Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995...
Transcript of Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995...
![Page 1: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/1.jpg)
Vol. 1, 215-222, February 1995 Clinical Cancer Research 215
Wnt5a Cloning, Expression, and Up-Regulation in Human Primary
Breast Cancers’
Sue Lejeune, Emmanuel L. Huguet,
Andrew Hamby, Richard Poulsom,
and Adrian L. Harris2
Imperial Cancer Research Fund, Molecular Oncology Laboratory,
Institute of Molecular Medicine, John Radcliffe Hospital, Headington,
Oxford, 0X3 9DU, United Kingdom
ABSTRACT
Wnt genes are involved in mouse mammary cancer, but
their role in human cancer is unknown. Human Wnt5a was
cloned from a placental cDNA library and used to assessexpression by ribonuclease protection and in situ hybridiza-
tion in human breast cell lines and in normal, benign, and
malignant breast tissues. Human WntSa shows over 99%
homology at amino acid level with mouse Wnt5a, and 90%with Xenopus Wnt5a. It was expressed only at low levels inbreast cell lines and normal breast tissue. Benign prolifera-
tions and invasive cancer respectively showed 10-fold and4-fold higher Wnt5a than normal breast tissues. The greaterup-regulation in benign conditions suggests a robe in aber-
rant differentiation. In situ hybridization localized the signal
to the epithelial component. Wnt5a is the first member of theWnt family to demonstrate overexpression in human breast
cancer. It was not associated with factors known to affect
breast cancer prognosis such as lymph node status or epi-
dermal growth factor receptor status.
INTRODUCTION
In mouse mammary tumor virus-induced breast cancer,
analysis of insertion sites has shown activation of endogenous
genes, mt genes (1). mt-i (now WntJ) was the first gene isolated
and shows strong homology to a Drosophila developmental
gene, wingless (2), involved in pattern development. Two other
members of this family, Wnt3 and Wnt2 (also called mt-related
protein, irp) are also involved in mouse mammary cancer (3, 4).
Fifteen Wnt genes have been isolated in vertebrates. They
are expressed in many adult and embryonic tissues (5) and are
involved in morphological development. The importance of
their role is reflected by the severity of the phenotypic abnor-
malities that result from aberrant Wnt expression. Thus, Wnt
genes have important roles in development and in cancer.
The role of Wnts in mouse mammary carcinogenesis has
been extensively studied and there is evidence that they are
secreted proteins, processed via the Golgi apparatus (6), which
remain tightly associated with the extracellular plasma mem-
Received 9/23/94; accepted 9/28/94.
, This work was funded by the Imperial Cancer Research Fund and
Oxfordshine Health Authority.2 To whom requests for reprints should be addressed.
brane or matrix (7). Writs produce morphological effects on
some mouse mammary cancer cell lines by transfection in
autocnine (8) and paracrine mechanisms (9).
A survey of expression in normal mouse mammary gland
development showed that some Wnts are expressed in virginal
breast, some in pregnancy, and others in lactation (10). How-
ever, Wntl, which is involved in carcinogenesis is not expressed
in normal mouse mammary tissue. This implicates Writ gene
family members in normal breast development and suggests
aberrant expression of other members can contribute to malig-
nancies (1 1).
Evaluation of the normal expression of Wnt genes in hu-
man breast epithelium and cancer would contribute to under-
standing the role of Wnt genes in human cancer. It has been
shown that some of the Wnt genes are expressed in human breast
tissue, and that quantitative differences exist in the Win expres-
sion profile of normal and proliferative lesions (12).
We chose Wnt5a as a candidate human gene to clone and
evaluate because it is expressed in normal mouse breast epithe-
hum to a low extent, and also in mouse breast cancer cell lines
(10). Furthermore it has some different properties from the
human Wnt genes previously cloned in its effects on cell gap
junctions (13) and Xenopus development (14). Interactions be-
tween Wnt genes with different normal functions may contribute
to malignant transformation (1 1).
MATERIALS AND METHODS
Isolation of 384-Base Pairs Fragment of Human WntSa
from Fetal Brain cDNA Library. Two hundred ng of a
human fetal brain library in plasmid pCDM8 (obtained from Dr.
D. Simmons and Dr. J. Fawcett, Institute of Molecular Medi-
cine, Oxford, United Kingdom) was used as a template for PCR.
Amplification of cDNA was carried out using 500 ng of each of
the degenerate forward (5’-GGGGAATTCCA’�’/GGA”/GTGT/
�AA”/TGT/CCAT3’) and reverse (5’-AAAATCTAGA’�’/
GCA/GCACCA/GTG/GAA3) oligonucleotide primers pre-viously described by Gavin et a!. (5). PCR products were
separated on a 2% agarose gel. Products of the correct size
(predicted from known Writ sequences) were recovered, then
further amplified using the above primers and ligated into the
plasmid pBluescript KS+ (Stratagene). JM1O9 cells were trans-
formed with the reaction products, and the nucleotide sequences
of clones containing inserts of correct size were determined by
dideoxy chain termination sequencing. Clones with significant
homology to known Wnts were identified using the FASTA
program (GCG) and included one clone containing a 384-base
pair fragment of human Wnt5a.
Isolation of Human Wnt5a from Placental cDNA Li-
brary. Replica colony lifts of approximately i0� recombinant
clones of a human placental library in the plasmid pCDM8 were
prepared using Hybond-N membranes (Amersham). The mem-
branes were hybridized to a Wnt5a probe synthesized using the
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
![Page 2: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/2.jpg)
216 Wnt5a Up-Regulation in Human Breast Cancer
384-base pair fragment isolated as described above. The probe
was generated by incorporating [a-32PJdCTP (Amersham) in a
PCR amplification of the 384-base pair fragment using the
above degenerate primers. The resultant species were end filled
and separated from unincorporated nucleotides by passage
through a Sephadex G-50 spin column (Boehninger Mannheim).
After hybridization of the probe to the membranes, positive
clones were identified by autoradiognaphy, and subjected to
further rounds of screening. After four rounds of screening,
positive clones were selected and sequenced. Clones with sig-
nificant homology to known W,its were identified and included
one containing 798 base pairs of the 3’ end of the human Wnt5a
cDNA as well as some 3’ untranslated sequences.
Further sequence 5’ to the 798-base pair 3’ terminus was
obtained using a nested PCR strategy. A primary PCR reaction
was carried out using 200 ng of a placental cDNA library in
pCDM8 as template. The primers used were a mouse Wnt5a-
specific forward primer FPI (5’-ATGAAGAAGCCCATTG-
GAATA-3’) corresponding to the 21 extreme 5’ nucleotides of
mouse Wnt5a, and a human Wnt5a-specific reverse primer RPI
(5 ‘-GCACGCCCGGCTCATGGCGTF-3 ‘) corresponding to a
known sequence in the 798-base pair partial clone. Fragments of
correct size (approximately 462 base pairs) were recovered and
used as template for nested PCR. In the nested PCR reaction the
forward and reverse primers (FP2 and RP2) were 3’ and 5’ of
the primers FP1 and RP1, respectively. Primer FP2 (5’-
AANTCNTGGTGGTCNCTNGG-3’) was a fully degenerate
primer, and primer RP2 (5’-GTGTI’ATCCACAGTGCT-3’)
was a human Wnt5a-specific primer corresponding to the ex-
treme 5’ region of the 798-base pair partial clone. Fragments of
correct size (approximately 234 base pairs) were recovered,
subcboned into plasmid pBluescnipt 5K, and sequenced. Clones
with significant homology to Wnt5a were identified and in-
cluded one containing 234 base pairs of human Wnt5a sequence
5’ to the 798-base pair partial clone.
A nested PCR strategy was also used in order to clone the
extreme 5’ region of Wnt5a. In a primary PCR reaction, 200 ng
of human placental cDNA library in pCDM8 was used as
template. The primers used were a pCDM8-specific primer and
the human Wnt5a-specific internal primer RP1. Products of a
large enough size to contain the 5’ end of Wnt5a were recovered
and used as template in the nested PCR. In the nested PCR
reaction, primers FP1 and RP2 were used. Fragments of correct
size (approximately 366 base pairs) were recovered, cloned into
TA cloning vector (Invitrogen), and sequenced. A clone con-
taming the 5’ end of Wnt5a was identified. Thus the sequences
of the original 798-base pain partial clone and the two nested
PCR products combined to give the full-length sequence.
Chromosomal Localization of Human Wnt5a. Twen-
ty-jig DNA samples from a panel of human-rodent hybrid cell
lines, and control human, mouse, and hamster DNA (obtained
from Dr. N. Spurn, Imperial Cancer Research Fund, London,
United Kingdom) were digested with EcoRI, fractionated on a
0.7% agarose gel, and transferred to Hybond-N membranes
according to Southern’s protocol (15). The membranes were
then hybridized to a random primer generated [a-32P]dCTP-
labeled probe, using a 1.4-kilobase XbaI fragment of the original
(placental) partial human Wnt5a clone as template. Signals were
detected by autoradiography.
Ribonuclease Protection Assays. Ribonuclease protec-
tion assays were carried as described in Ref. 16. Briefly, a
384-base pair fragment of human Wnt5a was cloned into pBlue-
script KS. The EcoRV linearized plasmid was used to generate
antisense [a-32P]CTP-labeled probes with T7 RNA polymerase
(Gibco). Probes were hybridized to 10-jig samples of total RNA
extracted from tissues and cell lines by a single-step extraction
method (17). Hybridization was carried out at 45#{176}Cfor 16 h.
Each hybridization also contained an antisense probe for
GAPDH3 as a loading control. GAPDH probes were prepared
from a 120-base pain b fragment of GAPDH cloned into pBlue-
script 5K (18). Unhybridized probe was digested with RNase A
and Ti, and protected fragments were electrophoresed on poly-
acrylamide gels. Dried gels were autoradiographed.
Image Analysis. Autoradiographs of nibonuclease pro-
tection assays were scanned using a Bio-image analyser (Milli-
gan Bioresearch) to determine RNA abundance. Wnt5a values
were normalized to GAPDH to allow for loading. MCF1O RNA
was included in all assays as a positive control. This was
assigned a unit level of expression and all other values were
standardized to this.
Cell Lines. The following breast cell lines were obtained
from ATCC (Bethesda, MD): T47D (ATCC HTB 133),
MDA231 (ATCC HTB26), MCFJO (ATCC CRL1O3I7),
MDA415 (ATCC HTB128), MDA453 (ATCC HTBI31),
MDA157 (ATCC HTB24), BT2O (ATCC HTB19), SKBR3
(ATCC HTB3O). ZR9B1 1 (ZR-75-1), ZR4, and ZR1 1 were
obtained from Dr. E. Valvenius (Department of Pathology, Uni-
versity Hospital, Uppsala, Sweden). MCF7s were obtained from
Dr. B. Durkacz (Cancer Research Unit, University of Newcastle
upon Tyne). Adniamycin-resistant MCF7s were obtained from
Dr. K. Cowen (National Institutes of Health). Lines 2-5-2a,
3-4-1, 5-3-1, 6-1-1, MTSV1-7, and MTSV4-1 were obtained
from Dr. J. Taylor (Imperial Cancer Research Fund, London,
United Kingdom).
Cell Culture. T47D, MDA23I, MCF1O, MDA453,
SKBR3, MCF7, Adniamycin-resistant MCF7, ZR9B1 1, ZR4,
and ZR1 1 were maintained in DMEM with 10% FCS. BT2O was
maintained in Eagle’s MEM supplemented with 15% FCS and 2
mM glutamine. MDA4I5 was maintained in DMEM, iS% FCS,
1 jiM hydrocortisone, 10 jig/mI insulin, and 10 jig/mb glutathi-
one. MDA1S7 was maintained in RPMI 1640 and 10% FCS.
MTSV1-7, MTSV4-l, 2-5-2a, 3-4-1, 5-3-1, and 6-1-1 were
maintained in DMEM: Ham’s F12 (i:1), 10% FCS, 10 jig/mb
insulin, and 5 jig/ml hydrocortisone. All cultures were grown on
plastic dishes in 5% CO,-95% air in humidified incubators. All
cultures were free of Mvcoplastna.
Handling of Clinical Samples. Protocols for handling of
clinical samples and assays for hormone and growth factor
receptors were followed as detailed in Leieune et a!. (19).
Briefly, Tumors were considered to be ER positive if they
contained at least 10 fmol of specific binding sites per mg of
cytosolic protein, and EGFR positive if they contained at least
3 The abbreviations used are: GAPDH, glycenaldehyde-3-phosphate de-hydnogenase; ER, estrogen receptor; EGFR, epidenmal growth factor
receptor; ATCC, American Type Culture Collection.
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
![Page 3: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/3.jpg)
FPI
ataaaaaaacccattaaaatattaagcccaggagt’ gctttggggatggctggaagtgca
H K K P I G I L S P 1 V /, L G M A (�. S A
atgtcttccaagttcttcctagtggctttggccatatttt tctccttcgcc-aggt tqta61 � , , +.------, 121)
M S S K F F L V A L A 1 F F S F S Q 2 V
FP2
attgaagccaattcttaataatcactaacitatgaataaccctgttcagatgtcagaaqt a
121 + , ,
I K A N S W W S L G H N N P V Q M S F
tatattataggagcacagcct ctctgcagccaactggcaggactttctcaaggacaqaag
181 ‘ --‘ + ‘ + ‘ 245
Y I I S A Q 1’ L C S Q L A G L S 0 5 Q F
241 - ‘ - i.
K L C H L V Q 1) H N Q S : C E C A K V -
SF2
atcaaagaatgccagtatcadt tccgacatcgaaggtggaactgca�cacLaLauata�c
301 � --� ,--- �------ ‘
I F F C 0 5 0 F H H P Is W N C S T .‘ II 1
�(ctgtttttggcagggtqatg(aqataggcagccgcgagacggccttcacara� I
361 --- --- - -,-------, -- -4VT 2 V F G S �.-‘ H� (I � � 5 5 F S A F 2 5 1
gtuaqcqcagcaggggtggt9aacQCCat0aQCCUQUCatUCCgCgagggCq4gCt� 1
421 --- -----‘ ---: :- A A G ‘.‘ 2 1. 5 ‘� 5 15 A C H F C 51:.��
20 fmol of specific binding sites per mg of membrane protein.
Human tissue samples were selected to represent normal breast
tissue, benign breast disease, and breast cancer.
In Situ Hybridization. A single-stranded antisense RNA
probe to Wnt5a was transcribed from EcoRI-linearized Wnt5a
DNA using T3 DNA polymerase (Promega), and 35S-UTP
(-800 Ci/mmol; Amersham International) as the sole source of
UTP. Histological sections of human tissues that had been fixed
in neutral-buffered formalin and embedded in paraffin wax were
treated in the manner described by Senior et a!. (20) with minor
modifications. In summary, 1 X 10#{176}�cpm of unhydrolyzed probe
in 10 ml buffer was hybridized overnight at 55#{176}Cto sections
permeabilized with proteinase K. Posthybnidization steps in-
cluded several large volume washes in a 50% formamide buffer
at 55#{176}Cto remove unhybrized probe, RNase A treatment to
digest single-stranded and imperfectly hybridized domains, and
extensive washing to remove these cleaved fragments were
performed. The final washes were in 0.SX SSC (1X SSC is
0.15 M NaC1 and 0.015 M sodium citrate) at 65#{176}Cfor 30 mm twice.
Slides were dehydrated and processed for autoradiography (Ilford
K2) at 4#{176}Cfor 7 to 10 days. Latent images were developed with
Kodak D-19, and sections were Giemsa counterstained.
The �3-actin mRNA was used as a positive control for the
presence of mRNA species, as described previously by Wright
et a!. (21). Labeled Wnt5a sense transcripts were used as con-
trols for nonspecific niboprobe binding.
RESULTS
Isolation of WntSa cDNA. A partial length cDNA was
initially isolated by using PCR primers to homologous domains
in Wnt genes. This was used to isolate a cDNA from a human
placental library, which, in combination with nested PCR prod-
ucts from the same library provided the full human Wnt5a
cDNA coding sequence shown in Fig. 1 with the corresponding
amino acid sequence. The sequence comparison of human
Wnt5a with mouse and Xenopus Wnt5a shows extensive con-
servation with amino acid level homology of 99% and 90%,
respectively.
Chromosomal Localization of Wnt5a. The chromo-
some location of the human Wnt5a was determined by screening
hamster-human and mouse-human hybrid cell lines which had
known human chromosome karyotypes. Southern blotting
showed a Wnt5a signal located on human chromosome 3 (Fig.
2), which was absent in a mouse-human hybrid cell line carrying
a p1 1 to p terminus deleted chromosome 3 (data not shown).
This suggests that Wnt5a is on chromosome 3p.
Expression of Wnt5a in Human Breast Cell Lines. To
assess expression in human breast cancer, a panel of human
breast cell lines was initially analyzed, since they represent a
pure epithelial population. Cell lines from normal breast duct
luminal epithelium, benign epithelial proliferation, and in situ or
invasive components of breast epithelium were studied (Table 1
and Fig. 3). Levels of expression measured by nuclease protec-
tion assays were low, requiring 7 days of development. One line
from luminal epithelium had higher levels (MTSV1-7) than the
others.
Cell lines established from malignant pleural effusions and
metastasis had lower levels than the luminal cell line MTSV1-7
481 . -. 54)
S C V C S H A A H P K 1) 1. 1 5 1) W 1 H
ggctgcggcgacaacatcqaCtatggctacCgCtttgCCaaqgagttCgtggaCgCc:3
541 + --‘-- ‘ -------‘ + 15_la
G C G D N I 1) Y (1 5 5 F A K F F V D A F
gagcgggagcgcat ccacgccaacqqct cIt acgagagt gct cgcat cct cat qaa as
601 -- ------‘ _-_-- � ,E P E F I H A K S V F S A P 1 F H N
ca�aacaa cgaggccggccgcaggaCggtgtaCaacctggctgatgtggcc�gcsa4t4C
661 - -----‘-- -‘ ---‘ --- 7,)))
H N N K A C) P P T V V N L A D V A C K C
catqgggt gt ccggctcatgt agcctgaagaCatgctggctgcagctqgCagacttCcq(
721 ----� ----- --� 7817
H (7 � S S S C S S K T C N L Q 1 A S F F
aaggtgggtgatgccctgaaggagaagtacgacagcqcggcggcCatgCggctcaacagc
781 �----------‘------ +- , 845
K V C D A L K E K Y D S A A A M S L N 77
cggggcaagt tggtacaggtcaacagccgct tcaactcgcccaccacacaagacctggtc841 �-- #{149}- - -, ca:
S G K L V Q V N S S F N S P T T Q S 1. V
tacat cgaccccagcCCtgaCtaCtgCgtgcgCaatgagagCaccggct cgctq5gcacg
901 ---- ----‘ ‘ ‘--- ---- . 1131)
V I [3 F S P D S C V P N F S I 77 77 1. 77 1
in all but one case (BT2O). Thus, in vitro cell lines rarely
expressed Wnt5a.
Expression in Human Breast Tissue. Expression was
then studied in normal breast tissue, tissue from benign breast
diseases, and primary breast cancers. The clinical details of the
patients (e.g., age, tumor receptor status) are given in Table 2.
Clinical Cancer Research 217
cagggccqcctgtgCaaCaag8CgtCggagggCatggatggCtqC�3dqCt catgtgctgc
961 ‘ ‘ -‘--- ----‘ a::Q G S L C N K T S K C M D G C F: :. 0 C C
ggccgtggctaC9dCCagttC8agaCCgtgCag8CggagCgCtqCC.�Ct 3caaqt tccac
1021 -‘ ‘
G R G V 0 0 F K T V Q T 0 5 C H C K F H
tggtgccgctaCgtCaagtgCaagaagtgCaCggagatCgtggaCC�gL’JtgtgtgCdag
1051 + + . 141)
w C C Y V K C K F C T E I V D �) F � C F
tag1141 ---1143
Fig. I Nucleotide sequence of human Wnt5a. The location of PCR
primers FP1, FP2, RP1, and RP2 are underlined. Predicted amino acid
sequence shown below nucleotide sequence. Conserved cysteine resi-
dues are shown in bold. �, stop codon.
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
![Page 4: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/4.jpg)
Table I Comparison of Wnt5a expression in breast cell lines derived
from ductal epithelium, in situ and invasive components of breast
carcinoma, and breast cancer metastases
Cell line
Expression
standardizedType to MCF1O
MCFIOZR9B1I
ZR1IZR4T47D
MCF7MDA231MDA415
MDA453
MDAI57
BT2O
SKBR3Adniamycin-resistant
MCF7
2-5-2A
3-4-I
5-3-I
6-1-I
MTSV1-7
MTSV4-1
Immortal nonmalignant
ER+ breast cancer
ER+ breast cancerER + breast cancer
ER+ breast cancerER+ breast cancerER- breast cancerER- breast cancerER- breast cancer
ER- breast cancerER- amplified EGFnER- amplified erbB-2Drug-resistant MCF7
Derived from benign
component of breastDerived from in situ component
Derived from in situ component
Derived from in situ component
Luminal normal cells, SV4O
immortalized
Luminal normal cells, SV4O
immortalized
Normal tissues (n = 15) were obtained either from reduction
mammoplasties (n = 7), or from normal tissue adjacent to
tumors (n = 8). Benign breast disease samples consisted of
fibroadenomas (n = 5), fibrocystic disease (n = 3), and benign
218 Wnt5a Up-Regulation in Human Breast Cancer
ahcdefghijklmnopqrl23
..otr . I
Fig. 2 Southern blot of human-rodent hybrid cell lines with human Wnt5a probe. Lane 1, human genomic DNA; Lane 2, mouse genomic DNA; Lane
3, hamster genomic DNA. Lanes a-r, DNA from hybrid human-rodent cell lines, each beaning human chromosome DNA. Lanes: a, chromosome 1;
b, chromosome 2; c, chromosome 3; d, chromosome 5; e, partial chromosome 6;f, chromosome 7; g, chromosome 8; h, chromosome 9; i, chromosome
I 1 ; j, chromosome 12, k, chromosome 13; 1, chromosome 14; m, chromosome 15; n, chromosome 16; o, chromosome 17; p, chromosome 19; q,chromosome 20 and partial 4; r, chromosome 21. Arrows in Lanes I and c, signal for human genomic DNA (Lane 1) corresponds to that in Lane
F’, i.e. , chromosome 3. The absence of Wnt5a signal in a human-mouse hybrid cell line carrying a p terminus deleted chromosome 3 (data not shown)
suggests that Wnt5a is on human chromosome 3p.
phyllode tumors (n = 2). Tumors (n = 28) were selected to
represent different subgroups according to known prognostic
factors (node, ER, and EGFR status). In contrast to the cancer
cell lines, Wnt5a was commonly expressed in primary breast
cancer (Fig. 4). Comparing normal breast tissue to tumor tissue
I showed levels that were 4-fold higher on average in the latter0 (Table 2). Ten of 28 tumors had levels higher than the highest
expression in the cell lines from normal breast tissue. Thus, the
<1 cell lines reflected normal breast expression, but not tumor0 levels. Tumor levels were significantly greater than normal
� tissue levels (P 0.0004, Mann-Whitney U test).
0 Benign breast tissue also showed much higher expression
< I than normal breast tissues, similar to and often greater than0 levels in many of the tumors. Two different types of benign
?8 breast disease were studied: fibroadenomas and fibrocystic dis-<1 ease. The former is a benign lesion involving epithelial and
< 1 stromal elements. The latter is a nontumorous collection of cysts
and ducts with some epithelial hyperplasia. In both types of0 benign breast disease there was high expression of Wnt5a (Fig.
1 � nuclease protection). Benign levels were significantly greater1 than those of normals (P = 0.0012 Mann-Whitney U test) and
<1 also than those of tumors, although to a smaller extent (P =
5 0.03).
< 1 In situ hybridization using the Wnt5a probe was carried out
to assess localization of expression. This showed that levels
were low and difficult to detect in normal breast but were
detectable in a few ducts and lobules. In some larger ducts the
mRNA appeared to be expressed in luminal cells but not the
myoepithelial population. In fibroadenomas there was high ex-
pression in the epithelial component uniformly throughout the
tumor (Fig. 5, a and b). In fibrocystic disease it was again
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
![Page 5: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/5.jpg)
wnt5a
gapdh
Clinical Cancer Research 219
ab c de f gh i j k 1 mnop q r s
v- �
-�-
LT:____a.____A
-�
A
--_�w-�--�
�.� � A �-A..
Fig. 3 RNase protection assay on cell lines. Wnt5a and GAPDH signals are shown. Lanes a-f, human mammary epithelial cell lines; Lanes g-s, human
breast cancer cell lines. a, 2-5-2a; b, 3-4-1; c, 5-3-1; d, 6-1-1; e, MThV1-7;f, MRSV4-1; g, MCF1O; h, ZR1 1; i, ZR4;j, MDA41S; k, MDA4S3; I, MDA4S7;m, BT2O; n, SKBR3; o, Adniamycin-resistant; p, MCF7; q, AR9B11; r, T47D; s, MDA231.
Table 2 Wnt5a expression assayed by RNase protection in humanbreast cancer
Sample Type
Normal
Benign Tissue PrimaryTotal (a = 10) (a 15) (n - 28)
Age (yr)Mean 49 39 42 56SE 2.13 3.1 4.8 2.3
Median 49 38 46 57Min,a max 18, 86 25, 52 18, 78 32, 86
Wnt5a
(RNA units)Mean 7.1 18.7 1.5 5.9SE 10.4 17.2 1.5 6.4Median 3.0 11.5 1.0 4.0Mm, max 0, 45 0, 45 0, 5 0.5, 31
ER (fmol/mg)cytosol
protein
Mean 128SE 168
Median 50.5Mm, max 3, 695
EGFR (fmol/mg)membraneprotein
Mean 29SE 27Median 25Mm, max 0, 127
Node statusPositive 11
Negative 15
a Mm, minimu m; max, maximum.
expressed in the epithelial component (Fig. 5, c and d). Simi-
larly, in the malignant tumors (Fig. 5, e and f) Wnt5a was
expressed within the epithelial element of the tumor and in
clumps of invading cells throughout the stroma. There was no
increased localization at the invading edge. The sense Wnt5a
probes used as controls for nonspecific hybridization showed a
uniform and low background signal (data not shown).
Thus, in many cases of benign breast proliferation and
breast cancers. Wnt5a is overexpressed in the epithelium. This
was not due to gene amplification since Southern blots of the
high-expressing cases showed no evidence of this (data not
shown).
Features of carcinomas known to relate to tumor phenotype
were compared with Wnt5a expression. There was no correba-
tion of either ER or EGFR with Wnt5a expression (P = 0.3 and
0.5, respectively, Spearman’s rank correlation coefficient; Table
2), nor was there a correlation with node status (P = 0.1). There
was no association with menopausal status, as indicated by age
>50 years or <50 years old (Table 2). ER and EGFR were
inversely related to each other, as previously reported (Ref. 22;
P = 0.005, Spearman’s rank correlation coefficient). ER was
related to age and EGFR inversely as has been described before
(Ref. 22; P = 0.0007 and 0.036, respectively, Spearman’s rank
correlation coefficient).
In relation to patient age, there was no significant differ-
ence between normal and benign samples but the primary cancer
patients were significantly older than the normal (P = 0.02) and
benign (P = 0.0013) samples. However the differences in
Wnt5a expression between the samples cannot be a function of
the different age distributions, as Spearman’s rank correlation of
Wnt5a with age as a continuous variable shows no correlation
(P = 0. 1 1). Furthermore the group of tumors which overlap the
normal and benign samples in age (n = 9, age <52 years) have
no different a level of Wnt5a than those which are older (n = 19,
age >52 years, P = 0.86). Also, the differences in the level of
Wnt5a between normal samples and cancers are maintained
whether the cancer patients considered are over or under 52
years of age. Thus, the significant differences in Wnt5a expres-
sion seen between the groups are not related to age distribution
differences.
DISCUSSION
The human Wnt5a gene shows marked homology to other
species including mouse (23) and Xenopus (24). This is char-
acteristic of all of the Wnt family members which are highly
conserved (25). They show greater homology to the family
member in different species than to other family members
expressed in the same species. Wnt5a is located on the terminal
region of chromosome 3 beyond the 3pl 1 band, whereas mouse
Wnt5a is on chromosome 14. However, human chromosome 3 is
syntenic with mouse chromosome 9, suggesting chromosomal
rearrangements at this locus during evolution. The region
3p2l-25 is known to be involved in loss of heterozygosity in
human cancer (26), including 30% of breast cancers (27). How-
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
![Page 6: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/6.jpg)
I.
.- . 5.. ‘ %_�� . a,
. -:
. . - .
� - . ,�;a.. �
220 Wnt5a Up-Regulation in Human Breast Cancer
NOFfl11II
Benign
gap
gap - �--
.4
Fig. 4 RNase protection assay
on human breast tissues. Wnt5a
and GAPDH signals are shown
for 15 normal breast tissue sam-
ples, 10 samples of benign dis-
ease, and 21 of the 28 tumors
examined (data for remaining 7tumors not shown in this figure
but included in Table 2).
�sIaIignant5 a -�-�-� � _.
gapw
-. --
_,�_� ‘..� -� � �
� ___Fig. 5 In situ hybridization of Wnt5a in human breast tissues, a, fibroadenoma, light field; b, fibroadenoma, dark field; c, fibrocystic disease, light
field; d, fibnocystic disease, dank field; e, carcinoma, light field; f, carcinoma, dark field. e, epithelial component; s, stroma; c, carcinoma.
ever, the work of Clark et a!. (28) suggests that Wnt5a is outside
this region and therefore not the gene involved.
During the course of this work, the isolation of overlapping
clones was reported giving the total sequence of the human
Wnt5a cDNA isolated from a human fetal fibroblast library. We
have similarly cloned overlapping clones from a human placen-
tab library. Our results independently confirm the sequence
published by Clark et a!. (28), as well as the chromosomal
localization of the gene. Our sequence differs from that of Clark
ci a!. (28) at a few nucleotides but these do not give rise to
amino acid differences.
Expression was studied in a range of human breast cancer
cell lines representing ER-positive and -negative types as well
as those having amplification of EGFR or erbB-2. With the
exception of BT2O, expression in the cell lines was very low
with levels similar to or lower than those found in normal
tissues. The breast cancer cell line BT2O showed high wnt5a
expression, similar to the elevated levels found in benign pro-
liferative lesions. In the mouse, Wntl expression in mammary
epithelium produces abnormal morphology in a hormone-inde-
pendent fashion (29). In relation to this, the level of expression
of Wnt5a in breast cancer cell lines appears unrelated to hor-
mone receptor status.
In tissues, Wnt5a expression was generally higher than that
in cell lines. Benign and malignant proliferative lesions of the
breast respectively showed levels of Wnt5a 10-fold and 4-fold
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
![Page 7: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/7.jpg)
Clinical Cancer Research 221
4 T. Bui, E. Huguet, and A. L. Harris, unpublished data.
higher than those in normal tissue. In the mouse Wnt5a is
expressed in normal breast tissue and its regulation has been
studied over a short period of reproductive history (10). Wnt5a
is present in early pregnancy but is undetectable by day 17.5 of
pregnancy. It is clearly difficult to reproduce such studies in
humans, but our results suggest that human breast tissue gener-
ally resembles that of the mouse in its expression of Wnt5a,
although no major endocrine effects involving steroid hormones
were demonstrated in that pre- and postmenopausal breast levels
were no different in any of the patient groups. This does not,
however, exclude pregnancy-specific regulation events. Wnt5a
was highest in the benign proliferative lesions, and analysis in
human breast cancer showed up-regulation of Wnt5a in 10 of 28
carcinomas above the highest level in normal breast tissues. The
up-regulation was not due to gene amplification in the breast
cancers and may therefore be related to transcriptional activa-
tion or RNA stabilization. The elevated level of Wnt5a is inde-
pendent of several other factors known to affect prognosis or
biology of human breast cancer such as EGFR and estrogen
receptor. In order to understand further the basis of up-regula-
tion of Wnt5a in human breast disease, human breast cell lines
transfected with a panel of oncogenes and cultured in different
extracellular matrices have been studied for regulation of
Wnt5a. There is evidence that Wnt5a is up-regulated severalfold
in these circumstances.4 Thus, Wnt5a may be secondarily reg-
ulated in response to a range of other genetic changes. Since
Wnts have recently been shown to modulate cell adhesion by
regulation of cadherins, it is possible that Wnt5a may also
contribute to this mechanism of regulation of growth and dif-
ferentiation.
In the mouse, Wnts have a role in the development of
normal mammary tissue, and aberrant Wnt expression can con-
tribute to mammary hyperplasia and mammary carcinomas.
Drawing a parallel between these observations and human
Wnt5a, the expression of the gene in normal breast suggests that
it has a role in this tissue, and its aberrant expression is associ-
ated with proliferative lesions or aberrant differentiation as in
fibroadenomas and fibrocystic disease. Olson and Papkoff (30)
have reported that the level of Wnt5a expression is inversely
related to the proliferative rate of the mouse mammary epithelial
cell line C57MG in vitro. Although this munine result cannot
necessarily be extrapolated to the human situation, it argues
against Wnt5a having a simple growth promoting role in the
benign and malignant lesions we analyzed. Thus, Wnt5a is
expressed at its highest level in benign disease, although it is
also elevated in cancer. It is possible that high Wnt5a expression
occurs at certain stage of normal differentiation, and that cells
blocked in this phase show the observed regulation. Olson and
Papkoff (30) have shown that in the mouse mammary epithelial
cell line C57MG, transfection of Wntl and Wnt2 causes a
30-fold reduction in the expression of endogenous Wnt4 and a
smaller decrease in the expression of Wnt5a. Thus, it is possible
that Wnt5a itself may interfere with the function of other Wnts
in human breast tissue where it is overexpressed.
To assess localization of Wnt5a, in situ hybridization was
carried out on normal tissues, fibrocystic disease, fibroadeno-
mas, and carcinomas. In normal tissues, the level of expression
was generally too low to detect above background, but could be
seen in a few ducts. In fibrocystic disease, fibroadenomas, and
carcinomas Wnt5a was expressed in epithelium. In some cases
it was possible to clearly resolve the basal myoepithelial layer of
the breast from the luminal epithelium and Wnt5a was expressed
in the luminal cell layer.
In fibroadenomas stromal cells are present in a much
greater proportion than in normal epithelium. Dilution of RNA
from the epithelium by matrix and stromal cells shows how high
the level of RNA must be in the fibroadenoma epithebium
compared to normal tissue epithelium. It is possible that the
stromal cells are involved in regulation of Wnt5a expression in
the epithelium or conversely that Wnt5a expression effects
stromal growth. Coculture of luminal cells with stromal cells to
measure Wnt5a regulation would be helpful to assess the role of
such stromal epithelial interactions.
The up-regulation of Wnt5a in both benign and malignant
proliferative disease of the breast suggests an important role of
Wnt genes in breast pathology. Wnt5a is the first member of the
family to demonstrate up-regulation in human breast cancer.
Cell lines established from benign or normal tissues may be
suitable models for further evaluation of the role of Wnt5a to
assess its regulation under variable growth and differentiation
conditions.
REFERENCES
1. Nusse, R., vanOoyen, A., Cox, D., Fung, Y. K., and Varmus, H.Mode of provinal activation of a putative mammary oncogene (mt-i)
oncogene promoter and its mechanism of activation by insertion ofproviral DNA of the mouse mammary tumour virus. Mol. Cell. Biol.,
10: 4170-4179, 1984.
2. Rijsewijk, F., Schuermann, M., Wagenaar, E., Parren, P., Weigel, D.,
and Nusse, R. The Drosophila homolog of the mouse mammary onco-gene mt-i is identical to the segment polarity gene wingless. Cell, 50:
649-657, 1987.
3. Roelink, H., Wagenaar, E., Lopes, d. S. S., and Nusse, R. Wnt-3, a geneactivated by proviral insertion in mouse mammary tumors, is homologous
to int-1/Wnt-l and is normally expressed in mouse embryos and adult brain.
Proc. Natl. Acad. Sci. USA, 87: 4519-4523, 1990.
4. Roelink, H., Wagenaar, E., and Nusse, R. Amplification and provinal
activation of several Wnt genes during progression and clonal variation
of mouse mammary tumors. Oncogene, 7: 487-492, 1992.
5. Gavin, B. J., McMahon, J. A., and McMahon, A. P. Expression ofmultiple novel Wnt-1/int-I-related genes during fetal and adult mousedevelopment. Genes Dev., 4: 2319-2332, 1990.
6. Papkoff, J., Brown, A. M., and Vanmus, H. E. The mt-i protoonco-gene products are glycoproteins that appear to enter the secretory
pathway. Mob. Cell. Biol. 7: 3978-3984, 1987.
7. Smolich, B. D., McMahon, J. A., McMahon, A. P., and Papkoff, J.
Wnt family proteins are secreted and associated with the cell surface.Mol. Biol. Cell, 4: 1267-1275, 1993.
8. Blasband, A., Schryver, B., and Papkoff, J. The biochemical prop-erties and transforming potential of human Wnt-2 are similar to Wnt-1.Oncogene, 7: 153-161, 1992.
9. Jue, S. F., Bradley, R. S., Rudnicki, J. A., Varmus, H. E., and Brown,A. M. The mouse Writ-i gene can act via a paracnine mechanism intransformation of mammary epithelial cells. Mol. Cell. Biol., 12: 321-
328, 1992.
10. Gavin, B. J., and McMahon, A. P. Differential regulation ofthe Wnt
gene family during pregnancy and lactation suggests a role in postnatal
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
![Page 8: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/8.jpg)
222 Wnt5a Up-Regulation in Human Breast Cancer
development of the mammary gland. Mol. Cell. Biol., 12: 2418-2423,
1992.
I 1. Buhlen, T. A., Dale, T. C., Kieback, C., Humphreys, R. C., and
Rosen, J. M. Localization and quantification of Wnt-2 gene expression
in mouse mammary development. Dcv. Biol., 155: 87-96, 1993.
12. Huguet, E. L., McMahon, J. A., McMahon, A. P., Bicknell, R., and
Harris, A. L. Differential expression of human Wnt genes 2, 3, 4, and Th
in human breast cell lines and normal and diseased states of human
breast tissue. Cancer Research, 54: 2615-2621, 1994.
13. Olson, D. J., and Moon, R. T. Distinct effects of ectopic expression
of Wnt-1, activin B, and bFGF on gapjunctional permeability in 32-cell
Xenopus embryos. Dev. Biol., 151: 204-212, 1992.
14. Moon, R. T., Campbell, R. M., Christian, J. L., McGrew, L. L.,
Shih, J., and Fraser, S. Xwnt-SA: a maternal Wnt that affects morpho-
genetic movements after ovenexpression in embryos of Xenopus !aevis.
Development, 119: 97-1 1 1, 1993.
15. Southern, E. M. Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J. Mol. Biol., 98: 503-517,
1975.
16. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman,
J. G., Smith, J. A., and Stnuhl, K. Current Protocols in Molecular Biology,Vol. 1, pp. 4.7.1-4.7.8. New York: Green Publishing Associates and Wiley
Interscience, 1991.
17. Chomczinski, P., and Sacchi, N. Single step isolation of RNA by
acid guanidium thiocyanate-phenol-chbonoform extraction. Ann. Bio-
chem., 162: 321-328, 1987.
18. McCarthy, S., and Bicknell, R. Responses of pertussis toxin treated
microvasculan endotheliab cells to transforming growth factor �3. J. Biol.
Chem., 267: 21617-21622, 1992.
19. Lejeune, S., Leek, R., Horak, E., Plowman, G., Greenall, M., and
Harris, A. L. Amphiregulin, EGF receptor, and estrogen receptor in
human breast cancer. Cancer Res. 53: 3597-3602, 1993.
20. Senior, P. V., Cnitchley, D. R., Beck, F., Walker, F. A., and Varley,
J. M. The localization of lamini mRNA and protein in the postimplan-tation embryo and placenta of the mouse: an in situ hybnidisation and
immunocytochemical study. Development, 104: 431-446, 1988.
21. Wright, N. A., Poubsom, R., and Stamp, G. W. Epidermal growth
factor receptor induces expression of regulatory peptides in damaged
human gastrointestinal tissue. J. Pathol., 162: 279-284, 1990.
22. Fox, S. B., Smith, K., Hollyer, J., Greenall, M., Hastnich, D., andHarris, A. L. The epidermal growth factor receptor as a prognostic
marker: results of 370 patients and review of 3009 patients. Breast
Cancer Res. Treat., 29: 41-49, 1994.
23. Gavin, B. J., McMahon, J. A., and McMahon, A. P. Expression of
multiple novel Wnt-1/int-I-related genes during fetal and adult mouse
development. Genes Dcv., 4: 2319-2332, 1990.
24. Christian, J. L., Gavin, B. J., McMahon, A. P., and Moon, R. T.
Isolation of cDNAs partially encoding four Xenopus Wnt-1/int-1-related
proteins and characterization of their transient expression during em-
bryonic development. Dev. Biol., 143: 230-234, 1991.
25. Sidow, A. Diversification of the Wnt gene family on the ancestral
lineage of vertebrates. Proc. Nail. Acad. Sci. USA, 89: 5098-5102, 1992.
26. Mastro, R., Gasparotto, D., Vukosavljevic, T., Barzan, L.,
S., and Boiocchi, M. Three discrete regions of deletion at 3p in head andneck cancers. Cancer Res., 53: 5775-5779, 1993.
27. Callahan, R., Cropp, C., Menlo, G., Campbell, G., and Lidereau, R.
Mutations in breast cancer. In: The Therapeutic Implications of the
Molecular Biology of Breast Cancer, pp. 57-67. Rome: John LibbeyCIC, 1991.
28. Clark, C. C., Cohen, I., Eichstetter, I., Cannizzano, L. A., McPher-son, J. D., Wasmuth, J. J., and lozzo, R. V. Molecular cloning of the
human proto-oncogene Wnt-SA and mapping of the gene (WNT5A) to
chromosome 3pl’4-p2l. Genomics, 18: 249-260, 1993.
29. Lin, T. P., Guzman, R. C., Osborn, R. C., Thordarson, G., and
Nandi, S. Role of endocrine, autocnine, and paracnine interactions in the
development of mammary hyperplasia in W,,t-1 tnansgenic mice. Cancer
Res., 52: 4413-4419, 1992.
30. Olson, D., and Papkoff, J. Regulated expression of Wnt family
members during proliferation of C57mg mammary cells. Cell Growth &
Differ., 5: 197-206, 1994.
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
![Page 9: Wnt5a Cloning, Expression, and Up-Regulation in Human ... · Vol. 1, 215-222, February 1995 Clinical Cancer Research 215 Wnt5a Cloning, Expression, and Up-Regulation in Human Primary](https://reader033.fdocuments.in/reader033/viewer/2022041922/5e6c912e30709756f07b87eb/html5/thumbnails/9.jpg)
1995;1:215-222. Clin Cancer Res S Lejeune, E L Huguet, A Hamby, et al. breast cancers.Wnt5a cloning, expression, and up-regulation in human primary
Updated version
http://clincancerres.aacrjournals.org/content/1/2/215
Access the most recent version of this article at:
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://clincancerres.aacrjournals.org/content/1/2/215To request permission to re-use all or part of this article, use this link
Research. on March 14, 2020. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from