 373

were carried out with active and pure neutrophils, lending credibility to the results. 374

DISCUSSION 375

This study was initially designed to identify the functions of extracellular nucleases 376

of SEZ in the context of immune evasion and provide new ideas for future studies 377

examining bacterial zoonosis. We assessed the interactions between SEZ and NETs and 378

observed the ability of SEZ to evade entrapment and killing by NETs. Importantly, SEZ 379

possesses a potent ability to degrade NETs into deoxyadenosine, negatively influencing 380

macrophage phagocytic activity. The production of extracellular nucleases by bacteria is 381

a significant mechanism utilized by bacteria to escape NETs (23). In this work, we 382


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

confirmed the identities of two primary extracellular nucleases by conducting a literature 383

search of the NCBI database and performing qRT-PCR. Interestingly, the recombinant 384

proteins rENuc and r5Nuc demonstrated both nuclease and nucleotidase activities 385

allowing both to degrade NETs and produce deoxyadenosine. To further study the 386

functions of these two enzymes, three gene deletion mutant strains—ΔENuc, Δ5Nuc and 387

double mutant ΔENucΔ5Nuc—were constructed. These mutants exhibited lower 388

virulence and a weaker ability to spread from the blood to organs compared to the WT 389

SEZ strain; this was particularly the case for the two-gene deletion mutant ΔENucΔ5Nuc. 390

Half of the mice challenged with ΔENucΔ5Nuc survived, while all of the mice in the WT 391

SEZ group were dead within three days. Thus, it appears difficult for ΔENucΔ5Nuc to 392

exit the blood-stream. Despite the degradation of NETs by SEZ, deoxyadenosine, a NETs 393

degradation product, may contribute to bacterial survival in the host; according to our 394

results, deoxyadenosine suppresses macrophage phagocytosis. These two characteristics 395

of SEZ strongly contribute to its pathogenicity and proliferation in the host. 396

NETs constitute an important and novel innate immune defense system that 397

influences pathogen invasion. Recently, this phenomenon was noted in several bacteria, 398

including Staphylococcus aureus and Streptococcus pyogenes (24). In this study, when 399

the genes ENuc and 5Nuc were knocked down simultaneously, SEZ was less able to 400

survive in NETs and better able to stimulate neutrophils to produce NETs which 401

indicated that ENuc and 5Nuc influenced SEZ virulence. PMA is generally 402

acknowledged to be an appropriate positive control when stimulating neutrophils to 403

produce NETs and was employed in this study in vitro (25). In previous studies 404


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

examining the interactions between pathogens and NETs in the context of 405

deoxyribonuclease, extracellular deoxyribonucleases protected pathogens by allowing 406

them to evade entrapment by NETs; these include EndA produced by Streptococcus 407

pneumoniae and Sda1 produced by Streptococcus pyogenes (26, 27-29). The recombinant 408

rENuc and r5Nuc proteins both degraded calf thymus DNA, a common substitute for the 409

NETs DNA backbone in laboratory research. Thus, ENuc and 5Nuc likely protect SEZ 410

from NETs entrapment. In addition, high bacterial loads were only observed in mice 411

challenged with WT SEZ at 24 h post-infection; this may be attributable to the functions 412

of ENuc and 5Nuc such that WT SEZ not only survived in the host but was able to spread 413

to organs better than the mutant strains. Moreover, Δ5Nuc and ΔENucΔ5Nuc 414

demonstrated difficulty in spreading to other organs from the blood, probably due to the 415

deletion of 5Nuc. Thus, 5Nuc may be more active than ENuc. Importantly, mice 416

challenged with ΔENucΔ5Nuc demonstrated no bacterial loads, highlighting the 417

importance and virulence of ENuc and 5Nuc. In summary, SEZ degrades NETs and 418

protects itself by evading entrapment by the host immune system, which may account for 419

the differences in virulence between SEZ, ΔENuc, Δ5Nuc and double mutant 420

ΔENucΔ5Nuc. 421

Extracellular 5′-nucleotidases, such as AdsA of Staphylococcus aureus, produce 422

adenosine, which is an immunomodulatory molecule (30, 31). However, Thammavongsa 423

V and colleagues noted cooperation between AdsA and a nuclease, facilitating the 424

production of deoxyadenosine through the degradation of NETs DNA. Deoxyadenosine 425

induces macrophage apoptosis via caspase-3 activation, thereby restricting macrophage 426


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

survival and promoting the establishment of infection (12). In this study, SEZ degraded 427

NETs DNA backbone and produced deoxyadenosine to suppress the phagocytosis of 428

macrophages but did not negatively influence neutrophils and monocytes. Unexpectedly, 429

both ENuc and 5Nuc demonstrated the ability to convert calf thymus DNA and NETs 430

DNA into deoxyadenosine as directly detected by rpHPLC. This mechanism differs from 431

that observed in other pathogens such as Staphylococcus aureus or Streptococcus 432

pyogenes because these pathogens possess NETs-cleaving nucleases in addition to 433

5′-nucleotidases (30, 32, 33). In this study, SEZ secreted two major extracellular enzymes, 434

ENuc and 5Nuc, that degraded DNA backbone of NETs and produced deoxyadenosine. 435

Even with the deletion of either of these two genes, SEZ was also able to degrade NETs 436

into deoxyadenosine. However, when both genes were knocked out, SEZ virulence 437

decreased and its abilities to degrade NETs and generate deoxyadenosine were lost. 438

Additionally, ENuc and 5Nuc possess the ability to hydrolyze AMP, ADP and ATP to 439

produce the immunomodulatory substrate adenosine, similar to Nt5e produced by 440

Streptococcus sanguinis and AdsA produced by Staphylococcus aureus but unlike S5nA 441

produced by Streptococcus pyogenes and Nud P produced by Streptococcus agalactiae, 442

which demonstrate limited specificity for AMP and ADP (31, 34, 35). Adenosine 443

suppresses neutrophil activation by occupying the A2a receptor on neutrophils and 444

promoting bacterial survival in the host bloodstream (36). Our data reveal a novel and 445

potent mechanism in which extracellular nucleases degrade NETs and produce 446

deoxyadenosine. 447


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

Deoxyadenosine is cytotoxic to macrophages. During infection with Staphylococcus 448

aureus, deoxyadenosine production is sufficient to restrict macrophage survival and 449

promote the establishment of persistent infection (12). The production of deoxyadenosine 450

through the degradation DNA backbone of NETs is an important mechanism enabling 451

bacterial survival. However, only a few studies have examined the functions of 452

deoxyadenosine in immune cells. In this study, we investigated the influence of 453

deoxyadenosine on macrophages, neutrophils and monocytes and only observed negative 454

effects on macrophage phagocytosis; however, deoxyadenosine did not affect the 455

bactericidal activity of macrophages. Additionally, deoxyadenosine exerted no influence 456

on the functions of neutrophils and monocytes. The molecular mechanism of 457

deoxyadenosine underlying immune cell impairment will be explored in a future study. 458

In summary, SEZ secretes two potent extracellular enzymes, ENuc and 5Nuc, each 459

demonstrating nuclease and 5′-nucleotidase activities, which allow SEZ to evade 460

entrapment by degrading NETs and producing the cytotoxic substrate deoxyadenosine to 461

impair macrophage phagocytosis. This mechanism differs from a previously reported 462

mechanism in which bacteria utilize nuclease in collaboration with 5′-nucleotidase to 463

degrade NETs DNA into deoxyadenosine. Our novel mechanism represent an ingenious 464

method for bacteria to utilize host components for survival and simultaneously perturb 465

host immune defenses. In addition, the two enzymes hydrolyze ATP, ADP and AMP to 466

produce the immunomodulatory substrate adenosine. Thus, ENuc and 5Nuc are novel and 467

important virulence factors for SEZ, and their identification will aid in the further study 468

of immune evasion by zoonotic pathogens and contribute to the design of therapeutics. 469


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

ACKNOWLEDGEMENTS 470

We thank high-performance liquid chromatography unit and flow cytometer unit 471

(Laboratory Center of Life Science, Nanjing Agriculture University). 472

FUNDING INFORMATION 473

This work was supported by grants from the National Transgenic Major Program 474

(2014ZX0800946B), the Special Fund for Agro-scientific Research in the Public Interest 475

(201403054), the National Natural Science Foundation of China (31272581, 31672574) 476

the Jiangsu Agriculture Science and Technology Innovation Fund (CX(15)1056) and the 477

Project Funded by the Priority Academic Program Development of Jiangsu Higher 478

Education Institutions (PAPD). 479

REFERENCES 480

1. Moloney E, Kavanagh KS, Buckley TC, Cooney JC. 2013. Lineages of 481

Streptococcus equi ssp. equi in the Irish equine industry. Ir Vet J 66:1. 482

2. Ma Z, Geng J, Yi L, Xu B, Jia R, Li Y, Meng Q, Fan H, Hu S. 2013. Insight 483

into the specific virulence related genes and toxin-antitoxin virulent pathogenicity 484

islands in swine streptococcosis pathogen Streptococcus equi ssp. zooepidemicus 485

strain ATCC35246. BMC Genomics 14:377. 486

3. Holden MTG, Heather Z, Paillot R, Steward KF, Webb K, Ainslie F, 487

Jourdan T, Bason NC, Holroyd NE, Mungall K, Quail MA, Sanders M, 488

Simmonds M, Willey D, Brooks K, Aanensen DM, Spratt BG, Jolley KA, 489

Maiden MCJ, Kehoe M, Chanter N, Bentley SD, Robinson C, Maskell DJ, 490


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

Parkhill J, Waller AS. 2009. Genomic evidence for the evolution of 491

Streptococcus equi: Host restriction, increased virulence, and genetic exchange 492

with human pathogens. PLOS pathogens doi:e1000346. 493

4. Lindahl SB, Aspan A, Baverud V, Paillot R, Pringle J, Rash NL, Soderlund R, 494

Waller AS. 2013. Outbreak of upper respiratory disease in horses caused by 495

Streptococcus equi subsp. zooepidemicus ST-24. Vet Microbiol 166:281-285. 496

5. Wartha F, Beiter K, Normark S, Henriques-Normark B. 2007. Neutrophil 497

extracellular traps: casting the NET over pathogenesis. Curr Opin Microbiol 498

10:52-56. 499

6. Borregaard N. 2010. Neutrophils, from marrow to microbes. Immunity 500

33:657-670. 501

7. Fuchs TA, Abed U, Goosmann C, Hurwitz R, Schulze I, Wahn V, Weinrauch 502

Y, Brinkmann V, Zychlinsky A. 2007. Novel cell death program leads to 503

neutrophil extracellular traps. J Cell Biol 176:231-241. 504

8. Brinkmann V, Zychlinsky A. 2012. Neutrophil extracellular traps: is immunity 505

the second function of chromatin? J Cell Biol 198:773-783. 506

9. Yost CC, Cody MJ, Harris ES, Thornton NL, McInturff AM, Martinez ML, 507

Chandler NB, Rodesch CK, Albertine KH, Petti CA, Weyrich AS, 508

Zimmerman GA. 2009. Impaired neutrophil extracellular trap (NET) formation: 509

a novel innate immune deficiency of human neonates. Blood 113:6419-6427. 510

10. Buchanan JT, Simpson AJ, Aziz RK, Liu GY, Kristian SA, Kotb M, 511

Feramisco J, Nizet V. 2006. DNase expression allows the pathogen group A 512


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

Streptococcus to escape killing in neutrophil extracellular traps. Curr Biol 513

16:396-400. 514

11. Puyet A, Greenberg B, Lacks SA. 1990. Genetic and structural characterization 515

of endA: A membrane-bound nuclease required for transformation of 516

Streptococcus pneumoniae. J Mol Biol 213:727-738. 517

12. Thammavongsa V, Missiakas DM, Schneewind O. 2013. Staphylococcus 518

aureus degrades neutrophil extracellular traps to promote immune cell death. 519

Science 342:863-866. 520

13. White MJ, Boyd JM, Horswill AR, Nauseef WM. 2014. 521

Phosphatidylinositol-Specific Phospholipase C Contributes to Survival of 522

Staphylococcus aureus USA300 in Human Blood and Neutrophils. Infect Immun 523

82:1559-1571. 524

14. Miyoshi-Akiyama T, Takamatsu D, Koyanagi M, Zhao J, Imanishi K, 525

Uchiyama T. 2005. Cytocidal effect of Streptococcus pyogenes on mouse 526

neutrophils in vivo and the critical role of streptolysin S. J Infect Dis 527

192:107-116. 528

15. Takamatsu D, Osaki M, Sekizaki T. 2001. Thermosensitive suicide vectors for 529

gene replacement in Streptococcus suis. Plasmid 46:140-148. 530

16. Brinkmann V, Laube B, Abu Abed U, Goosmann C, Zychlinsky A. 2010. 531

Neutrophil extracellular traps: how to generate and visualize them. J Vis Exp 532

doi:10.3791/1724. 533


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

17. Bernatowicz P, Kowal K. 2016. Soluble CD163 modulates cytokine production 534

by peripheral blood mononuclear cells stimulated by Dermatophagoides 535

pteronyssinus allergens in vitro. Adv Med Sci 61:249-254. 536

18. Ermert D, Shaughnessy J, Joeris T, Kaplan J, Pang CJ, Kurt-Jones EA, Rice 537

PA, Ram S, Blom AM. 2015. Virulence of Group A Streptococci is enhanced by 538

human complement inhibitors. PLOS Pathogens 11. 539

19. Liu P, Pian Y, Li X, Liu R, Xie W, Zhang C, Zheng Y, Jiang Y, Yuan Y. 2014. 540

Streptococcus suis adenosine synthase functions as an effector in evasion of 541

PMN-mediated innate immunit. J Infect Dis 210:35-45. 542

20. Moon AF, Gaudu P, Pedersen LC. 2014. Structural characterization of the 543

virulence factor nuclease A from Streptococcus agalactiae. Acta Crystallogr D 544

Biol Crystallogr 70:2937-2949. 545

21. de Buhr N, Stehr M, Neumann A, Naim HY, Valentin-Weigand P, von 546

Kockritz-Blickwede M, Baums CG. 2015. Identification of a novel DNase of 547

Streptococcus suis (EndAsuis) important for neutrophil extracellular trap 548

degradation during exponential growth. Microbiology 161:838-850. 549

22. Mitterstiller AM, Haschka D, Dichtl S, Nairz M, Demetz E, Talasz H, Soares 550

M, Einwallner E, Esterbauer H, Fang FC, Geley S, Weiss G. 2016. Heme 551

oxygenase 1 controls early innate immune response of macrophages to Salmonella 552

typhimurium infection. Cell Microbiol doi:10.1111/cmi.12578. 553

23. Altincicek B, Stotzel S, Wygrecka M, Preissner KT, Vilcinskas A. 2008. 554

Host-derived extracellular nucleic acids enhance innate immune responses, induce 555


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

coagulation, and prolong survival upon infection in insects. J Immunol 556

181:2705-2712. 557

24. Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss DS, 558

Weinrauch Y, Zychlinsky A. 2004. Neutrophil extracellular traps kill bacteria. 559

Science 303:1532-1535. 560

25. Daigo K, Hamakubo T. 2012. Host-protective effect of circulating pentraxin 3 561

(PTX3) and complex formation with neutrophil extracellular traps. Front Immunol 562

3:378. 563

26. de Buhr N, Neumann A, Jerjomiceva N, von Kockritz-Blickwede M, Baums 564

CG. 2014. Streptococcus suis DNase SsnA contributes to degradation of 565

neutrophil extracellular traps (NETs) and evasion of NET-mediated antimicrobial 566

activity. Microbiology 160:385-395. 567

27. Sumby P, Barbian KD, Gardner DJ, Whitney AR, Welty DM, Long RD, 568

Bailey JR, Parnell MJ, Hoe NP, Adams GG, Deleo FR, Musser JM. 2005. 569

Extracellular deoxyribonuclease made by group A Streptococcus assists 570

pathogenesis by enhancing evasion of the innate immune response. Proc Natl 571

Acad Sci U S A 102:1679-1684. 572

28. Zhu L, Kuang Z, Wilson BA, Lau GW. 2013. Competence-independent activity 573

of pneumococcal EndA mediates degradation of extracellular DNA and NETs and 574

Is important for virulence. PLoS One 8. 575

29. Chatellier S, Ihendyane N, Kansal RG, Khambaty F, Basma H, 576

Norrby-Teglund A, Low DE, McGeer A, Kotb M. 2000. Genetic relatedness 577

and superantigen expression in Group A Streptococcus serotype M1 isolated from 578


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

patients with severe and nonsevere invasive diseases. Infect Immun 579

68:3523-3534. 580

30. Zheng L, Khemlani A, Lorenz N, Loh JM, Langley RJ, Proft T. 2015. 581

Streptococcal 5'-nucleotidase A (S5nA), a novel Streptococcus pyogenes 582

virulence factor that facilitates immune evasion. J Biol Chem 290:31126-31137. 583

31. Thammavongsa V, Schneewind O, Missiakas DM. 2011. Enzymatic properties 584

of Staphylococcus aureus adenosine synthase (AdsA). BMC Biochem 12:56. 585

32. Fan J, Zhang Y, Chuang-Smith ON, Frank KL, Guenther BD, Kern M, 586

Schlievert PM, Herzberg MC. 2012. Ecto-5'-nucleotidase: a candidate virulence 587

factor in Streptococcus sanguinis experimental endocarditis. PLoS One 7:e38059. 588

33. Thammavongsa V, Kern JW, Missiakas DM, Schneewind O. 2009. 589

Staphylococcus aureus synthesizes adenosine to escape host immune responses. J 590

Exp Med 206:2417-2427. 591

34. H Z. 1992. 5'-Nucleotidase: molecular structure and functional aspects. Biochem 592

J 285:345-365. 593

35. Firon A, Dinis M, Raynal B, Poyart C, Trieu-Cuot P, Kaminski PA. 2014. 594

Extracellular nucleotide catabolism by the Group B Streptococcus 595

ectonucleotidase NudP increases bacterial survival in blood. J Biol Chem 596

289:5479-5489. 597

36. Haskó G. 2004. Adenosine: an endogenous regulator of innate immunity. Trends 598

Immunol 25:33-39. 599


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

FIG 1 The major nucleases and their virulence as determined by qRT-PCR and in a 600

mouse survival assay 601

(A) Changes in the transcription of predicted extracellular nuclease genes measured by 602

qRT-PCR during different growth phases of wild-type SEZ. SEZ GADPH 16S rRNA was 603

chosen as the internal control. The results are depicted as the mean ±SD (n = 3). (B) The 604

survival rate of mice challenged with wild-type SEZ and 3 gene deletion mutants. During 605

the first 72 h, all mice challenged with wild-type SEZ died. At 84 h, mice challenged 606

ΔENuc began to die, and all mice were dead by 120 h. Mice challenged with Δ5Nuc 607

began to die at 48 h post-infection, and almost 20% of mice survived by 148 h. Mice 608

challenged with double mutant ΔENucΔ5Nuc showed low mortality; approximately 50% 609

survived by 148 h. Virulence was compared between the three mutants and wild-type 610

SEZ. ***, p<0.001. 611

FIG 2 DNase activity of ENuc and 5Nuc. 612

(A) ENuc and 5Nuc degrade calf thymus DNA. Banding indicates the remaining DNA, 613

and lanes from left to right represent DNase I, reaction buffer, rENuc and r5Nuc 614

incubated with calf thymus DNA. (B) Wild-type SEZ and the 3 mutants degrade calf 615

thymus DNA. Lanes from left to right indicate remaining DNA after calf thymus DNA 616

incubated with wild-type SEZ, ΔENuc, Δ5Nuc, ΔENucΔ5Nuc, reaction buffer and DNase 617

I. 618

FIG 3 Production of deoxyadenosine detected by rpHPLC 619


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

(A) A standard deoxyadenosine sample (Sigma Aldrich) was evaluated by rpHPLC. (B) 620

Calf thymus DNA was evaluated by rpHPLC. (C) and (D) Deoxyadenosine production 621

following the incubation of rENuc and r5Nuc with calf thymus DNA. (E) NETs derived 622

from neutrophils induced by PMA were measured by rpHPLC. (F) to (K) 623

Deoxyadenosine production after the incubation of NETs with rENuc, r5Nuc, wild-type 624

SEZ, ΔENuc, Δ5Nuc and ΔENucΔ5Nuc was determined by rpHPLC. The arrows indicate 625

deoxyadenosine. 626

FIG 4 Hydrolysis of AMP, ADP and ATP by ENuc and 5Nuc 627

(A) and (B) Standard adonosine and AMP sample were evaluated by rpHPLC. (C) and (D) 628

AMP was hydrolyzed by rENuc and r5Nuc to generate adenosine. (E) Standard ADP 629

sample. (F) and (G) Adenosine evaluated by rpHPLC as a product of rENuc and r5Nuc 630

following incubation with ADP. (H) Standard ATP sample. (I) and (J) ATP was 631

hydrolyzed by rENuc and r5Nuc to generate adenosine. The arrows indicate the produced 632

adenosine. 633

FIG 5 Survival of wild-type SEZ and the 3 mutant strains in different organs 634

Rows represent the time points for sample collection. From top to bottom: 24 h, 48 h, 72 635

h and 96 h post-infection. Columns represent organs collected from infected mice. From 636

left to right: blood, liver, lung and spleen. The results are depicted as the mean ±SD (n = 637

5). *, p<0.05; **, p<0.01; ***, p<0.001; ns, no difference between groups. 638

FIG 6 NETs survival capacity of wild-type SEZ and its 3 mutants 639


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

Nearly all wild-type SEZ survived and proliferated in the presence of NETs, whereas 640

30%, 50% and 60% of ΔENuc, Δ5Nuc and ΔENucΔ5Nuc, respectively, were killed in the 641

presence of NETs. The results are depicted as the mean ±SD (n = 5); *, p<0.05; **, 642

p<0.01. 643

FIG 7 Effects of deoxyadenosine on RAW264.7 phagocytosis 644

Deoxyadenosine(-) indicates control groups that were not treated with deoxyadenosine; 645

deoxyadenosine(+) indicates groups that were pretreated with deoxyadenosine. (A) The 646

percent bactericidal activity of the control group was set to 100%. The bactericidal 647

activity of RAW264.7 cells treated with deoxyadenosine decreased to 40%. (B) △1 h, 648

△2 h and △3 h indicate the intracellular bactericidal rates of RAW264.7 cells between 1 649

and 2 h, 2 and 3 h and 3 and 4 h after extracellular bacteria were killed. Bactericidal 650

activity for each time range was compared. After 4 h, all intracellular bacteria were killed, 651

both in the control and treatment groups. (C) The bactericidal activity of monocytes is 652

evaluated by determining the CFU of viable bacteria after incubation. The CFU of viable 653

bacteria in the control group was set to 100%. The results are depicted as the mean ±SD 654

(n = 5); ***, p<0.001; ns, no differences between groups. 655

FIG 8 Measurement of the effects of deoxyadenosine on neutrophil function 656

Deoxyadenosine(-) indicates control groups that were not treated with deoxyadenosine; 657

deoxyadenosine(+) indicates treatment groups that were pretreated with deoxyadenosine. 658

(A) The bactericidal activity of neutrophils was evaluated by determining the CFU of 659

surviving bacteria after incubation. (B) PMA-stimulating NETs formation by neutrophils 660


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

was measured as the concentration of extracellular DNA, which was assessed with Pico 661

green and represented as relative fluorescence units (RFU). Resulted are depicted as the 662

mean ±SD n=5; ns indicates no differences between groups. 663


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

TABLE 1. Strains and plasmids used in this study 1

Bacteria strain and plasmid Notable characteristic (s) Source of reference

SEZ strains

SEZ ATCC35246 Wild-type isolated from infected pig Purchased from ATCC

ΔENuc The SESEC_RS04165 (ENuc) deletion mutant of SEZ

ATCC35246

This study

Δ5Nuc The SESEC_RS05720 (5Nuc) deletion mutant of SEZ

ATCC35246

This study

ΔENucΔ5Nuc The ENuc and 5Nuc double gene deletion mutant of SEZ

ATCC35246

This study

E. coli strains

E. coli DH5a Plasmid cloning host and Gram-negative replicon Purchased from Invitrogen

E. coli Rosetta E. coli - plasmid expressing host Purchased from Invitrogen

E. coli Rosetta 32a-ENuc E. coli Rosetta carrying plasmid pET32a-ENuc, Ampr This study

E. coli Rosetta 28a-5Nuc E. coli Rosetta carrying plasmid pET28a-5Nuc, Kmr This study

plasmids

pSET4s Streptococcus thermosensitive suicide vector, Spcr Takamatsu, 2001

pSET4s-ΔENuc pSET4s containing the upstream and downstream sequences This study


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

surrounding ENuc for deleting ENuc, Spcr

pSET4s-Δ5Nuc pSET4s containing the upstream and downstream sequences

surrounding 5Nuc for deleting 5Nuc, Spcr

This study

pET-32a (+) E. coli – gene expressing vector, Ampr Purchased from Invitrogen

pET32a-ENuc pET-32a containing ENuc gene, Ampr This study

pET-28a (+) E. coli – gene expressing vector, Kmr Purchased from Invitrogen

pET28a-5Nuc pET-28a containing 5Nuc gene, Kmr This study

Ampr, ampicillin resistance cassette; Kmr, kanamycin resistance cassette; Spcr, 2

spectinomycin resistance cassette. 3


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

TABLE 2. Predicted genes encoding extracellular nucleases in SEZ 1

Gene ID Producta Abbreviation

SESEC_RS04165

SESEC_RS05720

nuclease

5’-nucleotidase

ENuc

5Nuc

SESEC_RS02695 CRISP-associated protein Cas4

SESEC_RS03220 DNA/RNA non-specific endonuclease

SESEC_RS04065 DNAse

SESEC_RS04270 Competence associated endonuclease

SESEC_RS05625 DNA/RNA non-specific endonuclease

aData information referred to genomic information for Streptococcus equi ssp. 2

zooepidemicus ATCC 35246 (NC_017582.1) in the NCBI database. 3


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

TABLE 3. Primers used in this study 1

Primer Sequence (5ʹ-3ʹ) Restriction

enzyme

Fl-ENucF TCACTGGCTGCTGAGTTTATT

Fl-ENucR CGGCTGAACACGTCCATATAA

Fl-5NucF TCAGTCAAGGTGGGCTTTATC

Fl-5NucR CCACTCTAGGCAACCATCTTC

Fl-Nuc1F GCTTGGGTCTGTATGGGATTAT

Fl-Nuc1R CCACTCTAGGCAACCATCTTC

Fl-Nuc2F CTGGAGTGCTTTCGTCTGTAATA

Fl-Nuc2R TACCAATATGGCGGCATCAG

Fl-Nuc3F GCATTCCTGTGCGGTAATCTA

Fl-Nuc3R CAAATTGGGAGGCAACAAAGAA

Fl-Nuc4F CTTCTAGGCTATGCGCTTGTT

Fl-Nuc4R CTCTCGTTAGCTGCTTGGTTAG

Fl-Nuc5F ATTACCAATCCAGCCAGAAGG

Flu-Nuc5R CAGGTCGCAAGAGGAACAATA

ENucF CGCGGATCCCAGTCTTCAGCTCAGCATGTTTATG BamHI

ENucR GCCCTCGAG G CTTCCTTTCCTGACGTTTCCTA XhoI

ENuc-L-F GCCGGATCCAGCTTAGCTCGTTATGGAAGAGTGT BamHI

ENuc-L-R AAAGAAATCCTTTACTTCCTTTCCTTTGACATAAAAACTCCTTTTTAATG

ENuc-R-F CATTAAAAAGGAGTTTTTATGTCAAAGGAAAGGAAGTAAAGGATTTCTTT


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Restrict enzyme sites were underlined. 3

ENuc-R-R GCCGTCGACTCTACCACGTTTGTAATATGCTTGG SalI

5NucF CGCGGATCCGATCAGGTAGACGTGCAATTTCTTG BamHI

5NucR GCCCTCGAGTTATAAGGCAGCATTAGCTTGCTTT XhoI

5Nuc-L-F GCCGGATCCGGAATAATAAAAGCAATCATACCAC BamHI

5Nuc-L-R

5Nuc-R-F

5Nuc-R-R

GCCGGTTTTATTGGCCTTCCTTTTTAAACAAAATGCTTTTTCATAAACGC

GCGTTTATGAAAAAGCATTTTGTTTAAAAAGGAAGGCCAATAAAACCGGC

GCCGTCGACTCATCGATTGTATGACATCATGAAG

SalI


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

([WUDFHOOXODUQXFOHDVHVRI Streptococcus equi VVS ... · $%675$&7 7KHSDWKRJHQ Streptococcus equi VVS...

Documents

Transcript of ([WUDFHOOXODUQXFOHDVHVRI Streptococcus equi VVS ... · $%675$&7 7KHSDWKRJHQ Streptococcus equi VVS...