Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW...

Welcome to Part 3 of Bio 219Lecturer – David Ray

Contact info:Office hours – 1:00-2:00 pm MTW

Office location – LSB 5102Office phone – 293-5102 ext 31454E-mail – [email protected]

Lectures are available online athttp://www.as.wvu.edu/~dray

go to ‘Teaching’ link

mailto:[email protected]

http://www.as.wvu.edu/~dray

How Genes and Genomes Evolve

Variation

• There is obviously variation among and within taxa.

• How does the variation arise in genomes?• Are there patterns to the variation?• How is the variation propagated?• What questions can be addressed using

the variation?• What patterns exist in humans with regard

to genomic variability?

Generating Genetic Variation

• Somatic vs. germ line cells– Somatic cells – “body” cells, no long term

descendants, live only to help germ cells perform their function.

– Germ cells – reproductive cells, give rise to descendants in the next generation of organisms.


• Somatic vs. germ line mutations– Somatic mutations – occur in somatic cells

and will only effect those cells and their progeny, cannot not be passed on to subsequent generations of organisms.

– Germ mutations – can be passed on to subsequent generations.


• Five types of change contribute to evolution.– Mutation within a gene– Gene duplication– Gene deletion– Exon shuffling– Horizontal transfer – rare in Eukaryotes


• Most changes to a genome are caused by mistakes in the normal process of copying and maintaining genomic DNA.

• Mutations within genes– Point mutations – errors in replication at

individual nucleotide sites occur at a rate of about 10-10 in the human genome.

– Most point mutations have no effect on the function of the genome – are selectively neutral.


• DNA duplications– Slipped strand mispairing– Unequal crossover during recombination


• Gene duplication allows for the acquisition of new functional genes in the genome


• Gene Duplication: the globin family– A classic example of gene duplication and evolution– Globin molecules are involved in carrying oxygen in

multicellular organisms– Ancestral globin gene (present in primitive animals)

was duplicated ~500 mya.– Mutations accumulated in both genes to differentiate

them - α and β present in all higher vertebrates– Further gene duplications produced alternative forms

in mammals and in primates


Mammals

Primates

• Gene Duplication– Almost every gene in the vertebrate genome

exists in multiple copies– Gene duplication allows for new functions to

arise without having to start from scratch– Studies suggest the early in vertebrate

evolution the entire genome was duplicated at least twice


• Exon Duplication– Duplications are not limited to entire genes– Proteins are often collections of distinct amino

acid domains that are encoded by individual exons in a gene

– The separation of exons by introns facilitates the duplication of exons and individual gene evolution


• Exon Shuffling– The exons of genes can sometimes be

thought of as individual useful units that can be mixed and matched through exon shuffling to generate new, useful combinations


Review from last week• Overall theme – There are lots of ways to create genetic variation.

Genetic variation is the basis of evolutionary change but the variation must be introduced into the germ line to contribute to evolutionary change.

• Two cell lines in multicellular organisms– Somatic – short term genetic repository– Germ line – long term genetic repository

• Variation that occurs in the germ line are the only ones that can contribute to evolutionary change

• Genetic variation can be accumulated through various events– Mutations in genes – point mutations– DNA duplications – microsatellites (small), unequal crossover (large)– Gene and exon duplications are the major method for generating new

gene functions– Exon shuffling can produce new gene functions by creating new

combinations of functional exons/protein domains

• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis– Homologous and non-homologous

recombination


• What are mobile elements and how do they work?– Fragments of DNA that can copy itself and

insert those copies back into the genome– Found in most eukaryotic genomes– Humans – Alu (SINE); Ta, PreTa (LINEs);

SVA; plus several families that are no longer active


Pol III transcription

Reverse transcription and insertion

1. Usually a single ‘master’ copy

2. Pol III transcription to an RNA intermediate

3. Target primed reverse transcription (TPRT) – enzymatic machinery provided by LINEs

Generating Genetic Variation:Normal SINE mobilization


• Mobile elements contribute to genome evolution in several ways– Exon shuffling

Generating Genetic Variation:Exon shuffling via SINE mobilization

exon 1 SINE

intron

exon 2

SINE transcription can extend past the normal stop signal

Reverse transcription creates DNA copies of both the SINE and exon 2

DNA copy of transcript

Reinsertion occurs elsewhere in the genome

SINE exon 2


• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis

• The insertion of mobile elements can disrupt gene structure and function

ALU INSERTIONS AND DISEASE

LOCUS DISTRIBUTION SUBFAMILY DISEASE REFERENCE

BRCA2 de novo Y Breast cancer Miki et al, 1996Mlvi-2 de novo (somatic?) Ya5 Associated with

leukemiaEconomou-Pachnis andTsichlis, 1985

NF1 de novo Ya5 Neurofibromatosis Wallace et al, 1991APC Familial Yb8 Hereditary desmoid

diseaseHalling et al, 1997

PROGINS about 50% Ya5 Linked with ovariancarcinoma

Rowe et al, 1995

Btk Familial Y X-linkedagammaglobulinaemia

Lester et al, 1997

IL2RG Familial Ya5 XSCID Lester et al, 1997Cholinesterase one Japanese family Yb8 Cholinesterase

deficiencyMuratani et al, 1991

CaR familial Ya4 Hypocalciurichypercalcemia and

neonatal severehyperparathyroidism

Janicic et al, 1995

C1 inhibitor de novo Y Complement deficiency Stoppa Lyonnet et al, 1990ACE about 50% Ya5 Linked with protection

from heart diseaseCambien et al, 1992

Factor IX a grandparent Ya5 Hemophilia Vidaud et al, 19932 x FGFR2 De novo Ya5 Apert’s Syndrome Oldridge et al, 1997GK ? Sx Glycerol kinase

deficiencyMcCabe et al, (personalcomm.)


• Gene expression alteration via a P-element mobilization in Drosophila


• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis

• The insertion of mobile elements can disrupt gene structure and function

– Homologous and non homologous recombination

• 10,000 – 1,000,000 + nearly identical DNA fragments scattered throughout the genome


Unequal crossover due to non-homologous recombination

ALU/ALU RECOMBINATION AND GERM-LINE DISEASE

LOCUS DISTRIBUTION DISEASE REFERENCE

8 x LDLR

Kindreds Hypercholesterolemia Lehrman et al, 1985, 1987 Yamakawa et al, 1989 Rudiger et al, 1991 Chae et al, 1997

5 x -globin Kindreds -thalassaemia Nicholls et al, 1987 Flint et al, 1996 Harteveld et al, 1997 Ko et al, 1997

5 x C1 inhibitor

Kindreds Angioneurotic adema Stoppa-Lyonnet et al, 1990 Ariga et al, 1990

C3 Kindred C3 deficiency Botto et al, 1992 HPRT Individual

Lesch-Nyhan

syndrome Marcus et al, 1993

DMD Kindred Duchenne’s muscular dystrophy

Hu et al, 1991

ADA Individual ADA deficiency-SCID Markert et al, 1988

Ins. Rec. Individual Insulin-independent diabetes

Shimada et al, 1990

Antithrombin Individual Thrombophilia Olds et al, 1993 XY Individual XX male Rouyer et al, 1987 Lysyl hydroxylase Kindreds Ehlers-Danlos

syndrome Pousi et al, 1994

ALU/ALU RECOMBINATION AND CANCER

LOCUS DISTRIBUTION MECHANISM DISEASE REFERENCE

10 xALL-1

Somatic Alu-Alu recombDup. intron 1-6

Acutemyelogenous

leukemia

Strout et al, 1998So et al, 1997;Schichman et al,1994

7 xBCR/Abl

Somatic X-Alu recomb. CML Jeffs et al, 1998Chen et al, 1989de Klein et al, 1986

All-1/AF9 Somatic Alu-Alutranslocation

Acutemyelogenous

leukemia

Super et al, 1997

2 xBRCA1

Somatic &A kindred

Alu-Alu recomb(del exon 17; del.

Promoter)

Breast cancer Puget et al, 1997Swensen et al,1997

2 xMLH1

2 kindreds Alu-Alu recomb.(del exon 16)(exons 13-16)

HNPCC Nystrom-Lahti etal, 1995Mauillon et al,1996

TRE Somatic InterchromosomalAlu-Alu recomb

Ewing's sarcoma Onno et al, 1992

RB Common Alu-Alu recomb.(799 bp del.)

Association withglioma

Rothberg et al,1997

EWS Subset of Africans Alu-Alu recomb.(del 2 kb)

Protective againstEwing Sarcoma?

Zucman-Rossi etal, 1997


• Gene transfer can move genes between entire genomes– Horizontal gene transfer

– Main problem with the development of drug resistant strains of bacteria

Generating Genetic Variation• Bacterial conjugation

Reconstructing Life’s Tree

• Evolutionary theory predicts that organisms that are derived from a common ancestor will share genetic signatures

• Organisms that shared an ancestor more recently will be more similar than those that shared a more distant common ancestor

• Similarity can include sequence composition, genome organization, presence/absence of mobile elements, presence/absence of gene families, etc.

09_15_Phylogen.trees.jpg

09_16_Ancestral.gene.jpg

09_22_genetic.info.jpg

09_17_Human_chimp.jpg

Chromosome 1

Review from last time• Overall themes: Genetic variation can be introduced due to the

activities and presence of mobile elements (MEs); Genetic information can be introduced into organisms through horizontal transfer.

• MEs are fragments of DNA that can make copies of themselves and insert those copies back into the genome– MEs can lead to variation through exon shuffling, insertion mutagenisis,

and recombination– Many human diseases are the result of MEs

• Horizontal transfer can introduce genetic variation into bacteria via the process of conjugation

• Introduction of concepts for discussion of “Reconstructing life’s tree”– All sorts of variation provide information on the relationships among

organisms– Homology – derived from the same ancestral source– Phylogeny – a reconstruction of relationships based on observations

• Basic terms – Homologous – derived from a common

ancestral source– Phylogeny – a reconstruction of relationships

based on observed patterns


• Homologous genes can be recognized over large amounts of evolutionary time


• Homologous genes can be recognized over large amounts of evolutionary time

• Why?– Selectively advantageous genes and

sequences tend to be conserved (preserved)– Selectively disadvantageous genes and

sequences are tend not to be passed on to offspring



• Most DNA of most genomes is non-coding– Changes to much of this DNA are selectively neutral –

cause no harm or good to the genome– Different portions of the genome will therefore diverge

at different rates depending on their function

The neutral regions tend to change in a clock-like fashion– We can estimate divergence times for certain groups

09_19_human_mouse1.jpg

• Most DNA of most genomes is non-coding– Changes to much of this DNA are selectively neutral –

cause no harm or good to the genome– Different portions of the genome will therefore diverge

at different rates depending on their function

• The neutral regions tend to change in a clock-like fashion– We can estimate divergence times for certain groups


• The accumulation of changes can be quantified by several logical methods– Parsimony – the best hypothesis is the one

requiring the fewest steps (i.e. Occam’s razor)– Distance – count the number of differences

between things, the ones with the fewest numbers of differences are most closely related

– Sequence based models – take into account what we know about the ways sequences change over time


• These slides and the sequence files used to produce them are available as a supplement on the class website:

• DNA sequence from six taxa

Reconstructing Life’s Tree: An example using distance

human

Sumatran orangBornean orang

bonobo chimpcommon chimp

gorilla

ATGGCT AAGACG AAGACTCAGGCTCAGGCT

T-A

A-C

A-C

Reconstructing Life’s Tree: An example using parsimony

ATGGCT AAGACG AAGACTCAGGCTCAGGCTATGGCT AAGACG AAGACTCAGGCTCAGGCTATGGCT AAGACG AAGACTCAGGCTCAGGCT

T-G

G-AG-A

6 steps

ATGGCT AAGACG AAGACTCAGGCT CAGGCT

T-A

G-A

T-G

A-C

G-A

5 steps


ATGGCT AAGACGAAGACT CAGGCT CAGGCT

T-A

G-A

T-G

A-C

4 steps


• The accumulation of changes can be quantified by several logical methods

• The accumulation of mobile elements provides a nearly perfect record of evolutionary relationships


Phylogenetic Inference Using SINEs

Species A Species DSpecies CSpecies B

Phylogenetic Inference Using SINEs

Resolution of the Human:Chimp:Gorilla Trichotomy

(H,C)G

(H,G)C

(C,G)H

(H,C,G)

http://www.wildlifewebsite.com/ape-pictures/chimpanzee-36.html




Phylogenetic Analysis

PCR of 133 Alu loci 117 Ye5 13 Yc1 1 Yi6 1 Yd3 1 undefined subfamily

PNAS (2003) 22:12787-91

Alu Elements and Hominid Phylogeny

PNAS (2003) 22:12787-91

Review from last time

• The variation that is present in genomes allows us to make determinations about the relationships among living things

• Different parts of the genome accumulate variation at different rates depending on their function (or lack thereof)

• The presence of different rates allows for different questions to be addressed depending on the level of divergence

• Several methods are available to analyze variation for phylogenetic signal– Parsimony, distance, sequence based models

• Patterns of mobile element insertion can be used to infer relationships among taxa

• Much of the “junk” DNA is dispensible– The Fugu (Takifugu rubripes) genome is

almost completely devoid of unnecessary sequences

– Exon number and organization is similar to mammals

– Compared to other vertebrates• Intron size (not number) is reduced• Intergenic regions are reduced in size• No mobile elements


09_21_Fugu.introns.jpg

• Using all of the available information, we can reconstruct relationships between organisms back to the earliest forms of life


• The human genome is large and complex– 23 pairs of chromosomes– ~3.2 x 109 (3.2 billion) nucleotide pairs– Human genome composition

Our Own Genome

09_26_noncoding.jpg

09_25_Chromosome22.jpg

• Nuclear genome–3300 Mb–23 (XX) or 24 (XY) linear chromosomes–30-35,000 genes–1 gene/40kb–Introns–3% coding–Repetitive DNA sequences (45%)

Our Own Genome

• The human genome is large and complex– 23 pairs of chromosomes– ~3.2 x 109 (3.2 billion) nucleotide pairs– Human genome composition– The human genome project was one of the

largest undertakings in human history

Our Own Genome

• Progress in human genome sequencing– Hierarchical vs. whole genome shotgun

(WGS) sequencing– Repetitive DNA represents a significant

problem for WGS sequencing in particular

Our Own Genome

10_09_Shotgun.sequenc.jpg

08_03.jpg

• Progress in human genome sequencing– Hierarchical vs. whole genome shotgun

(WGS) sequencing– Repetitive DNA represents a significant

problem for WGS sequencing in particular

Our Own Genome

10_10_Repetit.sequence.jpg

• Progress in human genome sequencing– Hierarchical vs whole genome shotgun

sequencing– Repetitive DNA represents a significant

problem for WGS sequencing in particular–Landmark papers in Nature and Science

(2001)• Venter et al Science 16 February 2001; 291: 1304-

1351 • Lander et al Nature 409 (6822): 860-921

Our Own Genome

• A typical high-throughput genomics facility

Our Own Genome

• Exploring and exploiting the genome sequences

• BLAST/BLAT and other tools– BLAST - Basic local alignment search tool

• Input a sequence and find matches to human or other organisms

– publication information– DNA and protein sequence (if applicable)

Our Own Genome

• Exploring and exploiting the genome sequences

• BLAST/BLAT and other tools– BLAT – BLAST-like alignment tool

• A “genome browser”• Genomes available :

– human, chimp, rhesus monkey, dog, cow, mouse, opossum, rat, chicken, Xenopus, Zebrafish, Tetraodon, Fugu, nematode (x3), Drosophila (x10), Apis (x3), Saccharomyces (yeast), SARS

• example: chr6:121,387,504-121,720,836

Our Own Genome

Query sequence - Callithrix Human ortholog

Our Own Genome• BLAT can be used to make direct comparisons between

our genome and others.

• Comparisons with other genomes inform us about our own–Important genes and regulatory sequences

can easily be identified if they are conserved between genomes

Our Own Genome

• Human variation–~0.1% difference in nucleotide sequence

between any two individual humans–Translates to about 3 million differences in the

genome–Most of these differences are Single

Nucleotide Polymorphisms (SNPs)–We can use these differences to investigate

human variation, population structure and evolution

Our Own Genome

• Human evolution–Coalescence analyses (mtDNA and Y

chromosome)–Mutiregional vs. Out of Africa

• Predictions of the Multiregional Hypothesis– Equal diversity in human subpopulations– No obvious root to the human tree

• Predictions of the Out of Africa Hypothesis– Higher diversity in African subpopulations– Root of the human tree in Africa

Our Own Genome

Population Relationships Based on 100 Autosomal

Alu Elements

Africa

Asia

Europe

S. India

• Human evolution–Higher diversity in African subpopulations

• Insulin minisatellite Table 12.6 in text• 22 divergent lineages exist in the human

population• All are found in Africa. Only 3 are found outside of

Africa.

Our Own Genome

• Interpreting the information generated by the human genome project–The complexity of genome function makes

interpretation difficult–Ex. What are the regulatory sequences?–Ex. Exons can be spliced together in different

ways in different tissues

Our Own Genome

09_30_alt.splice.RNA.jpg

Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW...

Documents

Transcript of Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW...