Why Do We Need Proteins?

19

description

Why Do We Need Proteins?. Cell Structure Cell = 80% protein. Cell membrane. Why Do We Need Proteins?. Cell Processes Hormones (signals) Enzymes (speed up reactions). Why Do We Need Proteins?. Membrane Channels (remember transport?) Neurotransmitters (carry nerve/brain messages). - PowerPoint PPT Presentation

Transcript of Why Do We Need Proteins?

Page 1: Why Do We Need Proteins?
Page 2: Why Do We Need Proteins?

Why Do We Need Proteins?Why Do We Need Proteins?

1.1. Cell StructureCell Structure• Cell = 80% proteinCell = 80% protein

Cell membrane

Page 3: Why Do We Need Proteins?

Why Do We Need Proteins?Why Do We Need Proteins?

2.2. Cell ProcessesCell Processes• Hormones (signals)Hormones (signals)• Enzymes (speed up reactions)Enzymes (speed up reactions)

Page 4: Why Do We Need Proteins?

Why Do We Need Proteins?Why Do We Need Proteins?• Membrane Channels (remember transport?)Membrane Channels (remember transport?)

• Neurotransmitters (carry nerve/brain Neurotransmitters (carry nerve/brain messages)messages)

Page 5: Why Do We Need Proteins?

What Do We Need For What Do We Need For Protein Synthesis?Protein Synthesis?

1.1.DNADNA – Template for making mRNA during Template for making mRNA during

TranscriptionTranscription

Page 6: Why Do We Need Proteins?

What Do We Need For What Do We Need For Protein Synthesis?Protein Synthesis?

2. 2. RNARNAa.a. mRNAmRNA = (messenger RNA) makes = (messenger RNA) makes

and takes copy of DNA to cytoplasmand takes copy of DNA to cytoplasm

b.b. tRNAtRNA = (transfer RNA) Matches w/ = (transfer RNA) Matches w/ mRNA on ribosome and carries AA to mRNA on ribosome and carries AA to add to protein chainadd to protein chain

Page 7: Why Do We Need Proteins?

What Do We Need For What Do We Need For Protein Synthesis?Protein Synthesis?

3. 3. RibosomeRibosome

Reads mRNAReads mRNA

Directs tRNADirects tRNA

Creates peptide bonds between AAsCreates peptide bonds between AAs

(makes polypeptide chain)(makes polypeptide chain)

Page 8: Why Do We Need Proteins?

What Do We Need For What Do We Need For Protein Synthesis?Protein Synthesis?

4. 4. Amino AcidsAmino Acids (AAs) (AAs)• Building blocks of proteins Building blocks of proteins

(20 AAs exist)(20 AAs exist)• Protein = AA chain Protein = AA chain

= polypeptide chain= polypeptide chain• ORDER MATTERS!ORDER MATTERS!

AA order determines function of proteinAA order determines function of protein

Page 9: Why Do We Need Proteins?

Steps of Protein SynthesisSteps of Protein Synthesis1.1. Transcription (writing the “message”)Transcription (writing the “message”)

DNADNAmRNAmRNA

messenger carries code to cytoplasmmessenger carries code to cytoplasm

2.2. Translation (reading the “message”)Translation (reading the “message”)

mRNA mRNA tRNA tRNA protein (AA chain)protein (AA chain)

message translated into a message translated into a proteinprotein

Page 10: Why Do We Need Proteins?

Steps of Protein SynthesisSteps of Protein Synthesis

(Nucleus)

(Cytoplasm)

Page 11: Why Do We Need Proteins?

TranscriptionTranscription

DNA to mRNADNA to mRNA

1.1. Location = nucleusLocation = nucleus

2.2. StepsSteps

a. a. EnzymeEnzyme binds to DNA, unzips it binds to DNA, unzips it

b. mRNA copy of gene made from DNA b. mRNA copy of gene made from DNA templatetemplate

*U replaces T in RNA*U replaces T in RNA

Page 12: Why Do We Need Proteins?

TranscriptionTranscription

3 DNA nucleotides (3 DNA nucleotides (triplettriplet) to ) to mRNA mRNA codoncodon

Codons

Page 13: Why Do We Need Proteins?

TranslationTranslationmRNA to tRNA to protein (AA chain)mRNA to tRNA to protein (AA chain)

Location = cytoplasmLocation = cytoplasm

(first (first codoncodon in mRNA is the in mRNA is the start codonstart codon))

Page 14: Why Do We Need Proteins?

TranslationTranslation

Steps of TranslationSteps of Translation

1. mRNA moves to cytoplasm, binds to 1. mRNA moves to cytoplasm, binds to ribosomeribosome

2. tRNA 2. tRNA anticodonanticodon UAC brings AA UAC brings AA (methionine) to mRNA (methionine) to mRNA codoncodon on on ribosomeribosome

Page 15: Why Do We Need Proteins?

TranslationTranslation3. Ribosome moves down mRNA to next 3. Ribosome moves down mRNA to next codoncodon

4. tRNA 4. tRNA anticodonanticodon brings & attaches next AA brings & attaches next AA with peptide bondwith peptide bond

Page 16: Why Do We Need Proteins?

TranslationTranslation

55. tRNA. tRNA leaves ribosome leaves ribosome

once AA attachedonce AA attached

tRNA

mRNA

AA

Protein chain

Page 17: Why Do We Need Proteins?

TranslationTranslation6. Steps 1-5 repeated, adding AAs6. Steps 1-5 repeated, adding AAs

until until STOP CODONSTOP CODON signals end of signals end of proteinprotein

7. Polypeptide chain released from ribosome7. Polypeptide chain released from ribosome

Page 18: Why Do We Need Proteins?

Synthesis PracticeSynthesis Practice

ACUUGAACTAGAUCUAGAUAUAUATATCCUGGACCTGGACCUGGAUACAUGTAC

tRNA(anti-codon)

mRNA(codon)

DNA(triplet)

Page 19: Why Do We Need Proteins?

Synthesis PracticeSynthesis Practice

ACTACTAGAAGATATTATCCTCCTGGAGGATACTAC

DNADNA(triplet)(triplet)

ACUACUUGAUGAAGAAGAUCUUCUUAUUAUAUAAUACCUCCUGGAGGAGGAGGACCUCCUUACUACAUGAUG

tRNAtRNA(anti-(anti-

codon)codon)

mRNAmRNA(codon)(codon)

StopStop

SerSerSerineSerine

IleIleIsoleucineIsoleucine

GlyGlyGlycineGlycine

ProProProlineProline

Met (Start)Met (Start)MethionineMethionine

AminoAmino

AcidAcid