Winterhalter Chemicals

Professional Hygiene SystemsA total hygiene range for all your commercial kitchen, catering, beverage and housekeeping requirements

Detergents and chemical products catalogue

2

Hygienically clean – more than just an obligationWinterhalter is an independent family business predominantly known

for its manufacture of glass and dish washers for the catering trade.

We listen to the market and respond with prompt solutions to the

needs and suggestions of our customers.

Our help doesn’t end with the dishwashing cycle, we supply detergent

products for the whole business – from kitchen to restaurant, bar to

cellar and hotel bedroom to bathroom.

Winterhalter has been specialising in professional dishwashing systems

for more than 50 years so we are intimately familiar with hygiene

requirements and the laws governing them. Our service package is

based on this knowledge and is aimed at everything involving

commercial dishwashers, including the right detergents, rinse aids, care

products, disinfectants, floor treatment, dosing systems and accessories.

We will help you optimise your dishwashing procedures, develop the

necessary hygiene programme and provide you with supporting HACCP

documentation, product system wallcharts and training programmes.

Tel 01908 359000 - Sales 01908 359059 - ServiceFax 01908 [email protected]

NEW PRODUCTS

NEW ENVIRONMENTAL CHEMICAL RANGE

NEW PRODUCT SYSTEMS

FREE ADVICE LINE

3

Machine Dishwashing 4-5

Low Temperature Glasswashing 6

Manual Potwashing Detergents 7

Environmentally Friendly Hygiene Products 8-9

Super Concentrate Catering Systems 10-11

Super Concentrate Housekeeping Systems 12

Glasswashing Products, Bar & Cellar 13-15

Catering Hygiene System 16-17

Housekeeping Product Systems 18-20

Hand Care 21-22

Floor & Carpet Care 23-24

Laundry Products 25-26

Service Dosing Documentation 27

Product Index

4

Machine Dishwashing PowerDesigned to give an uncompromising clean, our dishwashing detergents are aimed particularly at stubborn dirt. Highly efficient, they cover the entire spectrum of stains such as coffee, tea, food starch, grease, egg white, dyes, tannin agents, roasting, frying and dough residues.

P1 Diamond 2000

P3 Diamond DetanDestaining Detergent

P2 Diamond 3000Soft Water Detergent

P4 Aluminium Safe Dishwashing Detergent

Hard water dishwashing detergent. A non-foaming liquid designed only for use in automatic dishwashers. Suitable for the washing of crockery, cutlery and glasses. Formulated to maintain performance without a corrosive hazard classification, this low alkaline product is especially useful where septic tanks are employed as it has minimal impact on bacterial cultures. Safe for use on aluminium.

Code No. P1/05 Pack Size 2 x 5LCode No. P1/20 Pack Size 1 x 20L

A highly alkaline heavy duty detergent comprising a blend of organic sequestering agents and inhibitors which provide soil suspension and dispersion properties with excellent tannin control. It is particularly effective for the removal of tannin associated with tea and coffee, giving maximum stain control. Prevents build-up of scale.


A non-foaming liquid designed only for use in automatic dishwashers in areas of soft water. Suitable for the washing of crockery, cutlery and glasses. Formulated to maintain performance without a corrosive hazard classification, this low alkaline product is especially useful where septic tanks are employed as it has minimal impact on bacterial cultures.


A highly alkaline heavy duty detergent comprising a blend of organic sequestering agents and inhibitors which provide soil suspension and dispersion properties with excellent tannin control. It is particularly effectivefor the removal of tannin associated with tea and coffee, giving maximum stain control. Prevents build-up of scale and will not damage aluminium.


5

Shine Rinse AidsNo more polishing – removes detergent residues, ensures rapid drying and gives perfectly stable beer head. All this is guaranteed by our rinse aid products when used with the right water treatment. They give dishes and glasses that special sparkle, enabling you to use them straight away without having to dry or polish them.

P3 PLUSDiamond DetanDestaining Detergent

S2 Sapphire 2000Dishwasher Rinse Aid

P5 Double Diamond Dishwashing Detergent

S3 Hard Water Rinse Aid

Diamond Detan Plus is a highly alkaline autodishwashing detergent specially formulated to provide excellent soil removal from crockery, in both soft andhard water conditions. Its oxidising properties provide fast effective removalof tannin stains and its intensive cleaning action rapidly removes fats, starchand proteins. Its highly concentrate formulation gives greater economy in use and its special ingredients prevents descaling of dishwashing machines, even in hard water conditions. Wherever tannin stains are a problem and ordinary products do not work, P3PLUS may be used to rapidly remove even built up stains without the need for extra products.

Code No. P3PLUS/05 Pack Size 2 x 5LCode No. P3PLUS/20 Pack Size 1 x 20L

A blend of low foaming surfactants and additives used in the final rinse to give fast drying. Designed to reduce surface tension of water and prevent water spotting and streaking, giving a sparkling finish without the need to towel dry.

Code No. S2/05 Pack Size 2 x 5LCode No. S2/20 Pack Size 1 x 20L

New to the range, a product specifically developed for the effective removal of heavy starch deposits on plates. Where excessive starch proteins are evident in the water tank, a hard uneven surface is often produced on the bottom of plates. This product has been specifically developed to emulsify the starch to enable an effective cleaning action.


A blend of low foaming surfactants and additives used in the final rinse. Especially formulated for hard water areas to give fast drying. Designed to reduce surface tension of water and prevent water spotting and streaking, giving a sparkling finish without the need to towel dry.

Code No. S3/05 Pack Size 2 x 5LCode No. S3/20 Pack Size 1 x 20L

6

Low Temperature Glasswashing Systems

F33 ReTemp Detergent K360 ReTemp Special Glass Rinse Aid

A special glasswashing alkaline liquid detergent for exclusive use with Winterhalter ReTemp glasswashing systems. Gives professional glasswashing at a temperature of 40°C.

Suitable for ReTemp glasswashing in bars, restaurants and beer gardens. Suitable for all types of drinking glasses. Reliably removes the remains of juice, wine, beer, sparkling wine, cocktails and soft drinks. Effectively removes lipstick and other greasy residues at temperatures of 40°C. Especially suitable for soft water and water with middle hardness.

For optimum results we recommend using this product in ReTemp glasswashing machines in conjunction with K360 ReTemp Rinse Aid and the corresponding Winterhalter water treatment.

For spotless glasses, it is necessary to use a Winterhalter demineralisation system (partial demineralisation, full demineralisation or reverse osmosis RoMatik) concurrently.

Code No. F33/05 Pack Size 2 x 5LCode No. F33/20 Pack Size 1 x 20L

Special acidic rinse aid for exclusive use with Winterhalter ReTemp glass cleaning system. Suitable for all glasswashing in bars, restaurants and beer gardens. For all types of drinking glasses included decorated glass. Permits proper draining of rinse water and guarantees a fast, spotless drying of glasses at temperatures of 40°C – 65°C. Especially suitable for soft water and water with middle hardness.

For optimum results we recommend using this product in ReTemp glasswashing machines in conjunction with F33 ReTemp Glasswashing Detergent and the corresponding Winterhalter water treatment.

For spotless glasses, it is necessary to use a Winterhalter demineralisation system (partial demineralisation, full demineralisation or reverse osmosis RoMatik) concurrently.

Code No. K360/05 Pack Size 2 x 5LCode No. K360/20 Pack Size 1 x 20L

Winterhalter provides a National Service Support Team of Engineers to install, commission and calibrate autodosing

equipment. Our engineers also provide regular service check-ups and service reports.

Call our Help Line on 01908 359059.

For exclusive use with Winterhalter ReTemp Machines

P6 Granular Salt

Code No. P6/01 Pack Size 6 x 1.75kgCode No. P6/25 Pack Size 1 x 25kg

7

F1 Fresh Standard Washing Up Liquid C1 Clean Bactericidal

Washing Up Liquid

A high quality lemon fragranced concentrated 20% active detergent for use in all hand dishwashing applications. A premium product which will leave crockery squeaky clean. Ideal for large sink areas in catering and kitchen locations where economy in use is required.

Code No. F1/05 Pack Size 2 x 5L

A bactericidal neutral liquid detergent for manual washing of kitchen utensils, cooking vessels and crockery. Contains an effective bactericide to kill micro-organisms and prevent cross-infection. The product has been designed to give effective degreasing properties. Sanitization can be achieved by immersion in hot water for a minimum of 3 minutes.

Code No. C1/05 Pack Size 2 x 5L

F1 Fresh Super Concentrate Potwash Detergent

For manual washing of pots, pans, crockery and utensils. Effectively removes grease and dried-on soiling.

Colour Code: Green

Code No. EV1/WH Pack Size 2 x 1.5L

Fresh Manual Potwashing Detergents

Winterhalters new Chemical Control Dispensing Systems allows concentrated chemical to be diluted at point of use. Unlike conventional systems, the Dispensing System requires no water connections, plumbing or electrical supply. The compact design allows for installation in areas where space is restricted and can be sited in the most convenient location.

The concentrate sink dispenser is sited to ensure the delivery spout dispenses directly into the sink or bowl of water.

Code No. EVDISA/WH Pack Size x 1

8

Catering Products

R6 ConcentratedWashing Up Liquid

R8 BactericidalLiquid Soap

A concentrated washing up liquid designed to cut through heavy grease and grime. For the manual washing of pots and utensils. Contains no unnecessary perfumes or dyes and is clear in colour. Formulated from renewable resources including vegetable derived surfactants and betaines. pH balanced to neutral.

Code No. R6/05 Pack Size 2 x 5L

A non-perfumed, non-tainting cleanser ideal for use in food preparation areas. Protects hands against hand and food borne infections. With added emollient to leave hands feeling smooth and conditioned. Contains vegetable derived surfactants, betaines and glycerine and is pH balanced to neutral. The product is biodegradable, contains no phosphates and has minimal impact upon the environment.


R5 Surface Cleaner& Sanitizer

R7 Heavy Duty Cleaner

A highly effective non-perfumed cleaner with a powerful sanitizing action. Safe for use in food preparation areas. Cleans and sanitizes all hard surfaces, including stainless steel, microwaves, fridges, freezers, canopies and chopping boards. Manufactured from vegetable derived surfactants. Has a low impact on the environment. Has not been tested on animals.

Code No. R5/05 Pack Size 2 x 5LCode No. R5/07 Pack Size 6 x 750ml

An unperfumed general purpose heavy duty cleaner and degreaser designed for use in areas where a non-perfumed cleaner is required. Ideal for use in commercial catering and kitchen environments. Has no caustic additives and is a safe alternative to many alkaline products used for similar tasks. Ideal for use on floors, walls, external and internal surfaces of catering equipment, canopy filters, canopy hoods, fat fryers and autoshams. Can be used through pressure washers and steam cleaners.


Environmentally Friendly Hygiene Products

Caring for the environment

At Winterhalter, we take our responsibility to the environment very seriously. We recognise that concern for the world around us should be an integral and fundamental part of our business and we are committed to minimising the impact of our products and services on the environment.

Each product in the Winterhalter Environmental Range has been formulated to minimize the impact on the environment. They utilise raw materials from renewable resources, are fully biodegradable and use recycled or recyclable packaging.

9

Housekeeping Products

R2 Citric Toilet Cleaner

R9 Shower Gel

Formulated from renewable resources including fruit based acid. A toilet and urinal cleaner that removes soil and scale. A complete cleaner which leaves toilets clean and with a refreshing floral fragrance. The product is biodegradable, contains no phosphates and has minimal impact on the environment. The product has not been tested on animals.

Code No. R2/07 Pack Size 12 x 750ml

Formulated from vegetable derived surfactants and pH balanced to neutral, this product is ideal for all over hair and body wash. A mild effective delicately perfumed formulation with high foaming properties. Rinses off easily, leaving the skin smooth and conditioned. Ideal for use through a wall mounted dispenser.


R1 Bath & WashroomCleaner

R4 Glass Cleaner

Formulated for the frequent cleaning of baths and washrooms. An effective cleaner and descaler for light to medium soilings. Ideal for cleaning and descaling taps, baths, showers, ceramics, plastic and porcelain surfaces. Suitable for all non-ferrous metals. After cleaning, a fresh citrus fragrance remains, leaving rooms deodorised and clean. The product is based on citric acid which is derived from renewable resource plants. The product is biodegradable, contains no phosphates and has minimal impact upon the environment. It has not been tested on animals and is proven to be effective against MRSA. The trigger is all plastic for greater recyclability.


A non-smear formula specially designed to give excellent cleaning power. Produces a sparkling, streak-free finish on glass, mirrors, ceramic tiles, highly polished stainless steel and chrome finishes. Can be used in sensitive areas such as foodpreparation areas. Formulated from renewableresources including bio-ethanol derived from the fermentation of sugar. It is pH neutral and no unnecessary perfumes or colours are used. It has not been tested on animals. The trigger is all plastic for greater recyclability.


� Unnecessary ingredients

� Harmful additives

� Contain no unnecessary perfumes or dyes

� Biodegradable to European standards

� Raw materials mainly from renewable resources including vegetable derived surfactants and betaines

� Reusable and recyclable triggers and spray flasks

� Septic tank safe

� Fruit fragrances

� Phosphate free

10

These robust dispensers are constructed frompolypropylene and HDPE and are able to withstandthe harshest of cleaning environments. Maintenancecosts are dramatically reduced as there is no needfor constant surveillance of the system.

Simple accurate dispensingThe easy to use dispenser has a push / pull leversystem which consistently delivers the correctamount of chemical concentrate directly into waterin a trigger bottle, sink or bucket.

Safe systemsThe product filled dispenser will only dispenseconcentrate when the spray bottle is locked intoposition. Both the sink and bucket operations needto be enabled before dispensing. An automaticdelay mechanism locks-out the system for a time,preventing over-dosing. The units arrr e lockable forsafety reasons. Non-return valves and drip-traysremove the risk of splashing surfaces or the operator.

Environmental advantagesAccurate dispensing prevents over-dosing andrrchemical wastage. Concentrated products reducepackaging, storage and transport.

Cost effectiveControlled dispensing and consistent dilutionsevery time give demonstrable savings in cost in use.

Super Concentrate Catering SystemsWinterhalter’s new Chemical Control Dispensing Systems allows concentratedchemical to be diluted at point of use. Unlike conventional systems, theDispensing System requires no water connections, plumbing or electricalsupply.yy The compact design allows for installation in areas where space isrestricted and can be sited in the most convenient location.

The product you select determines the dispenser you require. The concentrate dispenser has been designed to make your job easier and safer.

Up to 92% less packaging,based on a kilo of product

and conventional packaging.

3 SPRAY FLASK DISPENSERThe concentrate spray flask

dispenser has a purposebuilt shelf for holding thetrigger bottle in placewhilst it dispenses thecorrect measure ofconcentrate productinto the water filled flask.

A range of Winterhalterheavy duty 750ml bottles

and trigger sprays withchemical resistant labels are

available for the selected productsthrough this system. The dispenser will not operateunless the trigger bottle is locked in place.

Code No. EVDISF/WH Pack Size x1

1 SINK DISPENSERThe concentrate sink

dispenser is sited toensure the deliveryspout dispensesdirectly into the sinkor bowl of water.

Code No. EVDISA/WHPack Size x1

2 BUCKET DISPENSERThe concentrate bucket

dispenser has an extensionpipe to be installed atthe right height abovethe selected bucketallowing the productto flow directly into

the water.

Code No. EVDISB/WHPack Size x1

11

Wall MountedBottle HolsterKeeps trigger packsclean and tidy.

Code No. EVFH

C4 Clean Super Concentrate Heavy Duty Cleaner & Degreaser

A highly effective cleaner and degreaser for use where heavy soiling and grease are evident. Can be used through a trigger bottle on exterior areas of equipment including canopy hoods, fat fryers, cookers and canopy filters, as well as stainless steel wall cladding and glazed tiles. Bucket fill option for floors, walls and general cleaning of hard surfaces. Colour Code: Yellow

Code No. EV2/WH Pack Size 2 x 1.5LCode No. EVF2/WH Pack Size 6 x 750ml HD Refill Flask

7C Double Agent Super Concentrate Surface Cleaner & Sanitizer

The Winterhalter Double Agent System is a major innovation in product research and development specially designed to reduce the risk of disinfection resistant bacteria. Double Agent products are supplied in two colour coded formulations, each containing a different disinfection system. By rotating the two products, the risk of bacteria developing a resistance to either product is reduced. For all hard surfaces including work surfaces, microwaves, fridges, freezers, chopping boards and tiles. Passes BSEN 1276 (European Suspension Test) and is effective against MRSA, listeria, salmonella and e.coli at 20°C after five minutes contact time. The product complies with BS 5929 (1984 UKAS accredited triangle test), i.e. the product is classified as non-tainting to foodstuffs and may be air dried without rinsing. Colour Code: Pink and Blue

Code No. EV3DA/WH Pack Size 2 x 1.5LCode No. EVF3DA/WH Pack Size 6 x 750ml HD Refill Flask

F1 Fresh Super Concentrate Potwash Detergent

For manual washing of pots, pans, crockery and utensils. Effectively removes grease and dried-on soiling. Colour Code: Green

Code No. EV1/WH Pack Size 2 x 1.5L

Product PackagingA new 1.5L hermetically sealed pouch has beenselected for our system. The unique 4-positionkey has been created to allow only theWinterhalter product pack to be installed.When the pack has been inserted and primeda cruciform inside the pouch ensures that100% product use is achieved. Emptiedrecyclable packs can simply be rolled up forlow disposal costs. The easy to handle productpouches load simply and quickly. The productsare packed in 2 x 1.5L to a case. Product caseweight only 3 kilos. Winterhalter has developedan easy to use labelling system for our range ofconcentrate products.

Colour CodingA selection of bright, highly visual colourcodings have been developed for the chemicalproducts. The pouches and spray flasks,product use charts, dispenser handles anddispenser use guides.

Numeric ReferencesEach product within the range has a unique numeric number referencefor quick operator referral.

12

Super Concentrate Housekeeping Systems

F7 Window & Stainless Steel Cleaner F5 Toilet Cleaner & Descaler

An alcohol based cleaner that effectively cuts through atmospheric grime and nicotine soilings. This product is also ideal for cleaning and polishing stainless steel where a streak free finish is required.

Code No. EV8/WH Pack Size 2 x 1.5LCode No. EVF8/WH Pack Size 6 x 750ml HD Refill FlaskCode No. EVDISF/WH Pack Size 1 x Dispenser

For the daily maintenance of urinals and WC’s. A fragrant thickostropic toilet cleaner and descaler.

Code No. EV9/WH Pack Size 2 x 1.5LCode No. EVF9/WH Pack Size 12 x 500ml HD Refill BottleCode No. EVDIS9/WH Pack Size 1 x Dispenser

F8 Bath & Washroom Cleaner F10 Air Freshener

Designed to effectively remove natural oils soaps deposits and general soiling from baths, sinks, showers, w.c’s, tiles, glass screens and hard floor coverings. Contains a antibacterial agent and is citric acid based to maintain scale levels on surfaces being cleaned, helps prevent hard water deposits from forming on surfaces and leaves a refreshing mild fragrance to deodorize the room.


Formulated to neautralize and deodorize natural body odours and stale tobacco. Leaves rooms with a refreshing pot porri fragrance which naturally complements the bath and washroom cleaner in this range.


13

Glass Washing Products – Bar & Cellar

G1 Diamond 1000Glasswashing Detergent

G5 Glass Soft Water Cabinet Glasswash

G2 Non Caustic Machine Glasswashing Detergent

A high quality glasswashing detergent especially designed to quickly remove all dirt and soiling from glassware without damaging its delicate appearance. This powerful formulation is particularly effective in removing lipstick as well as keeping beer head retention and lacing to the highest possible level. It combines maximum impact on soil with minimum impact on the glass surface, therefore reducing the risk of blooming.

Code No. G1/05 Pack Size 2 x 5L

Designed for the cleaning of drinking glasses in enclosed automatic glasswashing machines. Only suitable for soft water areas or where an inline water softener is installed. Use in conjunction with Winterhalter Rinse Aid to enhance the visual quality of the cleaned glasses.


A non-caustic machine glasswashing detergent specially designed to quickly remove all dirt and soiling from glassware without damaging its delicate appearance. This powerful formulation is particularly effective in removing lipstick as well as keeping beer head retention and lacing to the highest possible level. It combines maximum impact on soil with minimum impact on the glass surface, therefore reducing the risk of blooming.


The reputation of an establishment can be determined by its glassware. To enable your glasses to make a dazzling impression, Winterhalter detergent products ensure that smears, streaks and grease, e.g. lipstick, disappear without a trace. These detergent products are completely scent neutral and together with the proper water treatment and temperature setting achieve the most hygienic results. Even delicate glassware and decorations are cleaned gently which ensures longevity and strength.

G3 Glass Renovating Powder

A powder detergent sanitizer for the refurbishment of drinking glasses and especially for the removal of rinse aid film. Can be used to treat new drinking glasses, removing all traces of chemicals used in glass manufacture, especially the mould release agent. Can also be used to aid the normal maintenance cleaning of cabinet and rotary brush type glasswasher machines. The sanitizer action of the product can also benefit the machine interior.

Code No. G3/10 Pack Size 1 x 10kg

14


S1 Sapphire 1000 Glasswasher Rinse Aid

C9 Clean Purple Beer Line Cleaner

A highly effective rinse aid especially formulated to leave low residue, ensuring that beer head retention is kept to a maximum. Spotting and streaking are eliminated, giving a brilliant sparkling finish without the need to towel dry.

Code No. S1/05 Pack Size 2 x 5L

A powerful blend of caustic alkalinity and chlorine based bleaching agent. Also contains a colour indicator to signify when the product is exhausted.


C4 Clean Heavy Duty Hard Surface Cleaner

A powerful blend of surfactants, sequestrants and alkali builders, ideal for the removal of a wide range of environmental soilings including oil and grease. For use on cookers, extraction fittings and canopy hoods. Also for the exterior areas of fat fryers, cook and hold ovens and other cooking appliances.

Code No. C4/05 Pack Size 2 x 5LCode No. C4/07 Pack Size 6 x 750ml

C18 Clean Clear Beer Line Cleaner

A highly effective cleaner with a built-in disinfectant solution for perfect results every time. Always follow the equipment manufacturer’s cleaning guide lines.


15

Ice Machine Cleaner & Sanitizer

arch has shown that certain bacteria IceIc is a food pd prodroductuct S. Sciecienntific fic fic rerereseamany hours. They can also remain andandand vivivirusrusruseses cancan su survirviveve frefreeziezingng ng g ffforfff mcoholic drinks. It is therefore capcapcapablablable oe oe of gf gf growrowrowththth iniin ververy sttrong gg alce contaminated by air borne particles, important that icee does es notnot be becomcommmemost likely source of contamination ost likely source of contamination food hd handandlerlers os or dr dirtirty utensils. TheheeThee making machine or equipment, or poor is is inainadeqdequatuate ce cleaning og of tf the he iceice m mmmamme icce. The ice storage compartment hyghygieniene pe pracra ticicce we wwhenhen hahandlndlingingg th thhhthhhe

foortttnightly, to prevent the build-up shoshoulduld be be cl cleaneaned ed regregggulau rlyrlyrr , a, at llt leaseasssst for ananannany gy gy gy gy y rowowwrowwth th th hth th ofofof of scuscucscscum om om om om or sr srr slimlimlilimlime ae ae aae andndndnd ndfffof bacbacterteriia. It shhouloould bd bd be me mmonionionitortortoredd ee ft sshoooouldulduldddd imimmedmediatia ely cleanedif sucsucucsucsucsucucu h gh gh gh gh gh gh grrowrowr ths become appaarennnt,tt, ittruuctiotioti nsnsns.ns.s according toto th the me manuanufacfacturtu er’e s innst

Code No. IMSD5/08 PaPaacacacack Sk SSSizeizee x xxx 1116 x6 505050000ml0ml0ml0ml0ml bobbo bo bobottlttlttlttlttlttt eseseses2 x2 750ml0m0m spprayrrr sanitizer flasks


C11 Clean Descaling Powder

A powder descaler which can be diluted to form a powerful and versatile descaling solution. For use in kitchen applications.

Code No. C11/05 Pack Size 1 x 5kg

Quash Starter Kit / Quash Refill Kit

Quash is a market leading antibacterial solution especially formulated for removing lipstick and grease marks. Simply twist the upturned glass in a solution filled foam pad and your glasses are ready for washing in the normal way. The foam pad comes with its own applicator tray and sits neatly next to the washing up area. A fast acting formula with user friendly applicator, Quash eliminates tough grease marks without slowing down either you or your staff.

Quash Starter Pack contains: 2x5L bactericidal cleaning solution, 3 foam pads, 1 applicator, 1 measuring cup

Code No. 02194K Pack Size 1 x Starter KitCode No. 02194R Pack Size 1 x Refill Kit

16

C13 Clean Foam Oven Cleaner

The foam spray enables the product to clean surfaces for improved cleaning power. The use on grills and ovens and any equipment where cameralised grease or oil is evident. Provides quick effective maintenance of internal and exterior areas of ovens, etc. Not suitable for the removal of hard carbon deposits. Use on cool surfaces only. Do not use on aluminium, plastic or painted surfaces.

Code No. C13/07 Pack Size 6 x 750ml

Catering Hygiene System

C3 Clean Oven Cleaner C3 Winterhalter Oven Cleaning Kit

A product that forms part of our successful catering hygiene programme. Formulated to remove heavily encrusted carbon deposits from the internal areas of industrial and commercial ovens. Converts hard deposits into a liquid that can be rinsed off easily.

HEALTH & SAFETY WARNING – CORROSIVEALWAYS WEAR PROTECTIVE CLOTHING


For use with C3 Oven Cleaner, this safety kit contains product use instructions and protective clothing, together with cleaning cloths and scourers to enable the operator to clean effectively and safely. All the products can be purchased individually.

Code No. C3/KIT Pack Size x 1

The Winterhalter hygiene programme is tailored to your kitchen and the amount of dirt it has to deal with. Our products will clean all the materials and equipment in your kitchen including glass, mirrors, stainless steel, frying areas, ovens, cookers, grills, combo convector mats, combination steaming equipment, cream whipping and ice machines, coffee machines, counters, sinks and fixtures. The products are available in various pack sizes - in a handy bottle with a dosing aid, or in the sensible ecological and low price refillable pack for flexibility and economy.

C17 Clean Stainless Steel Polish

Cleans, polishes and protects in one easy application. This product is designed to resist fingermarks and dust. Will remove light soiling and stains. Deposits a fine film of protective lubricant, leaving a soft glowing finish. It may also be used as a protective film to prevent food and grease splatter from sticking to cooking ranges and surfaces. Heavier soiling should be removed with a degreaser. Stainless Steel Polish does not contain any acids or abrasives and will therefore will not scratch, corrode or damage surfaces.

Code No. C17/07 Pack Size 6 x 750ml

17

Catering Hygiene SystemThe Clean System is designed for perfect kitchen cleaning. Guaranteeing kitchen hygiene is Winterhalter’s top priority. We have created clear language, colour coded labelling, making training easy, avoiding mix ups and preventing improper use. With our simple self-explanatory cleaning and disinfection plans, we will support your staff step by step in every day cleaning tasks.

C10 Clean Descaler

C6 Clean Enzyme Drain CleanerC16 Clean Descaler PA

C15 Clean Spray On Degreaser

A general purpose phosphoric cleaner and descaler with wetting agents designed to quickly and safely remove scale from dish and glasswashing machines. Winterhalter Descaler can also be used for other general descaling applications such as bain maries, kettles and boilers.


Designed to be used through approved automatic enzyme drain dispensing systems. Enzyme Drain Cleaner contains a specially selected blend of non toxic natural microbes that effectively digest oils, fats, grease and other organic matter blocking or impeding drainage systems or grease traps. Enzyme Drain Cleaner is a totally natural product and is not harmful to the environment. Use with improved Winterhalter battery or mains dosing unit.


A concentrated descaler detergent based on phosphoric acid for cleaning and brightening stainless steel equipment including bain maries, pasta boilers, machine dishwashers, machine glasswashers, kettles (internal), etc.


This product forms part of our Catering Hygiene Programme. Designed for the effective removal of caramelised grease from cookers, extractor fittings and canopy hoods. Also for external areas of fat fryers, cook and hold ovens and other cooking appliances.


18

Housekeeping Product SystemsOur Room Care Products get below the surface – your guarantee that all is fresh and clean. This programme works effectively to fight dirt and bacteria and will also treat materials and surfaces with care. Product lines includestoilet and bath cleaner, furniture polish, bleach, disinfectant, drain pipe cleaner,air freshener, antibacterial multipurpose cleaner and window cleaner.

C8 Clean Glass Cleaner

F9 Peach Air Freshener

A unique formulatiationon givgivinging ex excepceptitionala spparka ling sg stretreak-ak-frefreff e re esus ltsl every time. Removes a wide range of sois ls incin luding atmosphehericri grggg imememememe, nicotine stains, finger mmmmmmmmmarkarkaaaa s and dead insect c marks.

Code No. C8/07 PacP k SSizeize 6 6 66666666 x 7x x 50m50ml

LeLeaLL vesessss a a subbbbtletle pep achh fr agragrancncnn e aftetet r everery uy uuusese.ss Co C ntains a aa bioi cidcidc e to remmmmmmovoooovoveoveooov air borne bacterierie a. BanB ishishes llilinlinlili geringing smelells suchc asasasas to t bacco o smokke and stale aiair. r IdeId al forrr tht e se aninitizt ing of tetellephonho es.es AlAAAA AlAA wayways us uuuuuuuuse seover carpeted ad a aareas and never over hardrd flofloflflflflflfl orso .

CodCo e Ne No. o F9//0707 Pacckk Sizeeee 6 6 x 7750mmmmmmmmllllll

F8 Fresh Washroom Cleaner

F15 Fresh Wax Free Polish

An antibacteriariaiariaal ccl cl cl cl cl cl citritritritritritritrit ussus ususus us batbatbbb hh and wasashhrhroom clec aner. An efffectectivee fofofofo fofoofoofofoamam am amaacleaner and descaler, ididididealeal for cleaning and nnd nnddndndnd nd ndnddd desdesdede caling taaps,s,s, ba bababaabbabababa babaathsththsthththtththh ,hhshoshohshoshoshos werwwww s, cercecercerercercere amiaaa c and porcelain surfaacescec . Leaves surfaces s sansanananansansasaannsansanitiitiii zedzedeezeeeeeeedeze ,

ddddeoddeodeodeoddeoddddoriseeeeeeeddd ad addddd addd aaand ndnnnnnn scale free. Proved toto be b effffffffffecfecfefecffefefefefefe tivtt e ae against MRRRSASASA.

CodCodCodCodCodCoCododC e Neeee o. o. F8/F8 070 PacPacPacPacPacPacPacPa k Size 6 x 7xx 7x 7x 7x 7x 7x 7xxx 750m50m0m0m50m50m50m55 lll

Formulated to give a fasa t clean and shine in in one operatioti n. Rememoveves dust and d finger marks with ease. For useuse on paintwwwoworwwww k, enameleleelelellelelelelel,, ,laminatess, plastic and sealed woodene surfaces. Not o forf usse oe n wnn wnnnn axed or lacquered furniture.

Code No. F15/07 Pack Size 6 x 7x 50ml

19

Housekeeping Product SystemsAll round cleaning programme for housekeeping and laundry. These products contribute towards a fresh and clean atmosphere in your rooms. The Winterhalterprogramme of products offers you all the options you need to perfect all round cleaning so your guests can feel right at home.

F14 Fresh Descaler & SanitizerF12 Fresh Mould & Mildew Remover

A pA pA poweoweow rfurfurfurfurfurfurfuul ffl fl fl fl fl fl fl foamoammoamoaoooo inginngnin prprprprpppppproduoduooduct t desdesdesignigignigni ed forfoforfor thth th t e se afeeeafe and qquicuicuiccck rk rk rk rk remoooe valvalalofofofoof of of limlimlimlimli escesese aleale de deposposposposposososossositsitsititi from mm shoshohohoshoh werwerrw hehehheadsadsdsdsdsssdsdsdss III. I. I. . II. t it iit itt s esss eeffefff ctitctictitivve vevve agaagaagaa insi t tthe legionelllella ba ba ba bactactactctactactac eriierieriere a wa wwwwwa hichichhhhh h ih ih is os os fteftefteten hhhn arbarbarbarrbououred dedded wititwitwithinhinnn li l lli l mesmm calaaa e. ee WilW l descale and sanitiiitize ze zeeze shoshhohoshooshoshshs wererwwewerw heeeadssads, plumumu binbbb g fi fififififififififittittittittit ngsngsngsggsggg anananand sd ssssanianiaania tartartartartataryy wy warea inin oneon operation. It mayayayayyyy alaalal alal al a a so sosoo be e useususeusused ad addd s a geenernernernenernererere lal alal al al aa sursurursurfafafacfafa e dddescescescesccalealea r,e.ge ge ge.gge fff. f. f. f f. fororor or oro shoshos werw cubicles mmmmammmamamaaam dde dddd froom gm lassss ossss r acrycrycryryryylilicliclicliclicliclic pppl plpl plpppp asastastastastic,, wawwww sh shssh basbbbaba insnnn ,toilettetlettts, s, sssss, ss cererere amamiammicscs, taps, babaaatththhthththtttht uuububsubsubsuuub , chror me e andandandandandandandanandandanaa ce c rammmammic icicicic ici wall ttttileilil s.

CodC e Ne Ne Ne No. o. o. o FF14/07 PacPacPPacPacP k Sk Sk Sk SSk Sizeizeiziiz 6 6 66 66666 x 7x 7x 7xx 50m50mmmlCodCode Ne Ne No.o. o. F15F15F1555F155F /05/05/0/0// PacPacPacacacacacPacacacPaPaaa kkkk Sk k Sk Sk Sk Skk ize 2 x 55555L

A ppppoweowerful disiisiisisisissisisisisinfennnnnn ctant clecleaneaneaneaneneneeeeaner wwr rrr hichichhhhichhhich wh wwithhhh ititiit its hhs hs hiiighgh fof amiamiamimiimimimimiinngng ng nn propp perperpererrertietietietietietietieess, s, eeensensensenseen ureureureureureureuu s ps ps ps ps s rololroro ongonged contact wwititithhthhthhtithhth tt tttthh ee surfrfrfffffr aaceacac bebeinging cl cleane ededddededed. ThThThTThe pe ppppp pproddrodrodrodrodro ucuctctuctuctuctcttctdeodeod dordorisei s, bleblblebleachhachachaachaccheeseses es andanandand kiki killsllsllssssss t th ththt eeee e ccee olooloooureurred m md oullds dsdsdsds dsdsdsddsd andandanda mimmmimmm mildeldew ww ww www whhhichich hh oftoften grorogrow oooooow ow n ttn ttn tn tn tileileileil grg outingngggggg. OOOnlynlylynlylyyy fo fof for urr uur uurr uuuusese sss on onon grouted tilelelele su sususurfaacescesesesessesesess.

CodCodCodCodCododododCo e Ne Ne e eee o. o. . F12F12F12/0/07/070707070777 PaccPackkk Sk Sk Sk Sizeze 6 6 6 x 77755555050m50m5555 ll

F4 Fresh Heavy Duty Toilet Cleaner & Descaler F5 Fresh Toilet Cleaner

DesD igned for ususe we wherherhererherherheeherherheherrh e te teeeeee he he hehehehehehe heh remmmmmovaovaovaoovao l ol of hf hf hffff eavy ly llllimeimei scasc le isisis isis is is is is s iis reqreeeqreqreqreqreqreqreqquiruiri ed.ed.ddA hA ighg acctivt e phoshosoo phophophophohhhhooooooricricriiiri acid basba ed e forormulm atitiiion on sasafe to use se on o stastattatataaainlinlinlinlinlinlnninleessess stest el, feeeeeeerrorrorrorrorrorrorrrorror us u mettalsls and ceeramicmi s. . Contaiaiaiaiaiaiaainns a fresreseeeeee h ih nvinv goratiatititing ng g gfragragragragragragrgrgrgrragraaancennnnnnn . . Do not t mixxxxx wi w www www th h blbleb achchchchchchchchh.

Code No. o F4//070700 Pack Sk Skk Sk SSk Sk Sk Sizeiiii 121 x 7500mlm

DesDesignigned ed toto comcombatbatatbatatbatbatbaaba th thth th t t e be builuild-up oof sf scalcale ie in bn bothot memediudiudi m am nd d harhard dwatwater e areas.s. ToToileet Ct Clealeanerner efefffffecfe tivelyely cl cleaneans as nd nd d deodeodordddoriseisess, lealeavinvi g ag frefresh sh pine fe fragragrannce.cecececece Maayy safeafety t be bbe useused oon pn pn pporcor elae in in and stainlesle s sstestetstestesteste lel.el.el.elel Id Id II eal foff foff r everererrry dy dy dyyy ay y use. DDo no noo ot o mix with h bleach.

Cododde Ne No. o. F5/077 Pacck Sk ize 12 x x 75050mll

20

Housekeeping Product Systems

F3 Fresh BleachF2 Fresh Thick Bleach

A poweww rfurf l chlohlorinrine be be bbe bbbbbbasasaaseaseasaseaseased bd blealeaaaaaach ch cch forfor di diiisinsinsinsinsininnnsinfecfecfecfecfecfecfefef tintintint g flg flg flg flflflfloorooroorooooooroorooroorsssssss, ss, gulgulgululleyleyleyleyeyeyeyyyyyyyss ass as as ass ass ndnd ndn drarar insnsnsnsnsnssnssins.

Cododde Ne Ne Ne Ne Nee o. o. F3/F3/3/3/3/3/3/333/3/3/3/0505050505050505000500 PacPack Sk Sk SSk SSSizeizeizeizeizeizeizizeize 2 222 2 222222 x 5x xxxxxx L

A hA hA hA hA hA hA hAA hA hAA hhighighigiigg lly actactaactacttactactaacaaca iveiveiveiveiveiveiveivee th tht t ickckkkkkkckckkkkk bl each with adaddadddadadddddedd viscosity, allowiowiwiwwiwiwww ng ng ngng ththethethe blbllblbl bleaceaceacacceaceaceach th th hhhh hhhh o co co co ccco linli g totototoototo tooooto thethhhhththththetht sususs rfafaaaacecececececece ffforforforforforforffororforro lo lolololongengeeegegeeeeggegengeerrrr, r, r, , proproproproprproproprprprprp viding more re ree effe ective cleaeaeaeaeaeaananea ingingngggging NNN. N. NN. NN. ew ewewewewee 750505050005050005550550mmmmmml mmmmpaccccckk with annnnnglegleglegglegleggleg neck ckck kck k kkk ckk k totototototo totot rearererrerer chchccch chcccc the most difficult undder rimrimrimrimrimimrimrimrim arar arr arrar a easeaseaseaseaseaseasseasss of ofofofofoff of ofof WC WC WWWWCWWWC WCWCWCWCs. s

Code No.o. o.o. ooo. o. ooooo F2/F2F2F2F2F2F2F2 0101 11 11 11111 1 Pack Size 1212 x x 7750750mmlCode No. F2F2/2//F2/F2/2//F2/F2/F2//F2/050505050050000 PacP k Size 2 xx 5L

All round cleaning programme for housekeeping and laundry. These products contribute towards a fresh and clean atmosphere in your rooms. The Winterhalterprogramme of products offers you all the options you need to perfect all round cleaeaning so your guests can feel right at home.

F6 Fresh Pine Disinfectant

A clear green quaternary disinfectantant suitable for floors,s wallsss, b, binsi and drains. Remoem ves unnpleasant odours.

Code No. F6/6/055 Pack Size 2 x 5x L

C5 Clean Sanitizing Hard Surface Cleaner

ForF mulated fd or tototal a hyghy ieniene. Provides es quick and easy cleaning andnd sanitizinzing og f all ll food preparaatioti n sn urfacees, s microwowavea s, chooppiping boards, cupbboaroaroo ds,d fridges and freezers. Readady to use. Non taini tinng. g5L refill pack ak ak vaiva lable for maximum m ecoonomy.

Code No. C5/0707 Pack Size 6 x 750mlCode No. C5/05 Pacck Sk ize 2 x 5L

21

Hand CareWorking in the kitchen is hard on the hands. Winterhalter has developed a complete range of products for cleaning, protecting and caring for hands. It includes hand soaps that clean gently and hygienically with or without disinfectant. The soap dispensers are designed for optimal dosing and the right cream to help skin recover quickly.

H1 Pink Perfumed Liquid Soap H2 Bactericidal Hand Cleanser

A high quality, high viscosity, pearlised hand soap. For use with a wall mounted soap dispenser. A mild effective formulation to remove light to medium soilings. Rinses off easily. With added emollient to leave the hands feeling smooth and conditioned. Colour coded pink with a pleasant apple perfume which leaves a delicate residual fragrance, making it ideal for toilet and washroom areas.

Code No. H1/05 Pack Size 2 x 5L

Standard Centre Feed Roll DispenserCode No. 14797DISP/WH Pack Size x 1

Refillable Soap DispenserA modern design white ABS plastic 1L dispenser. Visual dispenser strip. Easily refilled. Removable reservoir for ease of cleaning. Keyless locking and operating. A refillable wall mounted tough hygienic soap dispenser for use with a 5L refill pack.

Code No. 137800B/WH Pack Size 1 x Soap DispenserCode No. 137800R/WH Pack Size 1 x Sanitizer Dispenser

A high quality, high viscosity, pearlised hand soap. For use with a wall mounted soap dispenser. A mild effective formulation to remove light to medium soilings. Rinses off easily. A white non-perfumed, non-tainting formulation to protect against hand and food borne infections. Ideal for use in the food and catering industries. With added emollient to leave the hands feeling smooth and conditioned.

Code No. H2/05 Pack Size 2 x 5LCode No. H2/500 Pack Size 6 x 500ml

22

Hand Care

H3 Hand Sanitizing Gel

Sea Kelp Hand Wash

Wall Holster 500ml Bottle

Sea Kelp Moisturiser

A waterless 40% ethanol based instant kill hand sanitizing gel. Sanitizes the skin without the need for water. Ideal for use on entering food production areas or before handling food. An alcohol based product for use in any situation where bactericidal control is important. Contains triclosan, a proven bactericide which carries on killing bacteria once the alcohol has evaporated. Complies with BSEN 1276 bacterial activity test when used neat.

Code No. 077063/WH Pack Size 6 x 500ml

A product designed to calm and revitalise – just perfect after a hard day at the office. The natural antidote to the stresses of every day life. Therapeutic and nutrient rich marine algae helps detox, rejuvenate and tone tired hands.

Code No. ZZ0551 Pack Size 6 x 300mlCode No. ZZ0553 Pack Size 2 x 5L Refill Pack

Code No. 077077 Pack Size x 1

To complement the Sea Kelp Soap, a high quality hand reconditioning cream which leaves hands smooth and conditioned and non-tacky after use.

Code No. ZZ0552 Pack Size 6 x 300mlCode No. ZZ0554 Pack Size 2 x 5L Refill Pack

Luxury Washroom SystemsThe ultimate in luxury dispensing for public washrooms, guest rooms and bathrooms. Stylishly presented in chrome plated stainless steel, each wall mounted unit has been designed for easy installation, maintenance and use.

23

Floor & Carpet CareEASYClean every step of the way – Winterhalter Easy products enable you to clean the floors in your guest areas and back of house easily and thoroughly. The programme is specially designed for a wide variety of surfaces and removes even the most stubborn spots. The non skid surface treatment guarantees high levels of safety in all areas of application – parquet, tiles and carpets.

E1 Easy Floor Polish

E2 Easy Floor Maintainer E6 Safety Floor Cleaner

E3 Easy Floor Stripper

For use on rubber, linoleum, vinyl, vinyl asbestos, thermoplastic, asphalt, sealed wood and sealed cork floors, etc. Rich in high quality solids ingredients for a brilliant, long-lasting shine. Produces a supreme, long-lasting shine quickly and easily with only one coat. Dries to a high gloss without machine buffing. Greater flexibility – resists powdering and permits the use of spray cleaning, mopping and buffing. Combines top quality ingredients for toughness and maximum durability. The high shine remains clearer and brighter, even in heavy traffic areas, wet or dry. Code No. E1/05 Pack Size 2 x 5L

Performs a 3 in 1 operation by cleaning, polishing and treating the surface. Consists of a special blend of waxes which allows a highly polished finish when burnished with a polishing machine. The product can be used on sealed and non-porous floors. Suitable for sealed wood, sealed cork, sealed granwood, concrete, stone, ceramic, quarry, linoleum, asphalt, vinyl, rubber and PVA thermoplastic.

Code No. E2/05 Pack Size 2 x 5L

An alkaline based floor polish stripper for the effective and fast removal of metallised emulsion polishes. Designed for light to medium polish removal.


1 2PREPARE

3MAIN

TAIN

PRESERVE

Ensures swift soil removal and can be used for deep cleaning as well as routine maintenance of any safety floor. It’s added bactericidal compounds make Winterhalter Safety Floor Cleaner an extremely effective disinfectant ideal for use in hospitals, nursing homes, schools, canteens and other areas where a clean, safe floor is essential.


24

E4 Easy Carpet Spot Stain Remover

F11 Liquid Enzyme Digester

E5 Easy Carpet Upholstery Cleaner

An effective general purpose pre-spotter and stain remover for removing water-based spots and stains from carpets and upholstery, etc. which can be safely cleaned with water. Also ideal for removing oil, grease, fat, tar, lipstick and crayon, etc. Always test on latex and rubber backed carpets and for colourfastness.

Code No. E4/07 Pack Size 6 x 750ml

Removes stale odours from urine, vomit and food spills. For use on carpets, upholstery and fabrics. May be used in carpet extraction machines. Concentrated formula makes up to 20 litres.

Code No. 08284X/6WH Pack Size 6 x 1L

General purpose carpet and upholstery cleaner for use in extraction machines. For manual use, use a brush or cloth. Gently but powerfully loosens and disperses stains and grime from most textiles.


Floor & Carpet Care EASY

750ml PACK SIZE

25

Laundry ProductsDesigned to clean deep into the fibres and gets all the washable textiles on your premises hygienically clean. They are gentle on the laundry and help textiles last for a long time. Their pleasant scent keeps laundry smelling fresh so your guests will have an all round good feeling. The programme includes detergent for hot washes and coloureds, bleach and spot remover, fabric conditioners and new Oxy-Cleen soil remover and pre-soaker.

Pu1 Pure Compact Laundry Powder

Pu4 Pure BiologicalLiquid Laundry Detergent

Pu2 Pure Laundry Destain

A machine laundry powder containing an optical brightening agent to give a brighter wash. Contains up to 100 washes.

Code No. PU1/10 Pack Size 1 x 10KG

A synthetic biological liquid detergent designed for most types of soiling. The product has excellent stain removal properties, leaving laundered fabrics with an invigorating freshness, thus eliminating or greatly reducing the need for rewashing. Use through autodosing equipment or manually. Use rates vary accordingly to the type and amount of soil present and whether it is being used as a one-shot system or in conjunction with an additional stain removal agent.

Code No. PU4/10 Pack Size 1 x 10LCode No. PU4/20 Pack Size 1 x 20L

A concentrated solution of hydrogen peroxide oxidizing agent providing a high level of stain removal. May be used to remove bleachable stains which cannot be treated with chlorine based bleaches due to the risk of colour removal and fabric damage. Also effective for the treatment of mildew.

Code No. PU2/10 Pack Size 1 x 10L

Pu3 Pure Laundry Alkaline Boost

A liquid laundry alkaline detergent boost containing a highly concentrated blend of inorganic alkali. Used in conjunction with PU4 Liquid Laundry Detergent, boost cleaning performance and eliminates the need for separate pre-soaking of heavily soiled garments.

Code No. PU3/10 Pack Size 1 x 10L

26

Laundry Products

Pu5 Fabric Conditioner

Pu7 Pure BiologicalLaundry Powder

Pu6 Pure Oxy-Cleen Stain Remover

Pu8 Pure Non Biological Laundry Powder

Designed to leave clothes fresh and clean. Gives a soft, luxurious fluffy feel to clothes, making ironing easier and prolonging fabric life. A new longer lasting perfume gives a fresh clean aroma, even after storage. Contains a built-in antistatic agent. Important – do not use on kylies.

Code No. PU5/05 Pack Size 2 x 5LCode No. PU5/20 Pack Size 1 x 20L

A high quality industrial biological laundry powder. Effectively removes blood, urine, perspiration stains and other body soilings. Gives up to 100 washes per bucket.

Code No. PU7/10 Pack Size 1 x 10kg

Designed to be used in conjunction with your normal powder or liquid laundry product. Contains an oxygen bleach system which at high temperatures exerts a positive soil lifting action on organic stains without any adverse effect on the fabric. Specially formulated for pre-soaking prior to normal washing. An aid to washing efficiency. Can also be added to the main wash as a boost to stain removal.


A non-biological machine laundry powder where built in enzymes are not required. Contains an optical brightening agent to give a brighter wash. Gives up to 100 washes per bucket.


27

Service Dosing Documentation

Complete service in all matters relating to hygieneWinterhalter’s Total Hygiene Solution, consisting of machine

technology, detergent products, water treatment and accessories,

guarantees that everything you wash will come out hygienically

clean. The quality and efficiency of our machines and products is

proven every day. Only the perfect combination of machine and

chemical, can provide you with the perfect wash result and fulfil

the most stringent hygiene requirements.

ServiceWe are there to help you whenever and wherever you want.

Winterhalter offers you careful guidance to eliminate mistakes.

We will instruct your dishwashing and cleaning staff in

personally developed training programmes that cover every

aspect of hygiene. Our comprehensive network of qualified

Winterhalter partners guarantees you fast and professional

support wherever you may be located. Winterhalter will provide

you with a dedicated Service Manager to ensure you receive the

best advice for the best results.

Dosing EquipmentEconomic efficiency starts with proper dosing. High quality

dosing equipment, regardless of manufacturer, lets you use our

detergent products to their best advantage. In this way we can

help you use as little detergent as necessary, saving you money

on automatic or manual dosing aids.

DocumentationEverything you need to know to get it right. We will assist in

ensuring you have all of the necessary documentation to meet

the strict hygiene regulations (HACCP documentation) that

effect your business. This applies to the use of cleaning agents

as well as to the regulation of work procedures and processes.

We will support your staff with detailed instructions on how to

use our products properly and organise hygienic conduct methods

in your kitchens. With our comprehensive documentation we

guarantee that you can fulfil your statutory duties. These include

safety data sheets, documents for storage and transport,

operating instructions, procedure documentation, cleaning and

disinfection schedules, leaflets and training documents.

Winterhalter Commercial

Dishwashers & Systems Ltd

Winterhalter House, Roebuck Way,

Knowlhill, Milton Keynes MK5 8WH

Tel 01908 359000 - Sales

Tel 01908 359059 - Service

Fax 01908 359060

www.winterhalter.co.uk

[email protected]

Winterhalter Chemicals

Documents

Transcript of Winterhalter Chemicals