“Whats new in Campylobacter infection”
-
Upload
alden-pennington -
Category
Documents
-
view
37 -
download
3
description
Transcript of “Whats new in Campylobacter infection”
“Whats new in Campylobacter infection”
Andrew Fox
Health Protection /Agency NorthWest
Laboratory reporting of selected GI pathogens Laboratory reporting of selected GI pathogens in England & Wales - 1977 to 2002.in England & Wales - 1977 to 2002.
0
10
20
30
40
50
60
1977 1979 1981 1983 1985 1987 1989 1991 1993 1995 1997 1999 2001
Year
Lab
rep
orts
(10
00's
)
Campylobacters
Salmonellas
Rotavirus
Shigellas
Cryptosporidium
Norovirus
Campylobacter StatisticsCampylobacter Statistics
50,000+ confirmed cases in England and Wales (CDR)50,000+ confirmed cases in England and Wales (CDR)Estimated 400,000+ infections annually (IID study)Estimated 400,000+ infections annually (IID study)0.1% cases develop GBS (US estimate)0.1% cases develop GBS (US estimate)0-5% cases develop reactive arthritis (Scandinavia)0-5% cases develop reactive arthritis (Scandinavia)0.3-5.9% case develop bacteraemia (UK)0.3-5.9% case develop bacteraemia (UK)10% cases hospitalised, 5 days10% cases hospitalised, 5 daysMeningitis, Cholecystitis, Pancreatitis, Hepatitis,Meningitis, Cholecystitis, Pancreatitis, Hepatitis,Peritonitis, Myocarditis, Abcess ……Peritonitis, Myocarditis, Abcess ……
BUT…BUT…
Common source outbreaks are rarely identified and the source of the majority of cases reported in the UK is unknown. In one case control study, epidemiology of infection for over 60% of cases remained unknown.
There’s a lot of it about…There’s a lot of it about…
Transmission pathways forTransmission pathways for Campylobacter Campylobacter INFECTIONINFECTION
Campylobacter worldCampylobacter world
Selective cultureEnrichment culture
SerotypingSerotype specific phage typingPlasmid profiling
PFGE
Antibiograms
S.enteritidis PT4
S.typhimuriumDT104
S.virchow
S.ealing
S.goldcoast
S.typhi
The world of Salmonella EntericaThe world of Salmonella Enterica
Selective culture
Enrichment culture (foods)
Typing methodsCampylobacter spp.
Campylobacter world
PhenotypingPhenotyping
• SerotypingSerotyping– Penner serotyping (HS)Penner serotyping (HS)
• 65 serotypes65 serotypes– Lior serotypingLior serotyping (HL) (HL)
• >100 serotypes>100 serotypes– Colindale (modified HS)Colindale (modified HS)
• PhagetypingPhagetyping– Preston/Krakhria-Lior/Grajewski/ColindalePreston/Krakhria-Lior/Grajewski/Colindale
• BiotypingBiotyping– PrestonPreston
Problems with phenotypingProblems with phenotyping
• Isolates which fail to reactIsolates which fail to react
• Need to constantly expand reagent panelNeed to constantly expand reagent panel
• Limited availability of reagentsLimited availability of reagents
• Lack of standardisation Lack of standardisation
• Variable expressionVariable expression
Molecular sub-typing for Molecular sub-typing for C.jejuniC.jejuni
• Restriction endonuclease analysisRestriction endonuclease analysis• RFLPsRFLPs• RibotypingRibotyping• PFGEPFGE• fla fla typingtyping• PCR RFLPPCR RFLP• RAPDRAPD• ERICsERICs
But problems remain, Ambiguities need combinationsStandardisationRoll out
CrossroadsCrossroads
control and prevention
population genetics
Ambiguous typing
epidemiology
sporadic infection
Campylobacter infection
Campylobacter isolate Campylobacter isolate characterisationcharacterisation
• Is central to disease surveillance and Is central to disease surveillance and epidemiology, requiring methods that epidemiology, requiring methods that are are – accurateaccurate
– comprehensivecomprehensive
– reproduciblereproducible
Multilocus sequence typing Multilocus sequence typing (MLST)(MLST)
Chromosomal DNAAmplify 450-bp
fragments of seven house-keeping genes
Compare sequences of each gene fragment with the known alleles at the locus
Assign alleles at the seven loci to give the allelic profile
Compare the allelic profile with those of isolates within a central database via the internet and assign a sequence type (ST)
Sequence the seven gene fragments on both strands
C. jejuni sequence typesNameName aspAaspA glnAglnA gltAgltA glyAglyA pgmpgm tkttkt uncAuncA
ST-21ST-21 2 2 1 1 1 1 3 3 2 2 1 1 5 5ST-45ST-45 4 4 7 7 10 10 4 4 1 1 7 7 1 1ST-206ST-206 2 2 21 21 5 5 37 37 2 2 1 1 5 5ST-61ST-61 1 1 4 4 2 2 2 2 6 6 3 3 17 17ST-48ST-48 2 2 4 4 1 1 2 2 7 7 1 1 5 5ST-257ST-257 9 9 2 2 4 4 62 62 4 4 5 5 6 6ST-353ST-353 7 7 17 17 5 5 2 2 10 10 3 3 6 6ST-42ST-42 1 1 2 2 3 3 4 4 5 5 9 9 3 3ST-403ST-403 10 10 27 27 16 16 19 19 10 10 5 5 7 7ST-52ST-52 9 9 25 25 2 2 10 10 22 22 3 3 6 6ST-177ST-177 17 17 2 2 8 8 5 5 8 8 2 2 4 4ST-354ST-354 8 8 10 10 2 2 2 2 11 11 1212 6 6ST-22ST-22 1 1 3 3 6 6 4 4 3 3 3 3 3 3ST-433ST-433 2 2 59 59 4 4 38 38 17 17 1212 35 35ST-362ST-362 1 1 2 2 49 49 4 4 11 11 6666 8 8ST-179ST-179 1 1 6 6 7 7 2 2 40 40 3232 3 3ST-49ST-49 3 3 1 1 5 5 17 17 11 11 1111 6 6
Genetic diversity within Penner Genetic diversity within Penner serotypesserotypes
Penner serotype Number of STs1 322 334 125 86 8
Population diversity of C. jejuni
Diversity Index
Serotype and phagetype 0.989
Serotype, phage and biotype 0.997
Combined genotype 0.930
MLST 0.99
Do we need yet another typing scheme for Campylobacter?
• A nucleotide sequence based approach capitalises on technology which is largely automated and increasingly applied to the characterisation of pathogens
Advantages of MLST
• The technique is portable, reproducible and relatively quick, easy and cheap to perform
• Unlike antigen and antibiotic resistance genes, housekeeping genes are selectively neutral
• Freedom from reliance on serological typing reagents which are becoming more difficult to produce (recent changes in Animal Procedures Act)
Frequency of clonal complexes in Frequency of clonal complexes in different sample sources (n=160)different sample sources (n=160)
SourceSource ST-21ST-21 ST-45ST-45 ST-61ST-61
Ruminant 35 (41%) 11 (13%) 17 (20%)
Avian 3 (11%) 10 (35%) _ _
Wild mammal 5 (21%) 9 (37%) 2 (9%)
Environment 1 (5%) 10 (48%) 1 (5%)
Comparison of the frequency of ST-Comparison of the frequency of ST-complexes from animal and environmental complexes from animal and environmental
sources with human infectionssources with human infections
0
5101520
25303540
4550
Fre
qu
ency
(%
)
ST-21 ST-45 ST-61
RuminantAvianWild mammalEnvironmentHuman infection
Preston 2000 isolates
Number of Clonal Complexes
17
Number of Sequence Types
58
Number of HS serotypes
28
Preston 2000 isolates ST clusters versus
HS serotype ST No isolates HS serotype
ST-104 5 HS 5(1); HS 16(1); HS 50(2);HS NT(1)
ST-45 4 HS 12(3);HS NT(1)
ST-262 2 HS NT
ST-19 2 HS NT
Clonal Complexes for C.jejuni isolated from GI infections in Preston area NW
England
0
5
10
15
20
25
ST-21ST-45ST-205ST-47ST-61ST-19ST-53ST-311ST-17
Comparison of clonal complexes for UK human infections: 1991-2000
0%
20%
40%
60%
80%
100%
1991 2000
UAST-61ST-48ST-45ST-257ST-21ST-206
Glastonbury outbreak
OutbreakOutbreak aspAaspA glnAglnA gltAgltA glyAglyA pgmpgm tkttkt uncAuncA ST ST FlaSVRFlaSVRKettering 93Kettering 93 2 21 5 37 2 1 8 206 11 Kettering 93Kettering 93 2 21 3 37 2 1 5 206 11 Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 1 7 3 4 8 9 5 42 9Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 2 21 3 37 2 1 5 206 11Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 1 7 3 4 8 9 5 42 9Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 2 21 3 37 2 1 5 206 11Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 2 21 3 37 2 1 5 206 11
FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11
Glastonbury 93Glastonbury 93 1 4 2 2 6 3 17 61 14Glastonbury 93Glastonbury 93 1 4 2 2 6 3 17 61 14
Investigation of outbreak isolates with MLSTInvestigation of outbreak isolates with MLST
HS1PT76
HS2PT52
HS4PT121
HS4 PT55
HS11PT90
HS19PT90
ST 21 Complex
ST-61
ST 17
ST 22
Multilocus sequence typing of C.jejuni
Detection and report of Camp spp.by EIA or PCR
DNA Purification and typing
Further report to GP, EHO, CCDC, RE
24 - 48 hours
24 - 48 hours
24 hours
3 - 5 days
Cluster analysis and investigation
Campylobacter detection and typing from
faeces or foods - future prospects
C. jejuni sequence typesNameName aspAaspA glnAglnA gltAgltA glyAglyA pgmpgm tkttkt uncAuncA
ST-21ST-21 2 2 1 1 1 1 3 3 2 2 1 1 5 5ST-45ST-45 4 4 7 7 10 10 4 4 1 1 7 7 1 1ST-206ST-206 2 2 21 21 5 5 37 37 2 2 1 1 5 5ST-61ST-61 1 1 4 4 2 2 2 2 6 6 3 3 17 17ST-48ST-48 2 2 4 4 1 1 2 2 7 7 1 1 5 5ST-257ST-257 9 9 2 2 4 4 62 62 4 4 5 5 6 6ST-353ST-353 7 7 17 17 5 5 2 2 10 10 3 3 6 6ST-42ST-42 1 1 2 2 3 3 4 4 5 5 9 9 3 3ST-403ST-403 10 10 27 27 16 16 19 19 10 10 5 5 7 7ST-52ST-52 9 9 25 25 2 2 10 10 22 22 3 3 6 6ST-177ST-177 17 17 2 2 8 8 5 5 8 8 2 2 4 4ST-354ST-354 8 8 10 10 2 2 2 2 11 11 1212 6 6ST-22ST-22 1 1 3 3 6 6 4 4 3 3 3 3 3 3ST-433ST-433 2 2 59 59 4 4 38 38 17 17 1212 35 35ST-362ST-362 1 1 2 2 49 49 4 4 11 11 6666 8 8ST-179ST-179 1 1 6 6 7 7 2 2 40 40 3232 3 3ST-49ST-49 3 3 1 1 5 5 17 17 11 11 1111 6 6
AACTGGGTCCAGGCAACATCATTATCCGG
AACTGGGTCGAGGCAACATCATTATCCGG
Single Nucleotide Polymorphisms
Place and Time and Type
7 cases in 20 days
21 cases all year in NW and S Lancs HA
C.jejuni HS11 PT1
The Iceland Experiment
1.Public awareness campaign2.Frozen chicken
USDA Intervention studies Norman Stern
• Novel biological agents to reduce or eliminate Campylobacter from chicken intestinal flora– Competitive exclusion
• Bacteriocins– 15 trials
– Administer bacteriocin 5 days before slaughter
– 5-fold or total reduction in Campylobacter from chicken at slaughter
Acknowledgements
Preston PHLEric BoltonRoisin UreDavid Wareing (Dynal Biotech)
WCIED, OxfordFrances CollesKate DingleMartin MaidenRachel Urwin
University of StaffordshireMishele BarrigasPete Gowland
DEFRA Epidemiology Unit,University of LiverpoolNigel FrenchRichard KempHoward Leatherbarrow