Thesis submitted to the University of Karachi in partial fulfillment of the requirement for the Degree of Doctor of Philosophy in Marine Biology

By

YASMEEN ZAMIR AHMED

M.Sc (Microbiology)

CENTRE OF EXCELLENCE IN M A R I N E B I O L O G Y

UNIVERSITY OF KARACHI

KARACHI-75270, PAKISTAN

October, 2016

MICROBIAL COMMUNITY AND ITS ROLE

IN MANGROVE ECOSYSTEM

i

به نام خدا

AL-KABIR

He is the one who has set free the two kinds of water, one sweet and

palatable, and the other salty and bitter. And He has made between them a

barrier and a forbidding partition.

(Quran, 25:53)

It has been discovered that what distinguishes fresh water from salt water

in estuaries is a “pycnocline zone with a marked density discontinuity

separating the two layers.” This partition (zone of separation) has a

different salinity from the fresh water and from the salt water.

(A brief illustrated guide to understanding Islam. 2nd edition, I.A.

Ibrahim pg., 18)

ii

DEDICATED TO

MY BELOVED PARENTS

PAPA, NAWAZ

‘He didn’t tell me how to live; he lived, and let me watch him do it’ (Clarence Kelland)

AMMI, NARGIS

She’s made of those rare elements that now and then appear,

As if remov’d by accident unto a lesser sphere,

Forever reaching up, and on, to life’s sublimer things, As if they had been used to track the universe with wings.

(A PORTRAIT by Nathaniel Parker Willis)

MY UNCLE MIRAJUDDIN KHAN

Thank you for always being there,

And showing me that you truly care. (Brittany S. Wright)

AND MY FRIENDS & FAMILY

Thank You for All Your Prayers and Moral Support

iii

iv

ABSTRACT

The aim of current experimental work was to explore the importance of microbial

mat present at the mangrove area of Sandspit backwaters, Karachi. The first chapter consists

of an introduction to mangroves in general. In chapter 2, nutrients in the backwater channels

were studied. It was found that nutrient levels were more on site where mat was present as

compared to without mat site. Overall phosphate levels were high throughout all seasons and

the nutrient levels were found in the following order phosphate>ammonium>nitrate>nitrite.

In chapter 3, it was observed that the presence or absence of microbial mat directly influence

the soil. The soil covered with mat have increased water retention, low salinity and pH, high

carbon as compared to soil without mat. In chapter 4, the seasonal rates of potential

nitrification were examined. This process is a significant step in nitrogen cycle and involves

the conversion of ammonium into nitrate. Although there were no drastic changes in rates

with respect to seasons, the presence of microbial mat significantly affects the rates of

potential nitrification. In chapter 5, microbial mats were surveyed. The primary members of

mat include few protozoa, cyanobacteria, bacteria and diatoms. The filamentous forms of

cyanobacteria were responsible for macroscopic green sheath formation on top soil.

Phormidium tenue, Spirulina labyrinthiformis, Spirulina major, Oscillatoria limosa,

Phormidium breve and Oscillatoria prínceps were present in all seasons. In chapter 6,

cyanobacterial metabolites were inspected. Seawater fraction of Aphanocapsa litoralis and

ethanol fraction of Phormidium breve were active against Candida albicans. Phormidium

breve extract was more cytotoxic (LC50 0.02 mg/ml) against Artemia salina as compared to

Aphanocapsa litoralis extract (LC50 6.2 mg/ml). In chapter 7, metabolites of bacteria

associated with microbial mat were screened. Out of 120 isolates only two isolates SSC1407

(Proteus sp.) and SSC14011 (Klebsiella pneumoniae strain) were found to have some

antagonistic activity against isolates of E. coli and Proteus O respectively. SSC1407

tolerated increased levels of temperature and different types of chemicals. SSC14011

tolerated high pH, UV-rays and also produced higher protein yield after successive

purifications. SSC14011 was slightly more cytotoxic (LC50 0.046 mg/ml) against Artemia

salina than SSC1407 (LC50 0.052mg/ml).

v

خالصہ

( کے عالقے میں موجود Mangrove) تمرکے Sandspit backwaters مقام کے کراچیکا مقصد مقالے تحقیقیموجودہ

غذاباب میں، پانی کے چینل کے دوسرے. ھے گیا کیا بیانعمومی تعارف کا تمر ,باب میں پہلےمشاہدہ کرنا تھا. کا میٹمائکروبیل

( عالقہ کا میٹبغیر مائکروبیل کا احاطہ کے تمر برعکس ) کہکیا گیا مشاہدہ( کا مطالعہ کیا گیا. یہ Nutrient Ionsاجزاء ) بردار

مندرجہ ذیل گُنیااجزاء کی بردار غذاتمام موسموں میں .تھیزیادہ وہاںجہاں موجود تھا میٹمائکروبیل مقداراجزاء کی بردار غذا

باب میں، یہ تیسرے. رہا اِضافہ میں مقدارفاسفیٹ< امونیم< نائٹریٹ< نائیٹریٹ. مجموعی طور پر فاسفیٹ کی گئی پائیترتیب میں

بلبالمقامٹی کے والی میٹاثر انداز ہے. بغیر مائکروبیل پہکی موجودگی براہ راست مٹی میٹمشاہدہ کیا گیا کہ مائکروبیل

نامیاتی اور کمیمیں ایچ پیاور نمکینیت، صالحیتمٹی میں پانی برقرار رکھنے کی والی جانے پائیکے ساتھ میٹمائکروبیل

موسمی شرحوں کی جانچ کی گئی. یہ عمل نائٹروجن کی Nitrificationباب میں، ممکنہ چوتھے .گیا پایااضافہ واضحمیں معیار

شرح میں اسکی. اگرچہ موسموں کے حوالے سے ہے کرتا تبدیلنائٹریٹ میں کوامونیم کہ جوہے عملکے چکر میں ایک اہم

کی شرح Nitrificationکی موجودگی نمایاں طور پر ممکنہ میٹ، مائکروبیل آئی نہیں نظرکوئی تبدیلیاں کر بڑھ سے نظر ُمطمح

نیلے اور سبز، پروٹوزوا)چند( میںباب میں، مائکروبیل میٹ سروے کیا گیا. میٹ کے بنیادی ارکان پانچواں. ہے ہوتیپر اثر انداز

والے ِفالمنت سبز. ہیںشامل ڈایاٹم کائی عصیوی، خمیر اور فُطُر(، بیکٹیریا، cyanobacteria) بیکٹیریا کائی رنگ

cyanobacteria کے عالقے کی زمین پر تمرmacroscopic ہیںکے ذمہ دار بنانے سرپوش ماندسبز. Phormidium tenue

Oscillatoria ر ,Spirulina major, Phormidium breve, Spirulina labyrinthiformis, Oscillatoria limosa او

prínceps باب میں، چھٹےموسموں میں موجود تھے. تمامcyanobacteria مادے متحولکے metabolites معائنہ کیا گیا. کا

Aphanocapsa litoralis فریکشن اور ہوا بنا کاکا سمندری پانیPhormidium breve فریکشن ہوا بنا کا الکُحل ایتھائلکا

Candida Albicans رہا َمعائدانہکے خالف .Phormidium breve عصارہ ستکا ( 50LC 0.02 mg / ml )

Aphanocapsa litoralis ( 506.2 LC mg/ ml کے مقابلے میں )salina Artemia ساتویںسائٹوٹوکسک تھا. زیادہکے خالف

نسلمیں سے صرف دو 120کی جانچ کی گئی. metabolitesکے ساتھ منسلک بیکٹیریا کے میٹباب میں، مائکروبیل

(Proteus sp.) SSC1407 اور(K. pneumoniae strain) SSC14011 بالترتیب نےEscherichia coli اور

Proteus O کیا ظاہر ردعمل ُمخاِصمانَہلیٹس کے خالف آئیسوکے .SSC1407 درجہ حرارت اور کیمیائی مادوں کی مختلف نے

steps تزکیہ مختلفاور کیبرداشت اشعہ- UV، ایچ پی زیادہ نے SSC14011. کیا برداشت متحملمیں اضافہ ارتکازاقسام کی

purifications مالاعلی پروٹین ماحصل زیادہکے بعد .SSC14011 (50LC 0046 mg/ ml )SSC1407 بالمقابل کے

(500.052 LC mg/ ml )Artemia salina ہوا ثابت کے خالف زیادہ سائٹوٹوکسک.

vi

ACKNOWLEDGEMENT

First of all, I would like to thank God Almighty for guiding me through every single step of

my life. I wish to express my sincere gratitude to my supervisor who is also my spiritual parent

and my mentor Dr. Seema Shafique, Assistant Professor, Centre of Excellence in Marine

Biology (C.E.M.B), University of Karachi (UoK). Through her vast experience in field and lab,

she has offered her hands on support 24/7 and guided me through to fulfill this Ph.D. study. I am

sincerely thankful to Prof. Dr. P.J.A. Siddiqui and Miss. Zaib-un-Nisa Burhan, Centre of

Excellence in Marine Biology, for their encouragement, expert advice and recommendations.

Many thanks to Dr. Munawwer Rasheed, Dr. Sher Khan Phanwer and Dr. Amjad Ali, Centre of

Excellence in Marine Biology for giving me full access to their labs. Thank you to Dr. Tariq Ali,

Department of Chemistry, for nitrogen tests and technical support. Dr. Adnan Khan, Department

of Geology, UoK , for granting me permission to use lab, Dr. Aqeel Ahmed, Department of

Microbiology, UoK, for providing clinical cultures and incubation facility, Mr. Faiz

Mohammed, Department of Microbiology, UoK, for PCR analysis, Miss. Samiya Kainat

Department of Microbiology, UoK for providing oxidase reagent, Dr. Faraz Moin, Proteomics

Department, UoK, for SDS-PAGE gel testing, Dr. Erum Hanif, Department of Biotechnology,

UoK for reviving and providing hospital culture especially for my research and Mr. Yousuf

Khan, Centralized Scientific Laboratory, UoK for providing gene sequencing software and

guiding me through BLAST analysis.

Many thanks to following honorable scientists for their comments and suggestions during

the compilation of this thesis, Emeritus Professor of Biology Dr. Stjepko Golubic, Boston

University, USA, Prof. Dr. Sairah Malkin, Assistant Professor, Horn Point Laboratory,

University of Maryland Center for Environmental Science, USA, Dr. Elisa Berdalet, Institute of

Marine Sciences (CSIC), Spain, Prof. Dr. Victor N. de Jonge (DSc), Institute of Estuarine &

Coastal Studies, University of Hull, UK and Dr. Mónica Puyana Hegedus, Bióloga Marina de la

Universidad Jorge Tadeo Lozano, Colombia.

Finally, my sincerest appreciation to all my C.E.M.B., UoK, colleagues particularly, Dr.

Shoaib Kiyani, Dr. Parveez Iqbal, Farah Naz, Ambreen Abbas, Rehan, Dr. Safia Mushtaq, Hina

Jabeen, Fouzia Bibi, Saira Naseem, Sundas Iqbal, Afshan Yasmeen, Mehwish Shoaib, Gul-e-

Zehra Naqvi, Aisha Majid Ali, Rabia Bukahri, Saeedul Bukhari and Noreen Farooq. Thank you

to field and lab attendants Naveed, Assad and drivers Naseer baba, Ibrhim for their assistance.

vii

TABLE OF CONTENTS

Page No.

Abstract iv

Abstract in Urdu v

List of Tables xi

List of Figures xiii

PART I. AN INTRODUCTION TO MANGROVES: ITS IMPORTANCE

AND FACTORS AFFECTING MANGROVE ECOSYSTEM

1

CHAPTER 1. General Introduction 2

1.1. Types of mangrove forests 4

1.2. Distribution of mangroves 4

1.2.1. World wide mangrove distribution 5

1.2.2. Worldwide families of Major mangrove 6

1.2.3. Minor mangrove families 7

1.2.4. Mangrove distribution in Asia 7

1.2.5. Mangrove distribution in Pakistan 10

1.3. Effect of climatic factors on mangrove ecosystem 13

1.3.1. Temperature 14

1.3.2. Salinity 14

1.3.3. Tides 15

1.3.4. Moisture and Rainfall 15

1.3.5. Winds and Storms 16

1.3.6. Nutrients 16

1.4. Commercial and curative aspects of mangrove products 17

1.4.1. Edible and non-edible uses 17

1.4.2. Medicinal uses 19

1.5. Community of flora and fauna associated with mangrove

ecosystem

19

1.5.1. Microbial community a major component of mangrove

ecosystem

22

1.6. Societal aspects of mangrove 24

1.7. Aims and objectives of present research 24

viii

Page No.

PART II. INFLUENCE OF MICROBIAL MAT ON SOIL, NUTRIENTS

AND SEDIMENT POTENTIAL NITRIFICATION OF

MANGROVE ECOSYSTEM

26

CHAPTER 2. Seasonal variations in nutrient levels of Sandspit mangrove

backwaters, Pakistan.

27

2.1. Abstract 28

2.2. Introduction 29

2.3. Material and Methods 31

2.3.1. Site Description 31

2.3.2. Sample Collection 35

2.3.3. Sample Analysis 35

2.3.4. Benthic Flux Formula 36

2.3.5. Statistical Analysis 37

2.4. Results and Discussion 37

2.4.1. Physicochemical properties and Nutrient rates 37

2.4.2. PCA and Cluster Analysis 45

CHAPTER 3. Microbial mats associated with mangroves provide soil

stabilization and modify nutrient chemistry over monsoon cycles:

Sandspit backwaters, Pakistan.

56

3.1. Abstract 57

3.2. Introduction 58

3.3. Material and Methods 61

3.3.1. Site Description 61

3.3.2. Field Sampling 61

3.3.3. Sediment Analysis 62

3.3.4. Channel water analysis 63

3.3.5. Statistical Analysis 63

3.4. Results and Discussion 64

3.4.1. Sediment Characteristics 64

3.4.2. Channel Water Characteristics 75

3.4.3. PCA and Cluster analysis 79

3.4.4. Environmental health and Recreational value 86

CHAPTER 4. Seasonal variations in Potential Nitrification rates in mangrove

sediment at Sandspit backwaters, Karachi, Pakistan.

86

4.1. Abstract 87

4.2. Introduction 88

4.3. Material and Methods 90

4.3.1. Sampling 90

ix

Page No.

4.3.2. Lab and Statistical Analysis 90

4.4. Results and Discussions 91

4.4.1. Physicochemical and Potential Nitrification rates 91

4.4.2. State of Potential Nitrification at Sandspit Mangrove 96

PART III. OBSERVATIONS OF DOMINANT CYANOBACTERIA

FORMING GREEN MICROBIAL MAT AND SCREENING OF

ANTAGONISTIC SUBSTANCES (BACTERIOCINS) FROM

MANGROVE MICRO-ORGANISMS.

99

CHAPTER 5. Seasonal abundance of six dominant filamentous cyanobacterial

species in microbial mats from mangrove backwaters in Sandspit,

Pakistan.

100

5.1. Abstract 101

5.2. Introduction 102

5.3. Material and Methods 104

5.3.1. Field Sampling 104

5.3.2. Physicochemical parameters, Microscopy, Biovolume

and Statistical Analysis

104

5.4. Results and Discussion 105

5.4.1. Physical and Chemical Parameters 105

5.4.2. Identification of Dominant Filamentous Cyanobacteria 108

5.4.3 Significance of Filamentous Cyanobacteria in microbial

mat

117

CHAPTER 6. Screening of antimicrobial and cytotoxic activities of marine

cyanobacteria Aphanocapsa litoralis and Phormidium breve

isolated from Sandspit mangrove forest, Pakistan.

120

6.1. Abstract 121

6.2. Introduction 122

6.3. Material and Methods 123

6.3.1. Site and Sampling 124

6.3.2. Isolation of Pure Culture 125

6.3.3. Culture Identification 125

6.3.4. Preparation of Cyanobacterial Extracts 126

6.3.5. Screening for Antagonistic Activity 126

6.3.5.1. Preparation of Test Cultures 127

6.3.5.2. Spot Agar method for screening of

Antagonistic Activity

6.3.6. Protein determination by Bradford Assay 127

6.3.7. Cytotoxic assay 127

6.3.8. Statistical Analysis 128

x

Page No.

6.4. Results and Discussion 128

6.4.1. Identification of Pure Culture 128

6.4.2. Antagonistic Activity 137

6.4.3. Protein Estimation and Cytotoxic Assay 137

CHAPTER 7. Characterization of two antagonistic substances produced by

mangrove bacteria of Sandspit backwaters, Pakistan.

144

7.1. Abstract 145

7.2. Introduction 146

7.3. Material and Methods 148

7.3.1. Sample collection and Preliminary Isolation 148

7.3.2. Identification of Bacterial Strains 149

7.3.3. Preparation of Crude Extracts 150

7.3.3.1. Bioassay of Bacteriocin/antagonistic

substance

150

7.3.3.2. Growth Curve Assay 150

7.3.3.3. Bacteriocin activity unit (AU) Assay 151

7.3.4. Characterization of test Bacteriocin 151

7.3.4.1. Temperature effect on Bacteriocin Activity 151

7.3.4.2. pH effect on Bacteriocin Activity 152

7.3.4.3. Chemical effect on Bacteriocin Activity 152

7.3.4.4. Ultra-violet effect on Bacteriocin Activity 152

7.3.5. Bacteriocin Purification 153

7.3.6. Protein Estimation 153

7.3.7. SDS-PAGE Gel Electrophoresis 153

7.3.8. Cytotoxicity Test 154

7.3.9. Statistical Analysis 154

7.4. Results and Discussion 155

7.4.1. Isolation and Identification of Bacterial Strains 155

7.4.2. Bioassay and Growth curve 158

7.4.3. Characterization of Bacteriocin 158

7.4.4. Purification of Bacteriocin 163

7.4.5. SDS-PAGE Gel Electrophoresis 163

7.4.6. Cytotoxicity Test 163

PART IV. GENERAL DISCUSSION 179

PART V. REFRENCES 187

APPENDIX 247

xi

LIST OF TABLES

S. No. Page No.

I. The main types of Mangrove forest. 4

II. The population percentages of mangrove distributed in the world. 5

III. The Families, Genus and Common names of mangroves widely

found in the world according to the study of Tomlinson, (1986).

6

IV. Table showing in detail the names of families and genus of

mangroves that are less prevalent in the world.

7

V. Mangrove genera of Asia according to the survey conducted by The

Food and Agriculture Organization of the United Nations.

8

VI. Asian countries having mangrove forest cover according to the study

by Adeel and Pomeroy, (2002).

9

VII. Physical parameters of Sandspit mangrove water channel. Mean

(±S.D.) of site during Pre-monsoon, Monsoon and Post-monsoon

seasons (N=03).

39

VIII. Benthic nutrient flux rates by bell jar method of mat and without mat

sites during Pre-monsoon, Monsoon and Post-monsoon seasons per

day mean (±S.D.).

42

IX. Pearson correlation matrix of nutrient ions by bell jar method and

physicochemical parameters.

44

X. PCA results showing the first two components for water

characteristic including nutrient ions and physicochemical variables

of twelve seasonal and mat conditions at Sandspit mangrove site.

47

XI. Nutrient Fluxes determined by Bell jar method in different regions. 50

XII. Nutrient exchange rates of water samples, means (±S.D.), collected in

microbial mat and without mat area.

77

XIII. PCA results showing the first three components for twenty physico-

chemical sediment and nutrient variables in twelve conditions at

Sandspit mangrove.

81

XIV. Pearson Correlations between soil properties (0-10 cm depth) and

Mangrove channel waters properties for the studied sites in Sandspit,

Karachi.

84

XV. Pearson correlation coefficient matrix showing relationship between

top, mid, bottom Rhizoidal and Non-Rhizoidal sections with time,

chlorate concentrations and physicochemical parameters.

95

XVI. Seasonal variations in physical and chemical parameters of water and

sediments from Sandspit backwaters mangroves (Mean± S.D., N=6).

106

XVII. List of organisms observed in microbial mats during the seasonal

study period of Sandspit mangrove area.

107

XVIII. Pearson correlations between dominant filamentous cyanobacterial

species at Sandspit mangrove and environmental field parameters,

(p<0.05).

114

XIX. Antagonistic activity of mangrove associated cyanobacteria (crude

extracts) against different strains.

133

xii

LIST OF TABLES

S. No. Page No.

XX. Cytotoxic assay of crude extracts of cyanobacteria 140

XXI. Probit analysis of Aphanocapsa litoralis (seawater fraction). 141

XXII. Probit analysis of Phormidium breve (Ethanolic fraction). 142

XXIII. General and Colonial characters of isolated mangrove bacterial

strains.

157

XXIV. Antagonistic activity of Sandspit mangrove cyanobacteria against

different clinical strains.

159

XXV. Effect of different chemicals on antagonistic activity of mangrove

bacteria

160

XXVI. Purification of bacteriocin(s) from culture supernatant of mangrove

bacteria.

165

XXVII. Probit analysis of Crude extract of Strain SSC14011. 169

XXVIII. Probit analysis of Crude extract of Strain SSC1407. 170

xiii

LIST OF FIGURES

S. No. Page No.

1. Coastline of Pakistan. The green belt of Keti Bandar covered by Mangroves is clearly visible via satellite image.

11

2. Sandspit mangrove site. (2A) 33

Map of experiment site, Sandspit Mangrove Area, Karachi. (2B) 34

3. Nutrient ion concentration according to tidal cycle during pre- monsoon,

monsoon and post-monsoon seasons.

43

4. PCA Two dimensional plot of field physicochemical variables. (4A) 48

Dendrogram (Cluster Analysis) of physical and chemical variables.

(4B) 49

5. Grain size percent composition of mat covered (M) and without mat

(WM) sediments during pre-monsoon, monsoon and post monsoon seasons.

65

6. Mean (±S.E.) Total Carbon and Nitrogen composition of the sediment in

the Sandspit Mangrove area, M=mat area, WM=without mat fringe area,

N=nitrogen, C=carbon.

66

7. Vertical profiles of (A) Water holding capacity, (B) Moisture content,

(C) Organic matter via Loss of ignition, (D) Carbon-Nitrogen ratio and

(E) Chlorophyll a-b ratio measured at mat covered (M) and fringe

(without mat) (WM) sites during pre-monsoon, monsoon, and post-monsoon seasons. Plotted values are mean of triplicate, (±S.E.).

67

8.

9.

Average values (±S.E.) of soil and water (A) pH, (B) salinity, (C)

temperature, recorded at the study sites of Sandspit mangrove mat area (M) and Fringe without mat area (WM) during the climatic pre-

monsoon, monsoon and post-monsoon seasons.

Average values (±S.E.) of soil and water (A) dissolved oxygen of

waterand (B) bulk density of soil recorded at the study sites of Sandspit mangrove mat area (M) and Fringe without mat area (WM) during the

climatic pre-monsoon, monsoon and post-monsoon seasons.

73

74

10.

Two dimensional PCA ordination of Sandspit mangrove channel waters

variables. 80

11. Dendrogram (Cluster analysis) of physical and chemical variables of channel water and sediments.

82

12. Seasonal observations of field parameters of study site, R= rhizoidal

area, NR= non-rhizoidal area. (N=3, ±S.D. error bars). 92

13. Box plot showing the difference in terms of Potential Nitrification

activity (PN) activity between Rhizoidal (R) and Non-Rhizoidal (NR)

sediments.

94

14.

Filamentous cyanobacteria most abundant at Sandspit mangrove backwaters during the study period. (A) Phormidium tenue (B) Spirulina

labyrinthiformis (C) Spirulina major (D) Oscillatoria limosa (E)

Oscillaoria brevis and (F) Oscillatoria princeps. All the pictures except

Fig. 2 (D) (200x) were taken at 400x.

111

xiv

LIST OF FIGURES

S. No. Page No.

15. Biovolume of the six dominant benthic cyanobacteria at Sandspit

mangrove backwaters. 112

16. Average proportional distribution of the six most dominant

cyanobacterial species at Sandspit mangrove backwaters for the period 2012-2014.

112

17. Abundance of the dominant cyanobacterial species in pre- monsoon

(January), monsoon (April, July) and post monsoon (October) at

Sandspit mangrove area.

113

18. Aphanocapsa litoralis circular cyanobacteria found in the microbial mat

at Sandspit mangrove area. 130

19. Phormidium breve filamentous cyanobacteria found in the microbial mat

at Sandspit mangrove backwaters. 131

20. Spot agar test of cyanobacterial extracts on potato dextrose agar plates

seeded with clinical strain of Candida albicans. 132

21. Probit analysis plot showing effect of Aphanocapsa litoralis seawater extract towards Artemia salina (brine shrimps). (21 A)

Probit analysis plot showing the cytotoxic effect of Phormidium breve

ethanol fraction towards Artemia salina (brine shrimps). (21 B)

134

135

22. Flow chart of extraction of bioactive protein extracts from cyanobacterial strains.

136

23. Bacteria isolated from the microbial mat of sandspit mangrove forest. 156

24. Effect of Temperature on Bacteriocin Activity. (24 A) 161

Growth curve and production of antagonistic activity in LB medium. The activity was monitored at 30 ºC. (24 B)

161

25. Effect of pH on Bacteriocin Activity. 162

26. The effect of UV-light on the isolated bacterial strains. 162

27. SDS-PAGE of Dialyzed fractions of test strains. Samples after dialysis

with 12 kDa cut off membrane. Test Strains showing multiple bands between the range of 95-29 kDa respectively.

166

28. Probit analysis plot showing effect of crude extracts of Bacterial Strain

SSC1407 on Artemia salina (brine shrimps). 167

29. Probit analysis plot showing effect of crude extract of strain SSC14011 on Artemia salina.

168

30. Neighbour joining phylogenetic tree (upper) and fast minimum evolution

tree (lower) based on 16S r RNA gene sequence of isolated SSC1407 bacterial strain.

174

31. Neighbour joining phylogenetic tree (upper) and fast minimum evolution

tree (lower) based on 16S r RNA gene sequence of isolated SSC14011

bacterial strain.

175

1

PART I

AN INTRODUCTION TO MANGROVES: ITS

IMPORTANCE AND FACTORS AFFECTING ON

MANGROVE ECOSYSTEM

2

CHAPTER 1

GENERAL INTRODUCTION

3

Mangroves are Halophytic plants which grow on swampy, clay, muddy and saline soil.

These forests are sometimes referred to as ‘mangrove swamps’ or simply termed as

‘mangal’ (Macnae, 1968). It could be a tree or shrub that reach height of up to 30 feet, and

bears thick leaves which are leathery in texture with various colors of flowers and fruits.

Mangrove plants have the ability to survive under harsh conditions and possess salt glands

or gall like formation that helps in exudation of excess salt. These plants have various

modified forms of root structure (knee, buttress, pneumatophores, stilt etc.). They have

osmoregulation mechanism, viviparous mode of reproduction, sunken stomata and aqueous

tissue (Chaudhuri, 2007). Mangroves can flourish below the high tide and above mean sea

level in intertidal humid salt laden conditions on arid or semi-arid environment, or estuarine

environments in tropical and subtropical region. They are one of the richest evergreen

ecosystems in terms of fertility and natural resources.

Mangrove ecosystems are of great importance because of its multiple benefits to living

beings as it acts as a natural barrier against severe storms, strong winds, extreme tides and

tsunami; mangrove not only provides a cool abode under high temperatures but also acts as a

sanctuary. Mangrove ecosystem enrich nearby waters as it bears mineral rich soil due to

increased rate of decomposition processes and nutrient regeneration (Alongi, Boto and

Robertson 1989; Kathiresan and Bingham, 2001; Shafique, Siddiqui, Aziz, Zaib-un-Nisa

and Mansoor, 2010). Mangrove protects coastlines by decreasing soil erosion rate

(Danielsen, Sørensen, Olwig, Selvam, Parish, Burgess, Hiraishi, Karunagaran, Rasmussen,

4

Hansen and Quarto, 2005) and provides commercially viable products and maintains

sustainable fisheries (FAO, 2007)

1.1. Types of Mangrove Forests:

Table I. The main types of Mangrove forest

S. No. TYPES DESCRIPTION REFERENCES

1) Riverine

Situated along the rivers and creek systems.

They are considered to be the largest

mangrove forests. These forests are exposed to

diurnal tidal activity and fresh water runoff.

Hograth, 1999

2) Fringe

Situated within the high tide range and covers

shoreline and water channel inlets, they can

withstand increased wave pressure and trap

marine and terrestrial sediments.

Hograth, 1999

3) Basin

Situated along the fringe mangrove towards

inland, infrequently inundated by waves or

tidal action, basin mangroves are compatible

with other halophytes.

Cintron, Lugo,

Martinez and

Correa, 1978

4) Dwarf

Wetlands with stunted mangrove, range of one

meter or less, restricted freshwater and

sediment inundation.

Lugo and

Snedaker, 1974

5) Hammock Combination of dwarf and basin mangrove,

found as islands aggregated along coastlines.

Cintron Lugo,

Martinez and

Correa, 1985

1.2. Distribution of Mangroves:

All the mangroves present around the world can be broadly classified into eastern mangrove

and western mangrove with the meridian being the borderline mangrove. The eastern

mangroves mainly cover eastern coast of Africa, Southeast Asia, Australia and New

Zealand. Whereas the western mangroves are present over both coasts of America and west

coast of Africa. The eastern hemisphere has five times more species of trees and shrubs as

5

compared to western hemisphere (McLeod and Rodney, 2006; Ricklefs, Schwarzbach and

Renner, 2006). Mangroves are mostly concentrated between 30º N and 30º S (Tomlinson,

1986) and are present in 112 countries and territories. Global estimates of mangrove

coverage vary considerably, for example, there was research suggesting that mangrove

covers about 14,653,000 ha of tropical and subtropical coastline areas (Wilkie and Fortuna,

2003). Another survey estimates, there were around 15.2 million ha mangroves in the year

2005 (FAO, 2007). Despite anthropogenic pollution, the mangroves of Sundarbans, Mekong

Delta, Amazon, Madagascar, Papua New Guinea and Southeast Asia are still under good

conditions. The largest extents of mangroves around the globe are found in the following

percentages (Giri, Ochieng., Tieszen, Zhu, Singh, Loveland, Masek and Duke, 2011):

1.2.1. Worldwide Mangrove distribution:

Table II. The population percentages of mangrove distributed in the world, (Giri, Ochieng.,

Tieszen, Zhu, Singh, Loveland, Masek and Duke, 2011)

S. No. NAME POPULATION IN %

1) Asia 42

2) Africa 20

3) North and Central America 15

4) Oceania 12

5) South America 11

The exact number of species varies from 50 to 70 depending upon different types of

classifications present. The most variety of species are found in Asia followed by eastern

Africa (FAO, 2007). Mangrove evolved steadily over the Tertiary and its species diversity

varies not only due to climatic factors but also due to certain environmental stress (Ricklefs,

6

Schwarzbach and Renner, 2006). The names of prominent mangrove families with genus are

listed as follows,

1.2.2. Worldwide families of Major Mangrove:

Table III. The Families, Genus and Common names of mangroves widely found in the

world according to the study of Tomlinson, (1986)

S. No. FAMILY GENUS COMMON NAME

1)

Acanthaceae,

Avicenniaceae or

Verbenaceae

Avicennia Black mangrove

2)

Combretaceae

Conocarpus, Laguncularia,

Lumnitzera

Buttonwood, white

mangrove

3) Arecaceae Nypa

Mangrove palm

4) Rhizophoraceae

Bruguiera, Ceriops,

Kandelia, Rhizophora

Red mangrove

5) Lythraceae Sonneratia

Mangrove apple

7

1.2.3. Minor mangrove families around the world:

Table IV. Table showing in detail the names of families and genus of mangroves that are

less prevalent in the world, (Tomlinson, 1986)

1.2.4. Mangrove distribution in Asia:

As compared to any other continent Asia has the largest mangrove population. Under a wide

range of climate and covering regions from arid Middle Eastern peninsula to subtropical

China, Japan to tropical South East Asia, these diverse conditions leads to high amount of

biodiversity in Asian mangrove ecosystem. At present South East Asia harbors 4.9 million

ha or nearly 35 per cent of the world’s total mangroves (Giesen, Wulffraat, Zieren and

Scholten, 2006).

S. No. FAMILY GENUS

1) Acanthaceae Acanthus, Bravaisia

2) Bombacaceae Camptostemon

3) Cyperaceae Fimbristylis

4) Euphorbiaceae Excoecaria

5) Lecythidaceae Barringtonia

6) Lythraceae Pemphis

7) Meliaceae Xylocarpus

8) Myrsinaceae Aegiceras

9) Myrtaceae Osbornia

10) Pellicieraceae Pelliciera

11) Plumbaginaceae Aegialitis

12) Pteridaceae Acrostichum

13) Rubiaceae Scyphiphora

14) Sterculiaceae Heritiera

8

The mangrove forests of Sundarbans are among the densest forests of the world. Although it

has the highest population density in the world, its net forest area is steady at the rate of

1.2% and the net area decreased is not very significant (Giri, Pengra, Zhu, Singh and

Tieszen, 2007). Sundarbans forests are located in Ganga- Brahmaputra delta, falling in India

and Bangladesh. It is a continuous patch of estuarine forest which is the largest patch of

estuarine forest in the world and contains numerous rivers, creeks and waterways

(Chaudhuri, 2007). Some 50 mangrove species are present in Asia belonging to the

following genera (FAO, 2007),

Table V. Mangrove genera of Asia according to the survey conducted by The Food and

Agriculture Organization of the United Nations (FAO, 2007)

S. No. Genus S. No. Genus

1) Acanthus 10) Heritiera

2) Acrostichum 11) Kandelia

3) Aegiceras 12) Lumnitzera

4) Avicennia 13) Nypa

5) Bruguiera 14) Osbornia

6) Camptostemon 15) Pemphis

7) Ceriops 16) Rhizophora

8) Cynometra 17) Scyphiphora

9) Excoecaria 18) Sonneratia

19) Xylocarpus

The top five countries of Asia in terms of mangrove vegetation are; Indonesia, Malaysia,

Myanmar, Bangladesh and India which covers about 80% of mangrove in Asia. Sundarban

forests cover approximately 1 million ha in India and Bangladesh; 60% of this forest is

present in Bangladesh having more species diversity as compared to India due to

considerably low salinity (FAO, 2007). India have 4, 18,828 ha in Sundarbans, 1, 15,000 ha

in Andaman and Nicobar Islands and 1, 47,888 ha in delta of Mahanadi, Godavari, Krishna,

9

Saurastra and Kutch (Chaudhuri, 2007). After Sunderbans the second most important

mangrove reserves are present in Irian, Kalimantan and Sumatra, Indonesia. Malaysia’s

Matang Mangrove Forest Reserve is a large forest and the world’s best managed forest.

Another well managed forest is in Ranong, Thailand. Mangroves on the delta of

Ayeyarwady River, Myanmar have been overexploited and degraded but are still significant.

Towards the Middle Eastern regions, the species diversity reduces to a minimum level due

to arid conditions; Bahrain, Oman, Qatar, Saudi Arabia, UAE, Yemen, and Kuwait have

minimal mangrove vegetation (FAO, 2007). The Table VI below gives an idea about an

extent of mangrove areas in Asia (Adeel and Pomeroy, 2002).

Table VI. Asian countries having mangrove forest cover according to the

study by Adeel and Pomeroy, (2002)

S. No. Country Area (km2)

1) Bangladesh 5,767

2) Brunei Darussalam 171

3) Cambodia 851

4) China and Taiwan 366

5) Hong Kong 2.82

6) India 6,700

7) Indonesia 42,550

8) Japan 4

9) Malaysia 6,424

10) Myanmar 3,786

11) Pakistan 1,683

12) The Philippines 1,607

13) Singapore 6

14) Sri Lanka 89

15) Thailand 2,641

16) Vietnam 2,525

Regional total 75,173

10

1.2.5. Distribution in Pakistan:

Pakistan’s coastline is 1050 km long out of which 350 km belongs to Sind and 700 km to

Baluchistan provinces, respectively (Amjad and Kamaruzaman, 2007a). The vegetation lies

between 24◦ 10’ and 25◦ 37’ latitude North and 61◦ 38’ and 68◦ 10’ Longitude east (Qureshi,

1990). Pakistan have semi-arid climatic conditions and have the largest semiarid region

mangroves in the world (Amjad, Kasawani and Kamaruzaman, 2007b). Climatic factors

play an important role in the current distribution of mangrove in Pakistan. These factors are

also responsible for gradual decrease of mangrove population (Saifullah, Chughtai and

Akhtar, 2007).

Indus delta is fan shaped delta present on the boarders between Pakistan and India. It

occupies south eastern coast in Sind from north of Karachi to Indian boarder in southeast

and along the Baluchistan coast. It contains huge quantities of silt from Karakoram and

Himalayan ranges. It covers total area of about 600,000 ha and consists of 17 major creeks

and numerous minor creeks, mudflats and fringing mangroves (IUCN, 2007; Baig, Ahmed,

Khan, Ahmed and Straquadine, 2008). In Sind 95% of mangrove of Indus Delta comprises

of mainly monospecific Avicennia marina (locally called in Sind as Timmer) (FAO, 2007)

that can reclaim waterlogged and saline areas of Sind (WWF, 2005; Nazim, Ahmed, Khan,

Khan, Wahab and Siddiqui, 2010). The rest comprises of Ceriops tagal (Chaanhr) and

Aegiceras corniculatum (Chor). Apart from these three species, Rhizophora Mucronata have

successfully been established in over five thousand ha of the Indus Delta (IUCN, 2007).

11

Fig

ure 1

. C

oast

lin

e o

f P

akis

tan. T

he

gre

en b

elt

of

Ket

i B

andar

co

ver

ed b

y

Man

gro

ves

is

clea

rly

vis

ible

via

sat

elli

te i

mage (

WW

F, 2

00

5).

12

The soil of the mangrove is fine alluvium derived from land drainage and erosion (Qureshi,

1990). The other province which have mangrove forests is Baluchistan. It possesses

relatively lower density and commonly found in prier conditions. About 4.68 % of total

mangroves of Pakistan are situated here. Miani Hor, Kalmat Hor, Gawadar Bay and Jiwani

are the primary areas that contain 84% of total mangrove of Baluchistan province. Miani

Hor is a tidal lagoon having most of mangrove vegetation around 3431, 36 ha (42%). It is

approximately 50 km long and 20 km wide. Aviciennia marina (locally called in Baluchistan

as Timmer), Rhizophora mucronata (Kumri) and Ceriops tagal (Kain) are the only

mangroves species which are naturally occurring in this province (IUCN, 2007; WWF,

2005). Miani Hor is also the only area in Pakistan where all three species are present

naturally (Amjad and Kamaruzaman, 2007a).

Pakistan Space and Upper Atmosphere Research Commission (SUPARCO) conducted a

study on Pakistan mangrove ecosystem in the year 2005 and it was estimated that the total

mangrove forests covered an area of about 557, 60 sq km that started form Dabbo Creek to

Sir Creek near the Rann of Kutch (SUPARCO, 2006). The mangrove area of Pakistan has

reduced from 345, 000 ha in 1980 to 158, 000 ha in 2001 which makes 8,905 ha or 1.15%

loss of vegetation per annum (FAO, 2005). To overcome these losses various projects have

been initiated to create awareness and rehabilitation of mangrove in Pakistan such as

UNESCO (United Nations Educational, Scientific and Cultural Organization) Regional

Mangroves Project, Rehabilitation and Replanting of Indus Delta Mangroves Project, The

International Union for Conservation of Nature and Natural Resources (IUCN) -Pakistan's

Korangi Ecosystem Project, Social forestry project by IUCN-Pakistan and the Sindh forests

13

department, and IUCN Korangi Phitti Creek Mangrove Project. All these were conducted in

association with foreign environmental protection organizations (Baig, Ahmed, Khan,

Ahmed and Straquadine, 2008). The 1990 joint venture between Govt. of Pakistan and

World conversation Union was successful and resulted in the rehabilitation of approximately

19,000 ha of Avicennia marina and Rhizophora mucronata. Similarly, in 1999 World Bank

facilitation provided restoration of about 17,000 ha of Indus delta mangrove (FAO, 2007).

1.3. Effect of Climatic factors on Mangrove Ecosystem:

Climatic factors are very essential for mangrove sustainability. The mangrove forests are

distributed around different regions of the world according to temperature and rainfall

regimes which are the leading factors as these factors influence species richness, average

height, and maximum size of mangrove trees. Soil at low precipitation and high evaporation

rates ultimately results in hypersaline conditions. The mineral and nutrient content in

sediments are also affected by these factors (Hamilton and Snedaker, 1984; Kathiresan and

Bingham, 2001). Mangroves are mainly found in following climatic regions all around the

world:

1) Equatorial zone: between 10◦ N and 5 to 10◦ S.

2) Tropical summer rainfall zone: N and S of equatorial zone, 25-30◦ N and S., partly in

subtropical dry zone, pole ward.

3) Warm temperate climate, eastern border of the continents.

14

1.3.1. Temperature, influence and limit the mangrove population directly. During winter the

number of species decline. Generally increased varieties of species are found where

temperatures along with rainfalls are highest. In dry seasons precipitation is equal to or less

than twice the mean temperature, while the precipitation is above the temperature curve, the

period is considered to be humid and vice versa results in dry condition. Mangroves are

extremely sensitive to lengthy periods of frost with exception to some Avicennia species (A.

marina, A. germinans). Most mangroves are unable to germinate under 16ºC (Hamilton and

Snedaker, 1984). In mangrove area of Pakistan climate is considered to be warm where mild

winter months extends from November to February and summer lasts from March till June.

The temperature may range from 10ºC up to 41 ºC (IUCN, 2005; Gilman, Ellison, Duke and

Field, 2008).

1.3.2. Salinity, appears to control mangrove species distributed according to their salinity

tolerance range (Saifullah, Shaukat and Shams, 1994. Therefore, different species have a

preferred location from sea mouth to tidal limit upstream. Salinity gradient can be roughly

divided into upstream (where salinities are influenced by hypersaline runoff or fresh water

input), intermediate and downstream areas (where salinities are influenced by sea water).

Under humid conditions less salt resistant species are found in landward zone having swamp

forest ecosystem nearby. Whereas, under dry conditions the area may be affected by severe

droughts, as a result, high salt tolerant species are found in landward zone having bald areas

nearby. Bald patch areas have such high salinity that all the plantations are completely

wiped out except extreme halophiles (Hamilton and Snedaker, 1984; Kathiresan and

Bingham, 2001).

15

1.3.3. Tides, are also one of the major climatic factors influencing mangrove’s diversity and

distribution. Mangroves are adapted to survive in tidal marine locations and it keeps up with

the tides extreme actions by constantly regenerating and acclimatizing in the exposed tidal

environments. Mangrove areas exposed to heavy tidal actions are usually dominated by

small number of relatively hardy species. Different mangrove species occupy different

positions with respect to tidal profile present in that area thus forming distinct tidal areas.

Tidal zones of mangroves can be divided into lower, middle, and higher zones. Apart from

tidal actions, floral species competition and predation by faunal elements also influence

different species of mangrove to cover different high, low or intertidal areas (Shafique,

Siddiqui and Farooqi, 2015). The heavy tidal waves begin from June and lasts till

September. The tidal water runs four times in 24 hours. The source of mangrove areas soils

of Pakistan is mainly from Indus River which is then worked up by coastal tides and

deposits sediment close to coastal area (Kathiresan and Bingham, 2001; IUCN, 2005;

Gilman, Ellison, Duke and Field, 2008; Siddiqui, Farooq, Shafique and Farooqui, 2008).

1.3.4. Moisture and Rainfall, influence the mangrove population immensely. There is

maximal species diversity along the warm northern tropical coast where the climatic

conditions are uniformly present. Greatest species numbers of flora and fauna are found in

the regions where mean annual rainfalls are at higher rates. Mangrove develops best where

rain falls abundantly and evenly throughout the year. In mangrove areas of Pakistan, the

rainfall patterns are unevenly distributed throughout the year and the average rainfall is 200-

220 mm. June, July and August are the peak months of rainfall reported by IUCN, (2007),

Gilman, Ellison, Duke and Field, (2008) and Farooqui, (2012).

16

1.3.5. Wind and Storms, effect mangrove ecosystem as they simultaneously act as a

constructive and destructive force. Winds carrying sand not only modify the coastal

morphology but affect the evolution of mangrove in that area. It also transports huge amount

of sand, silt, and clay along with nutrient content. On the other hand, storms may seem very

destructive resulting in the blunt destruction of mangrove but it also plays a very vital role in

the dispersal of propagules either to adjacent areas or to distant offshore regions where

mangrove develop best. In terms of intensity, the storms can be classified from minor to

destructive respectively (Hamilton and Snedaker, 1984). In Pakistan, severe storm at the

speed of 130 km/h was recorded in June 1936 near Karachi. Otherwise the coastline rarely

faces heavy cyclones. Recently in the year 2014, cyclone Nanauk caused some major

damage to Karachi coastline and adjacent mangrove forests. The wind speed in Pakistan’s

mangrove area is highest in monsoon season in summer the wind speed is 7.5 to 20.5 km/h

(Kathiresan and Bingham, 2001; McLeod and Rodney, 2006; IUCN, 2007; Gilman Ellison,

Duke and Field, 2008; Benfield, 2014). It is evident from the above studies that climatic

factors help mangrove to achieve the maximum size, density and specific diversity

respectively.

1.3.6. Nutrients, in mangrove forest apperas to be the function of decomposers that

mineralize accumulated organic matter, transform and immobilize nutrients in mangrove

habitat and (Cherif and Loreau, 2009). Nutrient exchange between water and sediment is a

biogeochemical process (Pederson, Nielson and Banta, 2004) which may occur during tidal

inundation and also by pore water translocation (Ovalle, Rezende, Lacerda and Silva, 1990).

Sediment plays a predominant role in nutrient cycling. The microbial communities

17

(cyanobacteria, bacteria, fungi etc.) also catalyze increasing the rate of nitrogen content

(Hograth, 1999). In mangrove ecosystem, Nitrite, Nitrate, Ammonia and Phosphate are

considered to be among essential nutrients which are required by mangroves for metabolic

processes (Hwang and Chen, 2001) these inorganic ions are available due to the nitrification

and denitrification processes. Ammonium is disseminated form the mangrove sediment

(Robertson and Alongi, 1992) which is ultimately assimilated via nitrification by sediment

associated micro flora (Fernandes, Bonin, Michotey, Garcia and LokaBharathi, 2012). The

net nitrogen flux is influenced by the process of denitrification (Alongi, 1993). Phosphate is

significant in terms of bacterial metabolic activities and is an integral component of the

genetic material essential for reproduction hence it is readily assimilated by sediment

microbes and also improves mangrove growth (Glick, 1995; Behera, Singdevsachan,

Mishra, Sethi and Thatoi, 2016). In Pakistan, there is no recent the research on nutrient

exchange rates related to Sandspit mangrove and channel water. Earlier studies related to

mangrove tiadl creek nutrients by Harrison, Khan, Yin, Saleem, Bano, Nisa, Ahmed, Rizvi

and Azam, (1997) and pore water analysis conducted by Farooqui, (2012) and Shafique,

(2004) but, those observations were mainly supporting works for Phytoplanktons, litter

decomposition meiofaunal abundance.

1.4. Commercial and Curative aspects of Mangrove products:

1.4.1. Edible and Non edible uses, Mangrove primarily is a source of wood for many

fishermen, farmers and nearby population. This wood is used for firewood, timber, charcoal,

posts, for construction of domestic houses, bridges, fences, lattice, drainage pipes,

18

chipboard, fishing traps, furniture, tool handles, toys, match sticks, floats and boats. The non

woody parts are used as fodder, glues, fish poison, tannins, green manure, paper production,

sugar, alcohol, sugar, honey and wax production etc. The edible vegetables are obtained

from propagules, fruits and leaves which are also used as salads. Legumes are a good protein

source to be used for human consumption; condiments are obtained from bark, incense.

Synthetic fibers, cloth dyes, packing materials, shell decoration pieces, ropes, mats, baskets,

perfume material, rayon and pesticides are all obtained from mangroves, respectively. The

mangrove fauna provides food source such as, finfish, prawns, shrimps, crabs, oysters,

mussels, cockles, honey, wax, are used for protein source, feathers for bait making, the

grazing animals can be used for food. Mangrove forest itself serves as an ideal place for

aquaculture, apiculture and eco-tourism etc. (Hamilton and Snedaker, 1984; Untawala,

1998; Rönnbäck, 1999; Depommier, 2003; Chaudhari, 2007; FAO, 2007; Pattanaik, Reddy,

Dhal and Das, 2008; Walters, Rönnbäck, Kovacs, Crona, Hussain, Badola, Primavera,

Barbier and Dahdouh, 2008).

In Africa, Asia, North and Central America, Oceania, South America mangroves are used

mainly for Fuel, construction, tannin, medicine, beverage and fisheries (FAO, 2007). There

are few exceptions such as use of natural pesticides (Laguncularia racemosa) in Africa,

Thatching material (Nypa fruticans) is used in Asia commonly, In Cuba mangrove

communities mainly depend on oysters, honey and wax and in Caribbean the mangrove are

converted into Marianas (FAO, 2007). In Pakistan mangroves are mainly used as breeding

grounds for commercially important fishes and as sanctuary by migratory birds. Its fuel

wood and fodder is used by nearby fishermen village community (Snedaker, 1984; Qureshi,

19

1990; Qureshi, 1996; Saifullah, 1997; Bandaranayake, 1998; Khalil, 1999; Khalil, 2000;

Amjad and Kamaruzaman, 2007; Siddiqui, Farroqui, Shafique and Farooq, 2008; Adhikari,

Baig and Iftikahr, 2010; Mukhtar and Hannan, 2012; Abbas, Mueen, Ghaffar, Khurram and

Gilani, 2013; Salik, Jahangir, and Hasson, 2015).

1.4.2. Medicinal uses, traditionally, various types of medicines are obtained from bark,

leaves and fruits of mangrove which are used for the treatment of several health

complications and diseases such as, wound healing, antiseptic, asthma, diabetes,

rheumatism, cuts and bites, boils, skin disorders, ulcers, contraceptives, small pox, diuretic,

leprosy, hepatitis, jaundice, scabies, malaria, haemorrhage, veneral infection, stomach aches,

paralysis, diarrhea, laxative, cough, nausea, sore throat, fever. (Pattanaik, Reddy, Dhal and

Das, 2008). Mangrove contains antioxidants and have potential antitumor, cytotoxic, anti-

inflammatory, antiulcer and antiradical activity (Banerjee, Chakrabarti, Hazra, Banerjee,

Ray and Mukherjee, 2008).

1.5. Community of Fauna & Flora associated with mangrove ecosystem:

A mangrove ecosystem sustains and harbors variety of fauna and flora including unicellular

(bacteria, cyanobacteria, diatoms, fungi, and fungi like protists) to multicellular (macro

algae, seagrasses zooplankton, sponges, ascidians, epibenthos, infauna and meiofauna,

prawns, shrimps, crabs, crustaceans, insects, mollusks, fishes, amphibians, reptiles, birds and

mammals). All these organisms form a food web and maintain energy fluxes in mangrove

ecosystem (Macnae and Kalk, 1962; Sasekumar, 1974; Kathiresan and Bingham, 2001).

20

Mangrove ecosystem also provides breeding and nursery grounds for wide variety of

commercially important fish and shellfish species. Over all, around the world 48 bird, 14

reptiles, 1 amphibian, and 6 mammal species endemic to mangroves have been reported

(Luther and Greenberg, 2009).

In Pakistan, various research projects have been undertaken that were related to mangrove

flora and fauna. Studies on Avicennia marina were related to Inorganic content analysis of

leaves (Ilyas and Siddiqui, 1989), population density (Saifullah, Shaukat and Shams, 1994;

Saifullah and Rasool, 2002), potential salt tolerance and osmoregulation (Dagar, 1995; Aziz

and Khan, 2000; Khan and Aziz, 2001; Khan, Adnan and Aziz, 2016), pneumatophore

(Saifullah and Elahi, 1992), associated macro algal puffs flora and fauna (Siddiqui,

Mansoor, Burhan, Shafique and Farooqi, 2000), microalgal community assessment

(Yasmeen, Shafique, Zaib un Nisa and Siddiqui, 2016) disease control (Tariq and Dawar,

2011) foliage and litter decomposition (Qasim, Barkati, Siddiqui ans Ilyas, 1986; Siddiqui

and Qasim, 1990; Siddiqui and Qasim, 1994; Siddiqui, Farroqui, Valeem, Rasheed and

Shafique, 2009; Farooqui, Shafique, Khan, Ali, Iqbal and Siddiqui, 2012; Shafique,

Siddiqui, Aziz, Burhan, Mansoor and Nafisa, 2013). Other studies include mangrove forest

eocphysiology (Khan, 1998; Siddiqui, Farooq, Shafique, Burhan and Farooqi, 2000; Aziz

and Ajmal, 2001) and mangrove forest cover along the coastline of Pakistan (Abbas, Qamer,

Hussain, Saleem and Nitin, 2011).

Fauna that are frequently recorded in local mangrove ecosystems mostly consists of fishes,

crustaceans and molluscs (Ahmad, 1997; Barkati and Rahman, 2005). Ali, Arshad and

21

Akhtar (2003) observed 125 birds, 12 reptiles and 11 mammals’ species near Mekran

wetland complex of Baluchistan province. Gondal, Saher and Qureshi (2012) observed 84

different species of fauna (mainly belonging to families Mugilidae, Sillaginidae, Portunidae,

Penaeidae, Diogenidae, Nassariidae and Dentaliidae) of Somiani bay, Baluchistan province

mangroves and neighboring areas. Barkati and Rahman, (2005) listed detailed composition

of 66 species of invertebrates from Sandspit, Clifton and port Qasim mangrove areas of Sind

province. Khan, (1999) reported intermittent herpatofauna associated with mangrove and

adjacent areas. Saifullah and Chaghtai, (1993) reported some diatoms from Sandspit

mangrove site. Population of mangrove related gsatorpods were earlier survayed by Barkati

and Tirmizi, (1987). Feeding patterns of Cerithium sp. (Seema, 2004) and population

structure and distribution of Cerithideopsilla cingulata (Khan, Saifullah, Qureshi, Shaukat

and Chaghtai, 1999; Shafique, Siddiqui and Farooqui, 2015) which are common mangrove

gastropods were also reported.

Studies related to mangrove fisheries were focused on red snapper’s population, nutritional

evaluation and its influence on growth (Abbas, 2002; Abbas and Siddiqui, 2003; Ghulam,

Khalid, Rukhsana and Lin, 2005; Jamil, Abbas, Akhtar, Lin and Li, 2007; Abbas and

Siddiqui, 2009; Abbas, Siddiqui and Jamil, 2011). Population and abundance of shrimps

(Sultan and Mustaquim, 2001; Ayub and Muzammil, 2001; Sultan and Mustaquim, 2006),

distribution and morphology of mud crabs (Mustaquim, Imtiaz and Sultana, 2001; Mushtaq

and Mustaquim, 2009) and population of other crustaceans (sandspit backwaters), that were

reported by Khanam, Mustaquim, and Ayub, (2014). The mesozooplankton (Qureshi and

Saher, 2014) and meiobenthos studies (Qureshi and Sultana, 1999; Qureshi, Naz and Saher;

22

2016) of mangrove areas were also carried out respectively. Hymenoptera (bees) study at

mangrove of Sandspit, Karachi was conducted for the first time by Farooq (2010)

1.5.1. Microbial community a major component of mangrove ecosystem:

Microbial communities are very significant pillars of mangrove ecosystem and mainly

comprises of decomposers i.e. bacteria and fungi which are responsible for providing

pathways for primary productivity and effective recycling (Alongi, Boto and Tirendi, 1989;

Venkatesan and Ramamurthy, 1971; Hall-Stoodley, Costerton and Stoodley, 2004; Graham,

2013). These decomposers are present in sediment, water and are also associated with

different part of mangrove (roots, barks, leaves etc.) in the form of microbial mat. This mat

also sustains other microorganisms such as diatoms and protozoa. The major inhabitants of

mangrove microbial communities includes cyanobacteria, bacteria, fungi and diatoms

(Mehdi and Saifullah, 1992; Saifullah and Chaghtai, 1993; Bano, Nisa, Khan, Saleem,

Harrison, Ahmed and Azam, 1997; Manzoor, Siddiqui, Bano and Zaib-un-nisa, 2000; Mehdi

and Saifullah, 2000; Tariq, Qawar and Mehdi, 2006; Sahoo and Dhal, 2009; Gosh, Dey,

Bera, Tiwari, Sathyaniranjan, Chakrabarti and Chattopadhyay, 2010; Nizam, Khan, Ameen,

Naz and Noureen, 2012; Ahmed, Shaukat and Khan, 2013; Latif, Ayub and Siddiqui, 2013;

Yasmeen, Shafique, Zaib un Nisa and Siddiqui, 2016), that generate nutrient in the adjacent

sediments and water areas, (Garnier, Billen, Némery and Sebilo, 2010) and plays an

important role in terms of nutrient flux , assimilation (mainly conversion of nutrient from

complex into simpler forms) management and also litter decomposition on muddy mangrove

sediment (Holguin, Guzman and Bashan, 1992; Bano, 1997; Harrison, Khan, Yin, Saleem,

23

Bano, Nisa, Ahmed, Rizvi and Azam, 1997; Seema, 2004; Hara, Havehidoko, Desyatkin,

Hatano and Tahara, 2009; Woulds, Schwartz, Brand, Cowie, Lawb and Mowbray, 2009).

The bacteria present in microbial communities also have some defensive antagonistic

substances (bioactive compounds) which enable it to survive among variety of different

microbial species (Rajesh, Karthikeyan and Jayaraman, 2012). These substances act as

quorum sensing and defensive agents against other species of bacteria and have a potential

to act as a probiotic against certain pathogenic strains of commercially important fisheries

(Verschuere, Rombaut, Sorgeloos and Verstraete, 2000; Powell, 2006; Mollendroff, 2008;

Yi, Zhang, Tuo, Han and Du, 2010; Ghanbari, Rezaei, Soltani and Shah-Hosseini, 2009;

Ghanbari and Jami, 2013).

Studies in Pakistan are mainly from terrestrial sources which shows a positive antagonistic

effect against harmful strains (Ahmad, 2003; Faheem, Saeed and Rasool, 2007; Tariq,

Dawar, Mehdi and Zaki, 2007; Hussain, Khan, Wajid and Rasool, 2008; Jabeen, Gul,

Subhan, Hussain, Ajaz and Rasool, 2009; Yasmin and Bano, 2011; Naeem, Ilyas, Haider,

Baig and Saleem, 2012; Naz and Rasool, 2013; Yasmin, Bano and Samiullah, 2013) but

there are very few studies exploring marine bacteria’s bacteriocin (and bacteriocin like)

potential (Pirzada, Nasir and Rasool, 2000) and there is no recent study exploring the role of

microorganisms in mangrove areas of Pakistan.

1.6. Societal aspects of mangrove:

24

Mangroves serve as a way of living and permanent home for locals around the world. In

Australia the mangrove areas were managed by Indigenous people and still bears cultural

significance to them as they obtain food, timber, and heal stingray stings from Avicennia

marina bark. In Colombia, Ecuador, Guyana and Peru production of charcoal form

mangrove forests is a traditional practice (FAO, 2007). In Pakistan, the main communities

that live near Baluchistan province mangroves are the people of Damb village, Baloch

Goath and Bira village. Whereas Indus Delta’s main communities are Mallaha and Dablas

whose main profession is fishing and cattle farming, but due to reduced silica content,

decreased river flow, Sea water intrusion, sea level rise, over harvesting and other forms of

anthropogenic mangrove exploitations, there is now 70% decline in fishing and farming in

these areas. All of which resulted in to mass migration of locals over the period of several

years (Amjad and Kamaruzaman, 2007a; Amjad, Kasawani and Kamaruzaman, 2007b).

This sort of anthropogenic destruction is common all over the world (FAO, 2007; Islam,

2007).

1.7. Aims and Objectives of Present Research:

In Pakistan very little is known about the nutrient flux, microbial communities and

their role in mangrove ecosystem. Therefore, due to the scarity of data present study

was initiated. The aim and objective of the present research are:

To explore the mangrove ecosystem with specific reference to microbial mats.

25

To understand the pattern of microbial mat composition with respect to seasonal

fluctuations.

To estimate major nutrients present using physical and chemical variables and

observe the net nutrient flux in terms of tidal cycle and microbial mat influence on

nutrients.

To investigate the different soil and water parameters involved in mangrove area its

effect on our study area.

To observe the potential nitrification rates with respect to seasonal variations and

observe whether the presence of mat effect the rates or not.

To explore whether mangrove related bacteria and cyanobacteria have the ability to

produce bioactive or pharmacologically significant antagonistic substances against

common clinical and environmental bacterial strains.

26

PART II

INFLUENCE OF MICROBIAL MAT ON SOIL,

NUTRIENS AND SEDIMENT POTENTIAL

NITRIFICATION OF

MANGROVE ECOSYSTEM

27

CHAPTER 2

SEASONAL VARIATIONS IN NUTRIENT LEVELS OF

SANDSPIT MANGROVE BACKWATERS, PAKISTAN

(Manuscript submitted for Publication)

28

SEASONAL VARIATIONS IN NUTRIENT LEVELS OF

SANDSPIT MANGROVE BACKWATERS, PAKISTAN

2.1. Abstract:

Nutrient flux of Sandspit mangrove backwaters was determined using Bell jar method. The

inorganic nutrients NO2-, NO3

-, NH4+ and PO4

3- were measured in situ in areas of the

mangrove forest with and without the microbial mat cover. To observe the variations in

nutrient rates outside the bell jar, samples were withdrawn using polyethylene bottles. The

nutrient flux ranged for NO2- (-0.08 ±0.35 to 0.11 ±0.09 mol.m-2 d-1), NO3

- (-1.52 ±0.80 to

1.18 ±0.31 mol.m-2 d-1), NH4+ (-31.68±46.44 to 5.3 ±1.65 mol.m-2 d-1) and PO4

3- (-0.16

±0.23 to 0.67 ±0.05 mol.m-2 d-1) respectively. The results show that the overall nutrient

exchange rate was Higher in the mat-covered area than in the area without the mat cover.

The directly measured concentration of nutrient ions was higher inside the bell jar then

outside. Seasonal variations had a prominent effect on the nutrient fluxes. Tidal height had

significant effect on nutrient concentrations within the water channel. Other physical

parameters such as pH, salinity, temperature, dissolved oxygen and chlorophyll-a content

had variable apparent effect on nutrient ions and some were significantly correlated

(p<0.005) with NH4+ and NO3

-. Results indicate that nutrient flux at the benthic level is

responsible for nutrient dynamics and serve as a nutrient sink. The net nutrient rates were

low implying that direct terrestrial runoff in the area of study is not significant to the nutrient

flux rates.

29

2.2. Introduction:

Estuarine ecosystem creates a unique biodiversity. Sandspit mangrove forests are located at

the southern parts of Karachi city. It borders a tidal channel, which constantly receives

seawater from the Arabian sea and drainage water from surrounding residential and

industrial areas located at various points (Harrison, Khan, Yin, Saleem, Bano, Nisa, Ahmed,

Rizvi and Azam, 1997). The narrow channels have varying depth from 0.03 to 2.7m. The

area is exclusively occupied by the mangrove species Avicenna marina. Mangrove forests

are highly productive ecosystems of tropical intertidal areas (Rivera-Monroy, Day, Twilley,

Vera-Herrera and Coronado-Molina, 1995; Alongi, 2002). They maintain high nutrient

turnover rates (Alongi, 1994; Kristensen, Andersen, Holmboe, Holmer and Thongtham,

2000). Sandspit mangrove area release considerable levels of organic matter (Siddiqui and

Qasim, 1986). These studies revealed the significance of mangroves habitat as they provide

food, fodder and fuel, as well as serving as sanctuary for various fishes and shellfishes

(Hotel 1995; Badola and Hussain, 2003). Mangrove complex ecosystem is heavily

influenced by several factors that are involved in an efficient nutrient transformation and

exchange (Mendelssohn and Morris, 2000), including the tidal cycle, fresh water input and

rainfall, as well as microbial activities such as denitrification rates (Nixon, Oviatt and Hale,

1976; Widdows, Brinsley, Bowley and Barrett, 1998; Ensign, Hupp, Noe, Krauss and Stagg,

2014). Nutrient transformation within mangrove area provides nutrients to sustain the food

web (Bragadeeswaran, Rajasegar, Srinivasan and Rajan, 2007) and it is essential to maintain

water quality. Microbial processes act as a catalyst and efficiently transform nutrients from

complex to its simpler forms. Mangrove associated microbial flora efficiently mineralizes

the organic material (Nedwell, 1994). It also converts nitrogen from organic and dissolved to

30

gaseous state (Francis, Beman and Kuypers, 2007; Gomezulu, 2013). The cell growth of

bacteria associated with the sediment of mangrove forest may also contribute to the rates of

microbe-associated mineralization (Alongi, 1989). The Benthic microalgal communities

forming the mat cover are directly involved in mangrove nutrient dynamics (Rizzo and

Christian 1996; Pinckney and Zingmark, 1993) and play an important role in nitrification

and denitrification in intertidal sediment area (Magalhães, Joye, Moreira, Wiebe and

Bordalo, 2005; Koop-Jakobsen and Giblin, 2009). The microbial mats consist of

cyanobacteria (microalgae), bacteria, fungi, diatoms and some protozoa; they are diverse

and form a close community (Hosack, Dumbauld, Ruesink and Armstrong, 2006).

Considering the significance of mangrove ecosystem in nutrient generation, extensive

studies have been conducted to evaluate the nutrient budget (Ray, Majumder, Das,

Chowdhury and Jana, 2014), rate of nitrogen and phosphorus accumulation (Chiozzini,

Agostinho, Delfim and Braga, 2014), effects of seasons and tides on nutrient flux rates

(Mwashote and Jumba, 2002; Prabu, Rajkumar and Perumal, 2008), role of microbes in

elemental cycling of nutrients (Lee, Porubsky, Feller, McKee and Joye, 2008) and rate of

nitrogen transformation and uptake in mangrove sediment (Alongi, Sasekumar, Chong,

Pfitzner, Trott, Tirendi, Dixon and Brunskill, 2004).

In Pakistan, there are some supplementary data related to concentration of nutrient ions,

general hydrography (Shafique, 2004) and pore water chemistry (Farooqui, 2012) of

Sandspit mangrove area, but there are no data on nutrients of the Sandspit mangrove area. In

view of this, a study was conducted to observe the seasonal and tidal variation in nutrient

rates (ammonia, nitrite, nitrate and phosphate) of the estuarine area of sandpit mangrove

31

forest, comparing areas covered by benthic microbial mat (M) with areas without mat

(WM). The nutrient estimation was done by bell jar method in mangrove back waters.

Nutrients rates for inside (IN) and outside chamber (OUT) of mat (M) and without mat

(WM) sites were observed by manually operated bell jars. This investigation was conducted

for the first time in the Sandspit mangrove area of Pakistan. The Basic hydrographical

parameters such as temperature (of air, water and sediment), salinity, pH, dissolved oxygen

and Chlorophyll-a content (in sediment) were also recorded in order to correlate them with

the nutrient ion content. As the mangrove areas are susceptible to anthropogenic factors

(Beck, Heck, Able, Childers, Eggleston, Gillanders, Hughes, Kendrick, Kenworthy,

Olyarnik and Weinstein, 2001; Barbier, Hacker, Kennedy, Koch, Stier and Silliman, 2011)),

the present study is essential to create baseline data for further studies in establishing the

future hazard free sanctuaries for this habitat. This data will also benefit future impact

assessment study related to management and rehabilitation of Sandspit mangrove forest.

2.3. Material and Methods:

2.3.1. Site Description:

Sandspit mangrove forest area is among one of the five sites of similar kind in Pakistan (Fig.

2 a, b). It is relatively small as compared to its Indus Delta counterpart in the Sind province.

It is situated in the southwest of Karachi city (24º49’05.63” N, 66º56’37.21” E). It covers

the area of around 1056 ha (out of 98,128 ha) (Abbas, Mueen, Ghaffar, Khurram and Gilani,

2013). Climate of this site is mostly arid with annual rain fall up to 200 mm. The site is

mainly influenced by three seasons, pre-monsoon (Jan-march), monsoon (April-early Oct)

and post-monsoon (late Oct-Dec) respectively. The Sandspit study area is divaricated by

32

land having mudflats and mangrove forest area on its northern side whereas, sandy coastal

beach alongside the Arabian sea on its southern site. The area is exclusively covered by

monospecific Avicennia marina mangrove having 51% dense canopy (Abbas, Mueen,

Ghaffar, Khurram and Gilani, 2013). This backwater forest is connected to Arabian Sea via

Karachi harbor. The sea water enters from southeastern site of harbor area and pass through

Chari Kund channel finally entering into the back water channel of Sandspit area. The forest

floor is submerged under water 2 times a day due to tidal cycle. Average temperature is

around 29 ºC -30+ ºC. Salinity of water and soil may reach up to +40 PSU, +50 PSU.

Average pH of water is usually 7.8 and soil is up to 8.5 respectively. The study channel is

0.8 km long. The mean depth is 2.4 meters. Average tidal range is between 0.3 to 1.5m. The

freshwater supply is mostly form rainfall. River Indus is another source which flows from

the northern areas of Pakistan and finally into the Arabian Sea (Siddiqui and Qasim, 1986).

Forest sediment is mainly muddy and becomes sandy-silt around seaward fringe. The soil is

rich in organic carbon content and can range from 3.2 to 8.3% (Sultana and Mustaquim,

2003). The forest floor is covered with dense microbial mat which covers 1-2 mm top soil.

The mat mainly consists of cyanobacteria (such as Oscillatoria sp, Micrococcus sp.,

Phormidium sp.), diatoms, bacteria and fungi. Other primary benthic communities of this

site include gastropods, slugs, Polychaeta and fiddler crabs (Shafique, 2004; Qureshi and

Saher 2012; Nizam, Ahmed, Shaukat and Khan, 2013). The area between Manora channel

and Hawksbay are adjacent to residential, industrial and navy dockyard areas that are

heavily polluted and the waste water from northern sites of Lyari and Malir Rivers flows

into this mangrove site (Harrison, Khan, Yin, Saleem, Bano, Nisa, Ahmed, Rizvi and Azam,

1997).

33

Figure 2A. Sandspit mangrove backwaters. (1) channel at high tide, (2) channel at low tide,

(3) without mat covered fringe site, (4) microbial mat covered site, (5) mangrove fringe area

and entrance point, (6) picture showing distinction between mat covered (right) and

uncovered (left) area. (Photos provided by courtesy of Dr. Seema Shafique.)

(6) (5)

(4) (3)

(2) (1)

34

Figure 2B. Map of experiment site, Sandspit Mangrove Area, Karachi. (showing the

position of mangrove Backwater channel and the location of the sampling area (A) microbial

mat covered mangrove channel site (B) Fringe area without microbial mat cover. (with

permission form Google maps)

35

2.3.2. Sample Collection:

Nutrient flux experiment was carried out by selecting one-meter square quadrate area which

was cordoned and the bell jars were placed. Bell jars were manually operated according to

the methods of Bulleid, (1984), Asmus, Sprung and Asmus, (2000). Sampling was

conducted during pre-monsoon (mid of Jan) monsoon (mid of July) and post-monsoon (end

of Oct) seasons during the years late 2013- to early 2015 respectively. In order to minimize

variations in our observations same tidal cycles (high-low-high) were followed throughout

all the seasons. Clear PVC bell jars (area, 71cm2 and capacity, 21 liters) were pushed in to

the selected sediment with mat (IN M) and sediment without mat (IN WM) sites at low tide

level. There were no pneumatophores or macro algae at the survey site. Water samples were

withdrawn from the center of the chamber (Reay, Gallagher and Simmons, 1992) at regular

intervals (45 min.) during 13-hour high-low-high tide cycle. Sampling outside the bell jar,

near mat (OUT M) and without mat areas (OUT WM) was done simply by manually

collecting water using polyethylene bottles (capacity 500 ml), samples were collect within

one-meter quadrate where bell jars were placed. Sediment samples from mat (M) and

without mat (WM) area were collected during low tide period. The samples were cored

using (50.8 mm) diameter PVC corers wrapped in aluminum foil. Top 5.0 cm sections were

used for Chlorophyll a analysis. All samples were stored at -2 ºC and analyzed within 24

hours.

2.3.3. Sample Analysis:

For nutrients, water was filtered (0.45 m, Whatman GF/F) through filtration assembly

(Millipore), and the filtrate was analyzed Spectrophotometrically (UV-1800 /Shimadzu)

36

through the following procedures, Ammonium (NH4 +) by phenate method, Nitrite (NO2

-) by

diazotizing with C6H8N2O2S coupling N-(l- naphthy1)-ethylenediamine method, Nitrate

(NO3-) by Cu-Cd column method and Phosphate (Po4

3-) was determined by complex-reagent

method, Chlorophyll a was examined by acetone extraction method and Dissolved oxygen

was observed by using modified Winkler method (Strickland and Parsons 1972). Physical

parameters were also observed. The temperature of air, water and sediment were recorded

using standard ºC mercury thermometer. Salinity was determined by portable refractometer

(ATAGO 0161633, Japan) and pH was noted via pH meter (ELEMETRON, CP-401).

Sample collection and analysis were performed in triplicate and mean (±S.D.) calculated.

2.3.4. Benthic Flux Formula:

Total benthic flux was determined by following equation (Hargrave and Connolly, 1978;

Bartoli, Nizzoli and Viaroli, 2003) which is based on the assumption that the observed water

column is under steady state conditions (Miller-Way and Twilley, 1996). The positive flux

indicates interchange from the sediment into the water (release) and negative result indicates

interchange from water to the sediment respectively (uptake). All the observations were

taken in triplicate (mean, ±S.D., N=03).

Following equation was used to estimate hourly and daily flux rates,

F= {V. (Cf-Ci)/A. T}

Where, F = element flux (mol m-2 h-1), Ci= Initial concentration (M), Cf= Final

concentration (M), A= Surface area of the sediment (m2), V = Volume of water (l) and T=

Time of incubation (h).

37

2.3.5. Statistical Analysis:

Data was analyzed by using Microsoft Excel, (2013) for analysis of results in M and

estimation of daily flux rates. To examine the similarities of physicochemical parameters

under various seasonal and tidal conditions, the statistical software Minitab 17.0 was used

for the Pearson correlation (p< 0.005), PCA principle component analysis and Cluster

analysis. R-programming was done to initially analyze the raw data and observe the

variations which were then represented by excel graphs detailing the difference in nutrient

concentrations between inside and outside the bell jar with respect to seasons and tidal

cycles. The standard errors presented in graphs is of N=3 mean.

2.4. Results and Discussions:

2.4.1. Physicochemical properties and nutrient rates of mangrove backwaters:

Table VII. summarizes the mean (±S.D.) values of physical parameters recorded during this

study. The temperature ranges from 15 to 28 ˚C during all three seasons. The sediment

temperature was steady as compared to the air and water temperatures which fluctuated

more frequently during the high-low-high tidal cycle. The monsoon season have more

temperature variations as compared to other seasons. The salinity along with dissolved

oxygen is the most unstable parameter. Its values changed with respect to every tidal cycle.

It varied from 30+ to 42 PSU on daily basis throughout all seasons. Mean salinity levels of

post-monsoon season were lower as compared to other seasons. Although the pH level of the

38

study site usually ranged from 6.9 to 8.6 (Shafique, 2004), we observed the pH values

between 7.1-7.5 respectively. The pH levels were stable in all seasons with no drastic

change where as, the dissolved oxygen varied from 0.4 to 0.8 ppm. Its values also differed

with tidal change but remained within higher limit during monsoon seasons as compared to

pre and post monsoon seasons. The mat area chlorophyll-a concentrations were found to be

0.48 to 1.44 mg/m-3. The tidal height levels were high in monsoon season 1.5m among

frequent rainfall.

39

Tab

le

VII

. P

hy

sica

l par

am

eter

s o

f S

and

spit

m

angro

ve

chan

nel

w

ater

. M

ean

(±S

.D.)

o

f si

te

du

rin

g

Pre

-mo

nso

on,

Mo

nso

on a

nd

Po

st-m

on

soon

sea

son

s (N

=0

3).

40

The exchange of nutrients occurred inside the bell jar chambers of IN M and without mat IN

WM areas. There was significant variation in benthic nutrient flux of M and WM sediment

areas. The daily benthic flux rates were estimated (Table VIII) and we observed that in M

area, there was NO2- release in the pre- monsoon and monsoon seasons and uptake during

post monsoon. The NO3- flux pattern was not similar and showed uptake in monsoon season

and release in post monsoon and pre monsoon seasons. The NH4+ uptake was more in pre

monsoon season and release rate was higher during post monsoon season as compared to

monsoon season. The PO43- uptake occurred during the post monsoon season and the release

was low during monsoon and high in pre monsoon season. In the WM area, the nutrient flux

rates release and uptake levels were lower as compared to M area values. There was

frequent nutrient release as than uptake. The rate of nutrient ions does not directly coincide

with the tidal cycle. The mean nutrient ion concentrations of IN M, IN WM, OUT M and

OUT WM were plotted against tidal cycles of all seasons (Fig. 3). During the pre-monsoon

season all the nutrients concentration were low to moderate during the first high tide.

Decreased values were observed in low tide and finally increased rates were recorded in

second high tide cycle respectively. The highest values of NO2- (0.004±0.001 mol.m-2.h-1),

NO3- (-0.004 to 0.02±0.010 mol.m-2.h-1), NH4

+ (-0.138 ±0.120 to 1.308±0.640 mol.m-2.h-

1) and PO43- (0.030±0.010 mol.m-2.h-1) were observed during pre-monsoon season with the

tidal height reaching 0.5 (± 0.10) meters. In the monsoon season, the NO2- (0.010±0.002

mol.m-2.h-1) and NH4+ (0.210±0.05 mol.m-2.h-1) values increased and decreased with tides

but NO3- (-0.010±0.020 to 0.050±0.020 mol.m-2.h-1) and PO4

3- (-0.002±0.010 to

0.020±0.010 mol.m-2.h-1) levels exhibited an inversely proportional relationship. Tidal

height was recorded up to 1.5 (± 0.10) m. Throughout the post monsoon season, we

41

observed fluctuations in NO2- values. The remaining nutrients showed lower levels in 1st

cycle of high tide and higher levels during low tide and 2nd high tide cycle. Tidal height of

0.8 (± 0.10)m was recorded. The maximum rates of NO2- (-0.002±0.003 to 0.010± 0.004

mol.m-2.h-1), NO3- (-0.004±0.010 to 0.05±0.020 mol.m-2.h-1), NH4

+ (0.641±0.170 mol.m-

2.h-1) and PO43- (0.010±0.003 mol.m-2.h-1) were observed in post monsoon respectively.

Overall, the nutrient rates of OUT M and OUT WM sites were towards the lower end.

Increased values were found during high tide levels and the low tide mostly presented steady

concentrations. Frequently, 1st high tide cycle exhibited lower levels as compared to 2nd high

tide cycle.

42

Tab

le V

III.

Ben

thic

nu

trie

nt

flu

x r

ates

by

bel

l ja

r m

eth

od o

f m

at a

nd w

ithou

t m

at s

ites

du

rin

g P

re-m

on

soo

n,

Mo

nso

on a

nd

Po

st-m

on

soon

sea

son

s per

day m

ean

(±

S.D

.).

(WM

= w

ith

out

mat

sit

e, M

= m

at s

ite,

NO

2- N

itri

te,

NO

3- N

itra

te,

NH

4+ a

mm

on

ium

an

d P

O43- p

hosp

hat

e).

43

Figure 3. Nutrient ion concentration according to tidal cycle during pre-monsoon, monsoon

and post-monsoon seasons. (A) Pre-monsoon IN WM, (B) Pre-monsoon OUT WM, (C) Pre-

monsoon IN M, (D) Pre-monsoon OUT M, (E) Monsoon IN WM, (F) Monsoon OUT WM,

(G) Monsoon IN M, (H) Monsoon OUT M, (I) Post-monsoon IN WM, (J) Post-monsoon

OUT WM, (K) Post-monsoon IN M and (L) Post-monsoon OUT M. where, M= mat area,

WM= without mat area, IN= inside the bell jar, OUT= outside bell jar The hours 1-4= 1st

high tide, 5-8= low tide and 9-13= 2nd high tide cycle respectively.

44

Table IX. Pearson correlation matrix of nutrient ions by bell jar method and

physicochemical parameters.

(p< 0.005, *significant, **highly significant)

The correlation matrix with p<0.005, showed a significant positive relationship between

water temperature and NH4+ and negative relation between Chl a and NH4

+. NO3- exhibited a

positive relation with air temperature and pH and negative correlation with salinity and

dissolved oxygen. pH was negatively correlated with salinity and DO, salinity was

positively related with DO and chlorophyll a content and finally, tidal height was positively

correlated with DO (Table IX).

45

2.4.2. PCA and Cluster Analysis:

The principal component analysis (PCA) of nutrients ions and physicochemical parameters

under various seasons exhibited clear cluster of different seasonal and mat conditions. PCA

score plot (Fig. 4A) showed positive aggregates of conditions 11,5,6 and 12 and negative

aggregates of conditions 9,4,10 and 3 on PC1 axis (first component). The cluster of

conditions 7, 1, 2, and 8 on the positive axis of PC2 (second component) were recorded. The

table of loading for principle components of nutrient and field parameters was detailed

(Table X). According to the initial scree plot analysis and eigenvalues determining 80.90%

variability, two principle components were found to be significant. PC1 contributed 47.40%

of total variance whereas; PC2 was accounted for 80.90% of the total variability. PC1

showed high negative loading for salinity and dissolved oxygen and strong positive loading

for nitrate and water temperature was observed. PC2 indicates high negative factor of soil

temperature and tidal height, and exhibit strong positive factor for air temperature and

chlorophyll content. In both components PC1-2, Nitrite and air temperature were positively

loaded while, phosphate, soil temperature and dissolved oxygen were negatively loaded.

The cluster analysis of water parameters (nutrients and physico-chemical variables) under

different seasonal and mat conditions result in four clusters (Fig. 4B). Accordingly, the same

seasonal conditions form close aggregates. This result is similar to principal component

analysis with slight variations. The first cluster includes conditions 1, 2, and 8 which

indicates that during pre-monsoon season the water quality of mangrove channel was similar

both inside and outside the bell jar both in M and WM areas. The conditions 2 and 8 were

46

closely aggregated suggesting similar state of water quality outside the bell jar of M and

WM areas. The second cluster consists of 3, 4,10 and 9 conditions, which shows that during

monsoon season the water quality is similar at M and WM site. The closely related 4 and 10

conditions demonstrate that, water conditions were unvaried outside the bell jar of both mat

and without mat areas. The third cluster exhibit aggregates of conditions 5,6,11 and 12

which indicate during the period of post-monsoon season, the mangrove channel water was

indistinguishable in and out of bell jar while the closely associated clusters were arranged on

the basis of N and WM sites. The fourth cluster was found to be distinctly different. It

contained only condition 7 which is pre-monsoon season inside the bell jar in mat area. This

may be justified due to the presence of favorable conditions for mat bloom as we observed

higher chlorophyll a level in pre-monsoon than rest of the seasons which impact the water

quality resulting in a separate group. The four clusters generated may relate to identical

characteristic of water parameters represented in these cluster groups (Fig. 4B).

47

Table X. PCA results showing the first two components for water characteristic including

nutrient ions and physicochemical variables of twelve seasonal and mat conditions at

Sandspit mangrove site.

Variables PC1 PC2

NH4+ 0.150 -0.327

NO2- 0.265 -0.036

NO3- 0.343 0.092

PO43- -0.106 -0.173

Air°C 0.291 0.354

Water°C 0.335 -0.290

Soil°C -0.014 -0.494

pH 0.416 -0.003

SalinityPSU -0.403 0.121

DO ppm -0.401 -0.134

Chla mg/m-3 -0.220 0.418

Tide m -0.192 -0.439

Eigenvalue 5.692 4.012

Proportion 0.474 0.334

Cumulative 47.400 80.900

48

Figure 4A. PCA Two dimensional plot of field physicochemical variables (pH, Salinity,

Dissolved Oxygen, Chlorophyll a content, temperature (Air, Water, Soil) and Tidal height)

and nutrient content (Nitrite, Nitrate, Ammonia and Phosphate) of twelve conditions located

at Sandspit mangrove site. [1) Pre-monsoon IN WM, 2) Pre-monsoon OUT WM, 3)

Monsoon IN WM, 4) Monsoon OUT WM, 5) Post-monsoon IN WM, 6) Post-monsoon

OUT WM, 7) Pre-monsoon IN M, 8) Pre-monsoon OUT M 9) Monsoon IN M, 10)

Monsoon OUT M, 11) Post-monsoon IN M and 12) Post-monsoon OUT M. where, M= mat

area, WM= without mat area, IN= inside the bell jar, OUT= outside bell jar.]

49

Figure 4B. Dendrogram (Cluster Analysis) of physical and chemical variables (pH, Salinity,

Dissolved Oxygen, Chlorophyll a content, temperature (Air, Water, Soil) and Tidal height)

and nutrient ions content (Nitrite, Nitrate, Ammonia and Phosphate) of twelve seasonal and

mat conditions observed at Sandspit mangrove site. (1) Pre-monsoon IN WM, 2) Pre-

monsoon OUT WM, 3) Monsoon IN WM, 4) Monsoon OUT WM, 5) Post-monsoon IN

WM, 6) Post-monsoon OUT WM, 7) Pre-monsoon IN M, 8) Pre-monsoon OUT M 9)

Monsoon IN M, 10) Monsoon OUT M, 11) Post-monsoon IN M and 12) Post-monsoon

OUT M. where, M= mat area, WM= without mat area, IN= inside the bell jar, OUT= outside

bell jar, The brackets colour code the following clusters, Blue and Brown= Pre-monsoon

season, Red= Monsoon season, Green=Post-Monsoon season).

71 21 16591 043821

0.00

33.33

66.67

1 00.00

Conditions

Sim

ilari

ty

50

Table XI. Nutrient Fluxes determined by Bell jar method in different regions.

(n.a.= not available, NOx- = NO2- + NO3

-, NO2- Nitrite, NO3

- Nitrate, NH4+ ammonium and PO4

3- phosphate)

STUDY SITE COUNTRY NUTRIENT FLUX RATES (mol.m-2 d-1)

SOURCE NOX- NO2

- NO3- NH4

+ PO43-

Sawi bay Thailand 105 to 690 n.a. n.a. 280 to 2260 n.a. Alongi, Trott, Wattayakom and

Clough, 2002.

Southern everglades USA n.a. n.a. n.a. -754 to -158 -199 to -50 Davis, Childers, Day, Rudnick and

Sklar, 2001.

GBR Shelf Australia n.a. 48 216 1920 168 Lourey, Alongi, Ryan and Devlin,

2001.

Gazi bay Kenya n.a. 190 4941 -950 2215 Mwashote and Jumba, 2002.

Matang mangrove forest

reserve Malaysia n.a. n.a. n.a. -440 to -250 n.a. Alongi, 2004.

Citanduy mangrove Indonesia n.a. n.a. 0.1 to -14.4 -0 - 0 to -845 Moll, 2011.

51

We were successful in conducting bell jar survey to determine the nutrient flux rate of

mangrove Sandspit backwaters for the first time in Pakistan. Samples were also collected in

bottle outside the bell jar to observe the variation in the nutrient concentration. It was found

that the nutrient levels were lower outside the bell jar but the rate of increase and decrease of

nutrients level outside was similar to that of inside indicating, both methods are effective in

determining the water quality of mangrove area. These methods may be useful in

quantifying the nutrient exchange rates in wetland ecosystems all over the Pakistan coast.

The nutrient fluxes in this area were associated with benthic mat and without mat sediment -

water dynamics.

The physical parameters along with the runoff from industrial area mainly through Layari

river (Khan and Saleem, 1988; Rizvi, Saleem and Baquer, 1988) are of some significance in

the hydrodynamics and chemical properties of mangrove area water channel (Ovalle,

Rezende, Lacerda and Silva, 1990; Nedwell, 1994). The present measurements of

physicochemical parameters of Sandspit mangrove channel were generally in the same range

characterized earlier by Seema, (2004) and Farooqui, (2012). During our study period

salinity was generally high throughout most of year. The salinity levels were high even

during the monsoon season due to late and low precipitation and low during post monsoon

season due to late rain fall which lasted till early post monsoon season. There were no

marked variations in salinity and pH levels concurring with earlier data from the same

mangrove site ((Seema, 2004; Farooqui, 2012; Nizam, Ahmed, Shaukat, Khan and Ali,

2013). The pH remained <8 due to regular waste water input. Transition period from pre-

monsoon to monsoon exhibited the highest tidal range and dissolved oxygen. The medium

for nutrient upwelling is induced by tidal cycle managing the flow from sediment into the

52

water channel. Therefore, tidal level determines the nutrient exchange rates (Dittmar and

Lara, 2001a). There was a gradual increase in dissolved oxygen from post monsoon to

monsoon season and we found strong correlation between DO and salinity (0.866) There

was no significant correlation between nutrients and DO which showed that dissolved

oxygen in this channel is not mainly dependent on wastewater input (Ray, Majumder, Das,

Chowdhury and Jana, 2014). Low DO levels were observed in the present observations may

be due the heterotrophic activity in water column (Reddy and DeLaune, 2008). The study

area received sufficient light and chlorophyll a content to sustain benthic microbial

communities during all seasons. The chlorophyll a levels recorded during the present study

were higher than that of earlier reports (Farooqui, 2012). The higher values were observed

during pre monsoon season. This may be because the waters during this season is

comparatively less erratic and the conditions for microbial colony especially cyanobacterial

blooms are favorable for mat formation (Negri, Montoya, Carreto, Akselman, Inza,

Steidinger, Landsberg, Tomas and Vargo, 2004).

In the present study nutrient levels were relatively low as compared to other systems (Table

XI). The flux pattern found at mangrove site showed positive net flux of nutrients during

monsoon and post-monsoon season and negative flux occurred more during the pre-

monsoon season. The concentration of nutrients appears to be under the influence of tidal

height and seasons (Farooqui, 2012). The post monsoon season contained maximum

nitrogen content of NO2- (0.11 ±0.09 mol.m-2.d-1), NO3

- (1.18 ±0.31 mol.m-2.d-1), NH4+

(5.3 ±1.65 mol.m-2.d-1) respectively whereas, PO43- (0.67 ±0.05 mol.m-2.d-1) was highest

during pre- monsoon. The nitrate and phosphate concentrations of the Sandspit mangrove

53

channel is within the range of Citanduy mangrove study (Moll, 2011). The difference in

NH4+ flux appears more for rate of sediment uptake. The difference in the processes

occurring within the sediment for nutrients may be responsible for variations in the flux

rates among these two sites (Cabrita and Brotas, 2000).

As the consistent release of dissolved forms of nitrogen usually occurs in mangrove areas

(Rivera-Monroy, Day, Twilley, Vera-Herrera and Coronado-Molina, 1995), it was observed

that the NO2- and NO3

- levels in the survey area were marked by more release than uptake.

Reverse was true for NH4+ levels. Nitrate uptake by sediment during the monsoon season

suggests that denitrification may be occurring in the sediment (Twilley and Kemp, 1987).

Occurrence of nitrogen fixation has been studied earlier in mangrove soil (Holguin, Vazavez

and Bahon, 2001) having low denitrification rates (Kristensen, Jensen, Banta, Hansen,

Holmer and King, 1998). The Decreased levels of NO2- and NO3

- results in low nitrification

activity probably due to competition among primary producers and nitrifiers for ammonium

ion (Bartoli, Nizzoli and Viaroli, 2003). Low nitrification rates also decline denitrification

rates (Rivera-Monroy and Twilley, 1996). Overall low nitrogen flux rates may also be due to

algal oxygen production during light period resulting in decreased denitrification (Nielsen,

Christensen, Revsbech and Sorensen, 1990). NH4+ was found to have maximum flux rates.

Highest uptake occurred during pre-monsoon season (-31.68 ±46.44 mol.m-2.day-1). The

ammonium ion exchange indicates a linkage between sediment communities producing and

degrading organic matter at sediment water interface (Simmons, 1995). NH4+ levels suggest

that the benthic microbial community preferred it as the primary nitrogen source. The

gradual decline of NH4+ from post monsoon to pre monsoon and finally to monsoon concurs

54

with the Sundarban mangrove area study (Ray, Majumder, Das, Chowdhury and Jana,

2014). Phosphate act as a limiting factor for microorganisms related to coastal ecosystems

(Cole and Sanford, 1989). The PO43- flux showed similar pattern as that of NO2

- and NO3-.

Relative to M area, more positive flux was found in WM area due to large waste water

runoff. This implies that the mangrove sediment serves as a water column phosphorus

source as, sedimentation and mineralization sustains the phosphate export (Dittmar and

Lara, 2001b). The phosphate levels reported were mostly <0.8 reflecting that this site is

phosphate limited (Boyer, Fourqurean and Jones, 1999) this is similar to earlier study

showing low stocks of inorganic phosphate forms (Alongi, Boto and Robertson, 1992) in

mangrove area. Our levels were between 0.05-0.67 uM which are similar to the study of

Davis, Childers, Day, Rudnick and Sklar, (2001).

The primary members of microbial mat include cyanobacteria which can assimilate

nitrogenous compounds (Hogarth, 2015) and some such as Aphanocapsa sp. (which is

present in the micro mat sandspit mangrove area) also internally store phosphates in form of

polyphosphates (Kromkamp, 1987). We observed an inverse relationship between phosphate

efflux from sediment and microbial mat (Andersen and Kristensen, 1988). Net low levels of

PO43- release rates indicate sediment resuspention in terms of solid state diffusion and

adsorption thus forming a PO43- sink (Vidal, 1994).

Mangrove sediment is the reservoir of nitrogen which also play a significant role in nutrient

exchange (Sundback, 2005). We observed net fluxes to be occasionally higher in clay mud

(M) than sand-silt (WM) site. The rates of nutrient exchange coincide with the presence and

absence of microbial mat. Benthic organisms related to mat are also the cause of lower

55

levels of overall nutrient content (Sundback, 2005). The process of biosorption executed by

microorganisms present in mat can considerably reduce the nutrient ion levels thus creating

a nutrient sink in mangrove area (Alongi, 1996). During our study period we also observed

significant changes in the density and composition of microbial mat present throughout the

seasons (Yasmeen, Shafique, Zaib un Nisa and Siddiqui, 2016) that may have contributed to

nutrient level variation. Most exchange occurred at the mat area (Davis, Childers, Day,

Rudnick and Sklar, 2001). This enhanced the significance of benthic microbial mat in

regulating the nutrient exchange in Sandspit mangrove channel. The nitrogen flux was

relatively higher in the mat area than the non mat area. It was observed that the mangrove

area without mat was involved in nutrient transformation. This may be due to the presence

of sediment associated denirifiers (Fan, Shieh, Wu and Chen, 2006) and bacteria involved in

the nitrification process (Krishnan, Fernandes, Chandan and Bharathi, 2007) which were

also abundant in deeper layers of mangrove soil and not necessarily associated with mat.

Our data indicated successive trapping of nitrogen leading to reduction by nitrification and

denitrification respectively. Most of the nutrients were translocated into the sediment. The

mat along with sediment acted as a sink for nutrients. Our results allowed us to determine

the significance of study site in nutrient exchange across the area. Despite huge coverage

along the coastal belt. few studies were generated based on nutrient levels. Our study fills

that gap by creating a baseline data and understanding the regional pattern of nutrient rates

in this ecosystem. This tidal fringe mangrove area at Sandspit serves as an active site for

nutrient balance and availability throughout all seasons.

56

CHAPTER 3

MICROBIAL MATS ASSOCIATED WITH

MANGROVES PROVIDE SOIL STABILIZATION AND

MODIFY NUTRIENT CHEMISTRY DURING

MONSOON CYCLES: SANDSPIT BACKWATERS,

PAKISTAN.

(Manuscript submitted for Publication)

57

MICROBIAL MATS ASSOCIATED WITH MANGROVES

PROVIDE SOIL STABILIZATION AND MODIFY

NUTRIENT CHEMISTRY DURING MONSOON

CYCLES: SANDSPIT BACKWATERS, PAKISTAN.

3.1. Abstract:

We examined the characteristic of sediments and water nutrient levels in channels of the

Sandspit backwater mangroves. By using bell jar method and characterization of soil

physicochemical parameters, we found that there was seasonal variation in water nutrients

and edaphic characters. We observed a positive impact of microbial mat on mangrove soil.

The soil covered with microbial mat consists mainly of fine sands whereas the fringe area

soils have high medium sand content. Statistical analysis exhibited positive correlations

(p<0.05) between selected soil variables (Temperature, pH, salinity, bulk density,

chlorophyll a/b, total carbon, organic matter, moisture content, water holding capacity and

C/N) and water channel nutrients (NO2-, NO3

-, NH4+, PO4

3-). According to PCA soil salinity-

temperature, organic matter, water holding capacity, soil moisture, NH4+ and PO4

3- were

found as significant variables for two different soil types. Cluster analysis results were

similar to PCA. It is concluded from the results that seasonal changes within individual soil

types were not exceptional. Instead, the soil sediments were more influenced by the presence

of mat than by pre-monsoon, monsoon and post- monsoon seasons. Microbial mat

associated with mangrove forest floor played a considerable role in increased percentages of

total nitrogen and total carbon whereas, waste water runoff affected the inorganic nitrogen

and phosphate concentrations. These results suggest complex interactions among edaphic

and hydrological factors and provide valuable data for future modeling, rehabilitation and

productivity of similar mangrove sites. The current study provides the means to establish

management strategies for tropical mangrove ecosystems based on the interpretation of the

responses of a tropical system to seasonal changes as a tool, taking in consideration the

sediment properties and nutrient flux rates. These findings are relevant not only for Sandspit

investigation but also for other mangrove ecosystems, especially those compromised by

marine pollution. This small scale study provides general knowledge and understanding of

seasonal ecological interactions, which are of global significance.

58

3.2. Introduction:

Mangroves are productive tropical and subtropical ecosystems, which serve as an efficient

ecological and economic resource. Mangroves provide unique estuarine habitats for a

variety of animals and act as an excellent breeding and nursery grounds for many

commercial fisheries (IFAP, 2008). They protect against harmful effects of coastline

erosion, thunder storms and tsunami. Mangrove is considered to be carbon sink as well as

the site of accumulation of sediment and nutrients (Alongi and Carvalho, 2008; Bouillon,

Borges, Castaneda, Diele, Dittmar, Duke, Kristensen, Lee, Marchand, Middelburg, Rivera,

Smith and Twilley, 2008). Mangrove forest floor is covered by dense microbial mat. The

mat is a complex community mainly structured by benthic organisms like bacteria,

cyanobacteria and diatoms (Noffke, Knoll and Grotzinger, 2002; Yasmeen, Shafique, Zaib

un Nisa and Siddiqui, 2016) and serve as a food source for various members of benthic

fauna (Andersen and Kristensen, 2002). The microorganisms in the form of biofilms and

microbial mats prevent sediment erosion and biologically stabilize the sediment substrate.

These structures act as an efficient tool for sediment trapping and mineral-nutirent

deposition (Friend, Lucas, Holligan and Collins, 2008; Noffke, 2010). Mangrove sediments

entrap organic carbon from detrital and other marine sources. Microbial mat associated with

mangrove environment influence the carbon sequestration resulting in an increased carbon

budget (Bouillon, Moens, Overmeer, Koedam and Dehairs, 2004; Alongi, 2007). The

microbial mat also contributes to input of detrital material present in mangrove top soil

which is consumed by fiddler crabs, gastropods and other organisms (Kristensen and

Alongi, 2006).

59

The mangrove sediment degrades and stores organic material and other nutrient and

minerals but it also transports these material selectively to adjacent ecosystems via tidal

cycle (Dittmar, Hertkorn, Kattner and Lara, 2006; Kristensen, 2008). The remineralization

of detrital material by fungi and bacteria, generates essential nutrients for microalgae present

in microbial mat (Lee, 2008). The two main components e.g. soil and water, are extremely

relevant to analyze because hydrological changes affect the soil and its associated flora

(Deco, Hummon and Fleeger, 1985) and the sediment structure directly and indirectly

influences the associated habitat (Hogue and Miller, 1981). Properties of sediments such as

porosity, grain size, water content, organic matter content (Chapman and Tolhurst, 2007),

salinity (Jensen, 1985) play a significant role in maintaining the diversity and abundance of

associated communities.

Pakistan has the world largest arid zone mangrove forest (Abbas, Mueen, Ghaffar, Khurram

and Gilani, 2013). The coastal area of Pakistan is broadly distributed into Baluchistan coast

(745 Km) and Sindh coast (245 km, including Karachi coastal area and Indus Delta) (GoP,

2007). Karachi coast is included in Global 200 Ecoregions and it consists of two significant

sites: Karachi Harbour and Sanspit backwaters area. Sandspit is situated 18 Km southwest of

Karachi city and runs parallel to the Arabian sea coast (Damhoureyeh and Ghalib, 2014).

The manora channel adjacent to Sandspit area is heavily polluted due to municipal and

industrial waste that are discharged into backwaters area through Layari and Malir rivers

respectively (Zaigham, 2004). This input directly influences the Mangrove ecosystem and

causes poor water quality and reduced species diversity and flourishing of invasive pollution

indicator species (Rizvi, 1997). Earlier studies showed that the mangrove ecosystem is under

60

severe stress due to marine pollution caused by anthropogenic factors (Qureshi, Sajjad,

Mashiatullah, Waqar, Jan, Akram, Khan and Siddiqui, 1997).

In Pakistan, Studies on various aspects of mangrove area were conducted including,

sediment grain size (Qureshi and Sultana, 2001), vegetation (Saifullah and Rasool, 1998;

Rashid and Abbas, 2011), Mangrove flora and fauna (Siddique, Farooq, Shafique and

Farooqi, 2008; Zaib-un-Nisa, Mansoor and Siddiqui, 2000; Shafique, 2004 ), Litter

production and pore water nutrients (Farooqui, 2012), Benthic fauna and granulometric

characters (Qureshi, Farah and Saher, 2015), Elemental Soil analysis (Noor, Shaukat and

Naseem, 2015), and Sediment chlorophyll content (Farooq and Siddiqui, 2011). But the

seasonal studies related to mangrove sediment and hydrological parameters were not up to

date. The present work compares the dynamics of seasons; (pre monsoon, monsoon and post

monsoon with physicochemical soil-water associated variables. The two types of sediment

characteristics of mangrove forest floor: soil covered with microbial mat (M) and fringe area

without microbial mat (WM), were defined using analytical tools such as total carbon (TC)

and nitrogen content (TN), organic carbon (LOI), moisture, bulk density (B.D.), water

holding capacity (WHC) and grain size analysis. Dissolved inorganic nutrients ions such as

nitrite (NO2-), nitrate (NO3-), phosphate (PO43) and ammonium (NH4

+) in channel water

were also examined by the bell jar method.

61

3.3. Material and methods:

3.3.1. Site description:

Sandspit mangrove backwaters forest area is situated at (24º49’05.63” N, 66º56’37.21” E)

southwest of Karachi city (Fig. 2 a, b) (for detailed description see page 31).

3.3.2. Field Sampling:

The study was conducted for the period from 2012 to 2013. The collection period was

distributed into Pre-monsoon (Jan-march), Monsoon (April-early Oct) and Post-monsoon

(late Oct-Dec) seasons. As the main objective of this study was to examine the relationship

between seasons, sediment and inorganic nutrients. The ecological characteristics were

determined within 1 sq. meter quadrates that were placed at two study sites of mangrove mat

area (M) and, mangrove without mat area (WM). Data recorded form quadrates includes

field parameters (temperature, salinity, pH and dissolveld oxygen) and sediments analysis

(organic matter content, moisture content, bulk density, total organic carbon and total

nitrogen content, chlorophyll a and b content, grain size, water holding capacity). Bell jar

was used to determine hydrological parameters. All the samples were collected and analyzed

in triplicate and mean of data, ± standard deviation was computed.

62

3.3.3. Sediment analysis:

Sediment samples were retrieved via corer (29 mm diameter, 4 inches). The samples were

wrapped in aluminum foil and stored in icebox. In laboratory, the cores were sectioned in to

equal top mid and bottom sections (3 cm each). Each section was sub-sectioned for different

analysis. Sediment moisture content was determined by standard A.O.A.C. 1970 method. 1

gm of soil sample from each section was weighted before and after 24 hrs., 110 ºC oven

treatment. Sediment organic content was recorded using standard A.O.A.C. 1970 method.

Difference of 1gm sample was taken after 8hrs-450ºC muffle furnace treatment. Sediment

Chlorophyll a and b content were examined spectrophotometrically (630, 664, 647 and 750

nm) according to the methods of Strickland and Parson, (1972).

Total organic carbon and total nitrogen content were determined by the wet oxidation of

carbon by acid dichromate and spectrophotometric method described by Strickland and

Parson, (1972) and Kjeldahl method (Mann and Saunders, 1978), respectively. Soil pH was

examined by the method of Pansu and Gautheyrou, (2007) using 1mM KCL (Merk) and

salinity was recorded by using the method of Rhoades and Chanduvi, (1999). Soil bulk

density was estimated according to the method of USDA-NRCS, (1996) and water holding

capacity was determined by method of ISO 11274/1998 (Wilke, 2005). For Grain size

analysis separate (50 cm iron corer) was used) in triplicate and sediment samples (100 gm

each) were sieved through different mesh sizes followed by method described by Alfaro,

(2006).

63

3.3.4. Channel water analysis:

Bell jars capacity 21 liters were placed and manually operated (Asmus, Sprung and Asmus,

2000) at M and WM sites. The water physicochemical and nutrient parameters were

analyzed (for details see page 29).

3.3.5. Statistical analysis:

Net benthic flux was calculated by the equation of Bartoli, Nizzoli and Viaroli, (2003) (see

page 30). The positive values represented exchange from sediment into water column

(release rate) and negative values corresponded with exchange from water to sediment

(uptake rate) respectively

The observed data were computed by R programming for initial processing of raw data.

Microsoft Excel, 2013 was used for graphical interpretations and estimation of flux rates

within 24 hours. To examine correlation of physical and chemical factors under different

seasonal conditions, Minitab 17.0 software was used for the determination of Pearson

correlation (p<0.05, double checked by statistical software PAST), one-way ANOVA (p α

0.05), Principle component analysis (PCA) and Cluster analysis (dendrogram). The

graphical values plotted were of N=3 means (± S.E).

64

3.4. Results and Discussion:

3.4.1. Sediment Characteristics:

The overall soil properties observed in mangrove M and WM areas reflected that the mat

area is considerably organic in nature. The total nitrogen (TN%), total carbon (TC%),

dissolved oxygen DO, organic content by loss of ignition (LOI%), water holding capacity

WHC%, Moisture content, chlorophyll content (Chl a and Chl b) were generally higher in

the mat area than the corresponding fringe area. Data obtained on soil physico-chemical

properties revealed following,

Grain size, profile suggests variation in sediment deposition during three seasons (Fig. 5).

The sediment was categorized into coarse (250<500m/ 1-2), medium (125<250m/ 2-

3), fine sand (90<125m/ 3-3.5) and silt (<63m/4-6) (Hennig, Eagle, Fielder, Fricke,

Gledhill, Greenwood and Orren, 1983). The medium sand was found to be in highest

percentage followed by fine sands. The grain size data was seasonally analyzed and it was

observed that highest % of medium sediment was found in WM site during post monsoon

season. High fine sand % was recorded in M site in pre monsoon season. This may be due to

frequent wind, wave actions and storms that may induce translocation of sediment. This

initial textural analysis suggests that the sediment displacement may be taking place with

respect to seasonal changes. Sedimentation rates were more during monsoon due to

favorable biological (crab borrow activity) sediment associated interactions (Cuadrado,

Carmona and Bournod, 2011; author observation). Seasons have an influence on nutrient

rates and edaphic factors. The results of moisture content, LOI%, chlorophyll a content and

sediment texture concur with earlier studies of Farooqui, (2012) and Shafique, (2004)

although the investigations were in different area but with similar soil type.

65

Figure 5. Grain size percent composition of mat covered (M) and without mat (WM)

sediments during pre-monsoon, monsoon and post monsoon seasons.

0

10

20

30

40

50

60

-1 0 1 1.5 2 2.5 3 3.5 4

Fre

qu

en

cy (

wt%

)

Size

Pre-Monsoon M

Pre-Monsoon WM

Monsoon M

Monsoon WM

Post-Monsoon M

Post-Monsoon WM

66

Figure 6. Mean (±S.E.) Total Carbon and Nitrogen composition of the sediment in the

Sandspit Mangrove area, M=mat area, WM=without mat fringe area, N=nitrogen, C=carbon.

0.00

0.20

0.40

0.60

0.80

1.00

1.20

1.40 0.0

2.0

4.0

6.0

8.0

10.0

12.0

051005100510

Pre-MonsoonMonsoonPost-Monsoon

M N % WM N% M C % WM C%

Seasons/Sediment depth (cm)

To

tal

Carb

on

%T

ota

l Nitr

og

en%

67

Fig

ure 7

. V

erti

cal

pro

file

s o

f (A

) W

ater

hold

ing c

apaci

ty, (B

) M

ois

ture

co

nte

nt,

(C

) O

rgan

ic m

att

er v

ia L

oss

of

ignit

ion,

(D)

Car

bon

-Nit

rog

en r

atio

an

d (

E)

Chlo

rop

hyll

a-b

rat

io m

easu

red a

t m

at c

ov

ered

(M

) and f

rin

ge

(wit

hou

t m

at)

(WM

) si

tes

du

ring p

re-m

on

soo

n,

mon

soon

, an

d p

ost

-mon

soon s

easo

ns.

Plo

tted

val

ues

are

mea

n

of

trip

lica

te, (±

S.E

.).

Sediment Depth (cm)

68

Total organic carbon, content varied from 0.47 to 1.01% (Fig. 6). The autochthonous and

allochthonous sources are responsible for organic carbon in the mangrove ecosystem. We

observed that the distribution of TC% corresponds with sediment type that is; its

concentration was high in M area and low in WM area. This may be attributed to the

microorganisms associated with microbial mat which provide increased percentage of

organic content (Wooller, Smallwood, Jacobson and Fogel, 2003). Increased values were

observed during monsoon period. The carbon content in M area increases with depth and in

WM area the top soil contained more TC% than deeper layers (Bhavsar, Jasrai, Pandya,

Singh and Patel, 2014). This may be due to regular tidal flooding and low decomposition

rate that may results in high content of organic matter on these sites at depths of 10 cm and

more (Ceron-Breton, Cerón, Rangel, Murielgarcia, Cordova and Estrella, 2011).

There was a positive correlation between TC% and air–water-soil temperatures, water pH,

WHC%, LOI%, moisture content, nitrate and negative correlation with soil pH, water

salinity and C: N. The vertical profile of C: N showed that the ratio is variable with depth

(Fig. 7d). The total organic content was not high as compared to other south east Asian

mangrove ecosystem studies of Bhavsar, Jasrai, Pandya, Singh and Patel, (2014) and Moll,

(2011). But it was similar to Bangladesh mangrove study of Hossain, Aziz and Saha, (2012).

Lower ranges of TC% may be due to root system of Avicennia which is present in close

proximity of top soil (Marchand, Baltzer, Lallier and Albéric, 2004). Increased rates of C

and N may attribute to nutrient content reclaimed by soil through litter fall (Shafique, 2004).

As monsoon season was characterized by favorable conditions for primary producers and

also for mangrove trees (Mackey and Smail, 1995), this may also result in the observed

69

overall increased input of C and N content during monsoon period as compared to other

seasons.

Total nitrogen content, varied from 5.90 – 10.95% (Fig. 6). In present study, TN% in

sediment samples was high during pre-monsoon and monsoon and low during post-monsoon

season. The decreased levels of TC% corresponds to lower level of TN and vice versa.

Increase in N content may also favor rapid mineralization and assimilation by microbial

biomass (Levin, Boesch, Covich, Dahm, Erséus, Ewel, Kneib, Moldenke, Palmer, Snelgrove

and Strayer, 2001). Sediment particles trap fine detritus matter generating an increased

population of nitrifiers thus resulting high nitrogen levels in sediments up to 10 cm deep

(Wheeler and Kirchman, 1986). Increased TN% was observed in bottom section of 10 cm

sediment core samples at both M and WM sites. There was a positive correlation between

TN% and C: N, soil pH. The C: N ratios were mostly low with depth as compared to top soil

indicating that microbial mat associated organic matter was rapidly degraded (Marchand,

Elisabeth and Baltzer, 2003) and detrital matter associated with sediment may be a

significant source of nitrogen. Low C/N ratios also favor growth benthic algae resulting in a

thick microbial mat (Molnar, Marchand, Deborde, Patrona and Meziane, 2014) which we

observed over our studied M sediment top soil (Fig. 7d) (Table XIV).

Water holding capacity, of M area was higher than that of the WM area. WHC% was

highest during the monsoon season (34%) and lowest during post monsoon season (16%).

Vertical profile showed that the 0 cm top and 5 cm mid-section have high WHC% as

compared to 10 cm bottom section. There was a significant correlation between WHC% and

70

TN%, water pH, B.D., moisture content, Chl a, ammonia and negative correlation with

phosphate (Fig. 7a).

Moisture content, of M area was high (top soil) as compared to WM area. The top 10 cm

layer of sediment collected from each site contained 16 to 37% moisture. The highest value

was recorded during monsoon season M site. The lowest was observed during post-monsoon

at WM site. The vertical profile of moisture content showed some variation at top soil level

(Fig. 7b). We found a (+ve) correlation between moisture% and TN%, DO, air temperature,

water pH, Chl b and nitrate. Similar to earlier studies (Rao and Burns, 1990), we found that

microbial mat does improve water holding capacity.

Organic content, induces primary productivity, influence nutrient levels and WHC (Neue,

1985) in the mangrove area. LOI% in estuarine marsh may usually be up to 0-10% (450c 8h)

(Craft, Seneca and Broome, 1991). Sediment collected from M and WM sites were in the

range between 13 and 38%. The highest value was recorded during monsoon season and the

lowest recorded in post monsoon season. Increased organic contents in water column and on

top soil may facilitate the accumulation of Organic matter in to deeper layers of sediments.

Vertical profile showed high values in mid-section of WM site and top sections of M site.

LOI% was significantly (+) correlated with TN%, B.D., WHC%, moisture content, Chl a,

nitrate (Fig. 7c). Decomposition rate and Sediment type also plays a significant role in the

entrapment of organic matter (Ramanathan, 1997), resulting in increased rates of carbon

content in M area as compared to WM area.

71

Chlorophyll content, the mangrove area sediment was covered by microbial mat that was

0.1 to 0.5 cm thick on the sediment and consists of shades of brown, black and green. The

chlorophyll a and b content in the sediment cores showed variations in different sections

(that ranged between Chl a, 0.17-1.41; Chl b, 0.11-0.79 g. g-1). Chlorophyll a content was

higher as compared to chlorophyll b. Increased levels of chlorophyll a were observed in

monsoon season whereas, Chl b was more in post monsoon season. Vertical profile of Chl a:

b showed variable values at all sections (Fig. 7e). There was a strong correlation (+) between

Chl a and TN%, TC%, soil-water temperature, soil pH, water salinity, NH4+ and negatively

correlated with PO43-. The Chl b which is also an integral component used by cyanobacteria

(Grossman, Lemaux, Conley, Bruns and Anderson, 1981) that is present in mat of M site,

was positively significant with TN%, TC%, air-soil-water temperature, soil pH, water

salinity, Chl a and nitrate. Temperature, nutrients and cyanobacterial mats are also

responsible for Chl a distribution and variations in sediments (Saifullah, 1977; Facca and

Sfriso, 2007).

Soil pH, the soil pH was alkaline in nature throughout all seasons ranging between 8.43 up

to 9.44 which were normal for mangrove sites (Tam and Wong, 1998). Soil pH was low

during monsoon season. It was positively correlated with DO, water salinity, C: N and

negatively correlated with moisture content, LOI%, WHC%, and nitrate (Fig. 8a).

Soil salinity, showed significant variations between two M and WM soil types. The WM

site contained higher salinity rates as compared to M area in all seasons. Salinity ranged

between 35 and 69PSU (Fig.8b). Positive correlation was found between DO, B.D., soil

72

salinity and TC%, soil pH, nitrite and negative correlation was observed with, moisture

content, LOI%, WHC%, and Chl b content.

Soil temperatures, we observed no significant variations in the soil temperature-pH levels of

M and WM sites. The temperature and salinity values were similar to the mangrove study of

(Saravanakumar, Sesh, Thivakaran and Rajkumar, 2008). The soil temperature ranged

between 15 and 28 ºC. The maximum temperatures were observed during monsoon season.

The sediment was cooler as compared to air possibly due to fresh water input. Also, the

Avicennia marina canopy cover provides limited absorption of solar radiation (Tolhurst and

Chapman, 2007). The soil temperature correlated positively with DO, water pH, NO2-, NO3-

and negatively with soil pH, water salinity and C: N. (Fig.8c).

Soil bulk density, (B.D.) of M site is lower than WM due to presence of organic content

(Chen and Twilley, 1999b) the values were high during the monsoon season. B.D. was

found within the range of 0.83-1.25 g.cm-3 and was correlated (+) with TN%, TC%, soil-

water pH, nitrite, ammonia, C: N and negatively correlated to Chl b, phosphate (Fig. 9b).

73

(A)

(B)

(C)

Figure 8. Average values (±S.E.) of soil and water (A) pH, (B) salinity, (C) temperature,

recorded at the study sites of Sandspit mangrove mat area (M) and Fringe without mat area

(WM) during the climatic pre-monsoon, monsoon and post-monsoon seasons.

0

20

40

60

80

Sal

init

y

(‰)

Soil M Soil WM Water

0

10

20

30

Pre-Monsoon Mnosoon Post-Monsoon

Tem

per

atu

re º

C

Seasons

Air Soil M Water Soil WM

0.0

3.0

6.0

9.0

pH

Water Soil M Soil WM

74

(A)

(B)

Figure 9. Average values (±S.E.) of soil and water (A) dissolved oxygen of waterand (B)

bulk density of soil recorded at the study sites of Sandspit mangrove mat area (M) and

Fringe without mat area (WM) during the climatic pre-monsoon, monsoon and post-

monsoon seasons.

0.0

0.4

0.8

1.2

1.6

Dis

solv

ed O

xygen

(m

g/L

) M WM

0.0

0.5

1.0

1.5

Pre-Monsoon Monsoon Post-Monsoon

Bu

lk D

ensi

ty (

g/c

m3

)

Seasons

75

3.4.2. Channel water characteristics:

Sandspit mangrove area holds many marine water channels. The presently studied sites like

others were flooded daily by tides. The forest is occupied 100% by Avicennia marina trees.

The means of total nutrients released into the water column and uptake by sediment is

illustrated (Table XII). The water channel salinity levels remained high (up to 42PSU) in

pre-monsoon and were lower during rest of the seasons (Fig.8b). Water salinity was highly

positively significant with total TN%, DO, C/N and negatively significant with (bulk

density) B.D., NO2-, NO3-. We observed some variations in dissolved oxygen levels; the M

site contained more DO as compared to WM site (Fig.9a). The DO levels were high during

monsoon and low in other seasons because rainfall and river runoff were also attributed to

affect the rate of dissolved oxygen (Saravanakumar, Sesh, Thivakaran and Rajkumar, 2008).

DO was significantly positively correlated with TC%, Chl a, NH4+, Chl a/b, B.D. and

negatively correlated with PO43-. Values for water pH were low during monsoon may be due

to influx of freshwater, and carbon dioxide removal via photosynthesis (Fig.8a). There was a

positive correlation between NO2-, NO3- and negative correlation between soil pH, water

salinity, C/N and Chl a/b respectively. Highest water temperature was recorded during

monsoon season (28ºC) (Fig. 8c). We observed a significant positive correlation (+) between

temperature and DO, water pH, NO2-, NO3- and negative correlation with water salinity and

C: N. Factors influencing above mentioned parameters include rate of transpiration,

evaporation, rainfall, tidal cycle and waste water runoff (Table XIV).

76

The nutrients present in the mangrove water channel are responsible for metabolic growth

and sustenance of primary producers and decomposers. N and P are also essential for growth

of mangrove trees (Lovelock, Feller, McKee and Thompson, 2005). We observed that

concentrations of nutrients were influenced by seasons and physico-chemical parameters.

Overall there was more nutrient exchange in M area as compared to WM area. During the

pre -monsoon season, increased levels of ammonia were exchanged. In monsoon season

increased levels of nitrate and ammonia (release) and phosphate (uptake) were recorded.

Finally, in post-monsoon season high levels of phosphate (release) and ammonium (uptake)

were observed. (Table XII). Maximum average PO43- concentrations were found to be (up

take) -3.58(± 10.81) and (release) 15.85(± 10.05) mol.m-2.day-1 which was positively

correlated with TN%, TC%, moisture, soil salinity, nitrite, nitrate and negatively correlated

with Chl a: b. The increased concentrations of Nitrate (uptake -9.2(± 38.12), release 12.41(±

17.45) mol.m-2day-1) and nitrite (uptake -6.88(± 2.51) release 2.63(± 1.17) mol.m-2.day-1)

were relatively low as compared to ammonium. No strong correlation was found between

nitrite and other factors except for Chl b and LOI% (+ correlation). There was a significant

positive correlation between nitrate and DO, TN%, soil salinity, Chl a and a strong negative

correlation with C/N. The highest rates of NH4+ (uptake) -17.48(± 15.46) and (release)

13.04 (± 25.44) mol.m-2.day-1 that showed a significant positive correlation with TN%,

TC%, NO2-, NO3-, Chl a: b, C%, water pH, soil salinity, moisture content and a negative

correlation with PO43- respectively (Table XIV). In both studied sites M and WM, the nitrite

concentrations were lowest as compared to other observed nutrients. NH4+ and PO43- levels

were found to be the highest during all seasons.

77

Phosphate is not a rate-limiting factor in our study area. Earlier studies suggested that

increased phosphate at moderate salinity levels increases primary productivity of wetland

areas (Cardona and Botero, 1998). We can corroborate this information. The reason for high

concentrations of PO43- in mangrove channel water may be due to P content transported in

dissolved state to mangrove area from seawater input via tidal current in to creek area (Chen

and Twilley, 1999a). Other factors include mixing of sediment into water column due to

turbulence (Chandran and Ramamoorthy, 1984), Increased P loads from anthropogenic

sources which contains phosphate-based domestic and industrial waste and poor

management of discharged water quality which may increase the influence of P distribution

in mangrove habitat (Chen and Twilley, 1999a).

Table XII. Nutrient exchange rates of water samples, means (±S.D.), collected in microbial

mat and without mat area.

(Where, –values: uptake rate, +values: release rate, M: bell jar over microbial mat covered soil, WM: bell jar

over fringe area, without microbial mat, NO2- nitrite ion, NO3

- nitrate ion, NH4+ ammonium ion, PO4

3-

phosphate ion.)

M (mol.m-2.day-1) WM (mol.m-2.day-1)

Seasons NO2- NO3

- NH4+ PO4

3- NO2- NO3

- NH4+ PO4

3-

Pre-monsoon 6.88

(2.51)

9.20

(38.13)

(25.44)

3.58

(10.81)

1.41

(2.62)

4.50

(5.17) 10.96

(128.26)

7.63

(6.47)

Monsoon 1.02

(1.46)

11.77

(10.89)

11.37

(61.97)

2.85

(18.01)

1.79

(2.22)

3.38

(17.01)

6.68

(69.09)

1.75

(15.18)

Post- monsoon 3.05

(12.14)

(17.45)

17.48

(15.46)

15.85

(10.06)

2.63

(1.17)

.00

(3.01)

10.13

(12.68)

14.97

(9.79)

78

Nitrification process imputes to high ammonium rates (Allen, Dalal, Rennenberg and

Schmidt, 2011) and it could also be an indication of increased decomposition and

mineralization rates. Decreased nitrate rates may mean denitrification is efficient. Nitrate in

seawater could reduce to NH4+ via soil water interphase in mangrove area (Buresh and

Patrick, 1981). These types of systems where mangrove area is compromised by unregulated

deposition of wastewater, the associated bacteria were likely to fix nitrogen at low rate

(Mann and Steinke, 1989), which may result in increased levels of ammonia.

Ammonification rates may be independent of nitrogen concentration in mangrove area

(Chen and Twilley, 1999b) as we found no strong correlation between TC%, TN% and C:

N, there lies a complex relation between quality of sediment substrate with mineralization

rates of nitrogen and phosphate (Chen and Twilley, 1999b). Bacteria also efficiently convert

nitrogenous organic compounds into ammonium ions (Rivera-Monroy, Twilley, Boustany,

Day, Vera-Herrera and Ramirez, 1995) and nitrate reduction to ammonium may also

conserve nitrogen (Tiedje, 1988) in mangrove ecosystem, which may lead to increased N

content through all seasons. Ammonification, nitrification, denitrification and decomposition

of detrital matter by bacteria also influence the nitrate and nitrite rates (Rajasegar, Peramal

and Santhanam, 2005). Other variables that increase the rates of nitrogen content in

mangrove ecosystems may also include the presence of cyanobacterial mats present on

forest floor (Toledo, Bashan and Soeldner, 1995), freshwater input (Morell and Corredor,

1993) and nutrient input due to tidal cycle, (Boto, 1979). Lastly, anthropogenic activities

resulting in high nitrogen and phosphorous concentrations may lead to increased rates of

microbial respiration and nitrogen transformation (Chen, Tam and Ye, 2012). The Physico-

chemical parameters were similar to other southeast Asian Gulf of Kach mangrove study

79

conducted by Saravanakumar, Sesh, Thivakaran and Rajkumar, (2008) and earlier studies of

Sandspit area conducted by Farooqui, (2012) and Shafique, (2004). The nutrient values were

comparable with Indonesian Citanduy mangrove study conducted by Moll, (2011).

3.4.3. PCA and Cluster analysis:

The PCA was applied to minimize the complexity of variables data. It showed how sediment

relates to 20 different variables during seasons. The PCA ordination of sediment reveal

positive aggregation of conditions 1, 2, 5, 6 9,10 and negative group of conditions

3,4,7,8,11,12, on PC1 axis. On PC2 axis positive cluster of conditions 1,2, 5, 6, 7, 8 and

negative aggregation of conditions 3,4,9,10, 11,12 were recorded (Fig. 10). PC1 axis was

accounted for 44% of the variance and was strongly related to soil salinity (-0.65), LOI

(0.38), WHC (0.26), Moisture content (0.40) and ammonia (0.34). The second significant

axis PC2 was accounted for 32% of variance and was mainly related to soil temperature

(0.24), soil salinity (0.49), ammonia (0.65) and phosphate (-0.43) respectively (Table XIII).

These are considered to be integral factors related to mangrove sediment associated

microbes (Gonzalez-Acosta, Bashan, Hernandez, Ascencio and De la Cruz, 2006). A score

plot of these two soil and nutrient parameters illustrates the strong relationship between soil

site and presence or absence of microbial mat (Fig. 10).

80

Figure 10. Two dimensional PCA ordination of Sandspit mangrove channel waters

variables (dissolved oxygen, air temperature, water temperature, water pH, water salinity,

nitrite, nitrate, ammonia, phosphate) and sediment characters (total nitrogen, total carbon,

soil temperature, soil pH, soil salinity, soil bulk density, loss of ignition, water holding

capacity, moisture, chlorophyll a, chlorophyll b) in twelve different conditions (1)Pre-

Monsoon M top, 2)Pre-Monsoon M bottom, 3)Pre-Monsoon WM top, 4)Pre-Monsoon WM

bottom, 5)Monsoon M top, 6)Monsoon M bottom, 7)Monsoon WM top, 8)Monsoon WM

bottom, 9)Post-Monsoon M top, 10)Post-Monsoon M bottom, 11)Post-Monsoon WM top,

12)Post-Monsoon WM bottom) at two sites mat area (M) and without mat fringe area (WM)

located in Sandspit mangrove. (top= 0-5 cm sediment, bottom= 5-10 cm sediment). Ihe

Component 1 strongly separate the R vs NR distinction whereas the Component 2 displays

the seasonal differences. The vertical distinction between tops and bottoms of the mat are

clearly increased by the presence of the mat. Red= Pre-monsoon season, Green= Monsoon

season, Blue= Post-monsoon seasons.

81

Table XIII. PCA results showing the first three components for twenty physico-chemical

sediment and nutrient variables in twelve conditions at Sandspit mangrove.

[Where, (TN) total nitrogen, (TC) total carbon, (DO) dissolved oxygen, (AIR ºC) air temperature, (SOIL ºC)

soil temperature, (WATER ºC) water temperature, (Soil PSU) soil salinity, (B.D.) soil bulk density, (Water

PSU) water salinity, (LOI) organic matter via loss of ignition, (WHC) water holding capacity, (Chl a,b)

chlorophyll a,b. (NO2-) nitrite, (NO3-) nitrate, (NH4+) ammonia, and (PO43-) phosphate. The twelve different

conditions were as follows, (1)Pre-Monsoon M top, 2)Pre-Monsoon M bottom, 3)Pre-Monsoon WM top,

4)Pre-Monsoon WM bottom, 5)Monsoon M top, 6)Monsoon M bottom, 7)Monsoon WM top, 8)Monsoon WM

bottom, 9)Post-Monsoon M top, 10)Post-Monsoon M bottom, 11)Post-Monsoon WM top, 12)Post-Monsoon

WM bottom) at two sites mat area (M) and without mat area (WM) (top,0-5 cm and bottom,5-10 cm sediment

section)].

Variables PC1 PC2 PC3

TN (%) 0.01 -0.01 -0.03

TC (%) 0.00 0.00 0.01

DO (mg/L) 0.01 0.01 -0.01

Air (ºC) 0.04 0.21 0.18

Soil (ºC) 0.03 0.24 0.32

Water (ºC) 0.02 0.18 0.29

Soil pH -0.01 -0.01 -0.01

Water pH 0.00 0.00 0.01

Soil (PSU) -0.65 0.49 0.26

Water (PSU) -0.01 -0.09 -0.13

B.D (g/cm-3) 0.00 0.01 0.00

LOI (%) 0.38 0.03 0.26

WHC (%) 0.26 0.04 0.08

Moisture (%) 0.40 -0.07 0.25

Chl a (g.g-1) 0.01 0.01 -0.01

C hl b (g.g-1) 0.00 -0.01 0.01

NO2- (mol.m-2.h-1) -0.11 0.09 0.18

NO3- (mol.m-2.h-1) 0.15 -0.03 0.62

NH4+ (mol.m-2.h-1) 0.34 0.65 -0.31

PO43- (mol.m-2.h-1) -0.23 -0.43 0.23

Eigenvalue 339.643 244.852 157.003

% variance 44.277 31.92 20.467

82

Figure 11. Dendrogram (Cluster analysis) of physical and chemical variables of channel

water and sediments (dissolved oxygen, air temperature, water temperature, water pH, water

salinity, nitrite, nitrate, ammonia, phosphate, total nitrogen, total carbon, soil temperature,

soil pH, soil salinity, soil bulk density, loss of ignition, water holding capacity, moisture,

chlorophyll a, chlorophyll b) under different seasonal conditions up to 10 cm depth (1)Pre-

Monsoon M top, 2)Pre-Monsoon M bottom, 3)Pre-Monsoon WM top, 4)Pre-Monsoon WM

bottom, 5)Monsoon M top, 6)Monsoon M bottom, 7)Monsoon WM top, 8)Monsoon WM

bottom, 9)Post-Monsoon M top, 10)Post-Monsoon M bottom, 11)Post-Monsoon WM top,

12)Post-Monsoon WM bottom) were observed at two sites mat area (M) and without mat

area (WM), (top 0-5 cm, bottom 5-10 cm soil sections). Red bracket, M= Microbial mat

covered and Blue bracket, WM= without mat covered observations.

83

The seasons were not easily discerned. The separate clusters were formed on the basis of M

and WM types. These sites were influenced by a combination of soil variables considered in

this study. As such on PC1, WM soils of pre monsoon (conditions 3,4) monsoon (7,8) and

post monsoon (11,12) were clustered closely and M soil of pre monsoon (1,2) monsoon (5,6)

and post monsoon (9,10) is expected to have a combined cluster. There was an exception of

WM (conditions 7, 8) and M (9,10) on PC2 which were clustered with opposite soil types

inferring some similarity in monsoon WM and post monsoon M soil condition. Ranking the

variables by cluster analysis showed seasonal data was divided into three groups (Fig. 11)

based on soil type. The sediments can be clearly differentiated in to M and WM, this

distribution showed that there are no drastic changes within M and WM sediments (up to 10

cm depth) with respect to seasons except for post monsoon M soil (conditions 9,10) that

formed a separate cluster. One-way ANOVA analysis revealed that the cluster results were

significantly different (p<0.05). These clusters appear to be based on sediment salinity, net

moisture, N and P content at each sediment site, though other variables may also play a role

in the cluster formation. The PCA and cluster analysis provides a qualitative analysis

suggesting that the mat plays an integral role in maintaining the complex nature of

associated soil through all seasons and is an important part of mangrove vegetation. There

must be other discriminating variables affecting these sites which were not revealed by our

current physico-chemical measurements of two sediment types.

84

Tab

le X

IV.

Pea

rso

n C

orr

elat

ion

s b

etw

een s

oil

pro

per

ties

(0

-10

cm

dep

th)

and M

ang

rov

e ch

ann

el w

ater

s pro

per

ties

for

the

stu

die

d

site

s in

Sand

spit

, K

arach

i.

[Wh

ere,

p-v

alue<

0.0

5,

row

s an

d c

olu

mns

abb

revi

atio

ns

are

as f

oll

ow

s, (

TN

) t

ota

l n

itro

gen

%,

(TC

) to

tal

carb

on %

, (D

O)

dis

solv

ed o

xygen

mg/l

, (A

.T.)

air

tem

per

atu

re º

C,

(S.T

.) s

oil

tem

per

ature

ºC

, (W

.T.)

wat

er t

em

per

atu

re º

C,

(S.S

.) s

oil

sal

init

y P

SU

, (B

.D.)

so

il b

ulk

den

sity

g/c

m3,

(W.S

.) w

ater

sali

nit

y P

SU

,

(LO

I) o

rgan

ic m

atte

r via

lo

ss o

f ig

nit

ion

%,

(WH

C)

wat

er h

old

ing c

apaci

ty %

, (M

.) M

ois

ture

co

nte

nt

%,

(Ch

l a,

b)

chlo

rop

hyll

a,b

. (N

O2- )

-2.h

-1,

(NO

3-

-2.h

-1,

(NH

4+

-2.h

-1,

(PO

43

--2

.h-1

, (C

/N)

carb

on

-nit

rogen

ra

tio,

and (C

hl

a/b)

chlo

rophyll

a,

b

rati

o.L

ow

sig

nif

ican

ce,

*, S

ign

ific

ant

**

, H

igh

sig

nif

ican

ce

**

*].

85

3.4.4. Environmental health and Recreational value:

The researched site is quite compromised and is not suitable for recreational activities and

commercial fishing due to contamination by wastewater which is detrimental to mangrove

(Wong, Tam and Lan, 1997), other immediate threats to the Sandspit mangrove ecosystem

includes reclamation of land for building projects, development of cottage and heavy

industries, desolation of habitat, overgrazing and seawater intrusion (Damhoureyeh and

Ghalib, 2014). Effective remedial strategies are required to minimize current adverse

conditions. Present study will initiate further assessment of significant coastal eco systems

associated with Pakistan’s coastal belt. There is further need of an elaborate temporal scale

study to analyze the intricacies of sediment associated microbial processes in the habitat and

their long term impact on the productivity of the mangrove ecosystem. There is also a need

to assess the long term changes to soil sediment which could benefit in future restoration of

Sandspit and other related ecosystems.

86

CHAPTER 4

SEASONAL VARIATIONS IN POTENTIAL

NITRIFICATION RATES IN MANGROVE SEDIMENT

AT SANDSPIT BACKWATERS, KARACHI,

PAKISTAN

(Manuscript accepted for Publication)

87

SEASONAL VARIATIONS IN POTENTIAL NITRIFICATION

RATES IN MANGROVE SEDIMENT AT SANDSPIT

BACKWATERS, KARACHI, PAKISTAN

4.1. Abstract:

Sandspit coastal area is located between Hawksbay and Manora channel, south of Karachi.

The area opposite to sandy beach is covered by mangrove forest of Sandspit backwaters.

The potential nitrification rates in sediment from rhizosphere and non-rhizosphere at

Sandspit backwater mangrove forest was examined using sodium chlorate inhibition

method. Samples collected during pre-monsoon (Jan), monsoon (late June) and post-

monsoon (Nov) seasons were analyzed using two different concentration of inhibitor. The

higher inhibitor concentration (30mM) was found to be more effective than lower (15mM)

concentration used. The potential nitrification rates were slightly higher during monsoon as

compared to other seasons. The potential nitrification values ranged from 0.06 (post-

monsoon) to 1.20 g NO2- Ng w-1h-1 (monsoon). The potential nitrification rates had

significant correlation with the incubation time (p<0.005, n=3). The nitrifiers in mangrove

sediments appear to tolerate a range of physical and chemical variations, such as,

temperature (17-28 ºC), pH (6.8-8.9), Salinity (36-42) and DO (3.7-6.5 mg/L) and maintain

steady potential nitrification rates, as observed by present experiment in two sediments types

during all seasons.

88

4.2. Introduction:

Mangrove belt of Sandspit are highly productive (Siddiqui, Farooq, Shafique and Farooqi,

2008; Faroouqi, Shafique, Khan, Ali, Iqbal and Siddiqui, 2012; Shafique, Siddiqui, Aziz,

Burhan, Mansoor and Nafisa, 2013) which are located in the harbor areas of Karachi that

stretches from Hawksbay to Mannora channel. It is an estuarine area with a tidal range of -

0.4 up to 3.2m. This area is an integral part of the fan shaped Indus delta and consist of

monospecific Avicenna marina which provides food, fodder, medicine and coastal

protection to nearby local community area. Sediments are transported via Indus river to

estuarine parts which consequently develops and sustains this region (Saifullah, 1997;

Siddiqui, Farooq, Shafique and Farooqi, 2008). The primary productivity of mangrove area

is relatively high as compared to other coastal systems due to the presence of a unique

ecosystem having microbial community that efficiently transforms and provides essential

nutrient supplies including various forms of nitrogen (Kristensen, Jensen, Banta, Hansen and

King, 1998; Tam, Wong, Wong and Wong, 2009). Nitrification process involves the

microbial oxidation of ammonia to nitrite and then to nitrate (Alongi, Boto and Robertson,

1993). Soil Nitrification is a vital biogeochemical process as the microbes belonging to the

family Nitrobacteraceae are responsible for recycling of nitrogen. Nitrogen is considered to

be the rate limiting factor in ecosystems (Rabalais, 2002; Elser, Bracken, Cleland, Gruner,

Harpole, Hillebrand, Ngai, Seabloom, Shurin and Smith, 2007). The oxidized nitrogen is

used as a source of energy for growth. This process is under the influence of various

environmental parameters such as temperature salinity and pH (Olsson and Falkengren-

Grerup, 2000; Isnansetyo, Thien, Seguchi, Koriyama and Koga, 2011). The nitrite which is

89

produced during nitrification is required for nitrogen leaching in soil and directly involved in

the production of gaseous nitrogen greenhouse compounds and removal of N from soil (Von

Cleemput and Samater, 1995; Yan, Wang, Mao, Ma, Li, Ouyang, Guo and Cao, 2015). A

recent study conducted in Germany revealed that nitrite acts as the direct precursor of nitric

oxide (NO) formation under both anaerobic and aerobic state respectively (Russow, Stange

and Neue, 2009). In Southeast Asia and China, it was observed that the potential nitrification

rates in mangrove area were influenced by salinity (Miranda, Balachandran, Ramesh and

Wafar, 2008), organic carbon (Krishnan and Bharathi, 2009), soil moisture content and

nutrients (Singh and Kashyap, 2007) and tidal cycle (Hou, Liu, Xu, Ou, Yu, Cheng, Lin and

Yang, 2007). In Pakistan, the significance of potential nitrification process has been

examined mostly on agricultural soils (Amin and Flower, 2004; Gill, Abid and Azam, 2006;

Ahmedani, Yasmin, Arain, Shah, Abro and Nahyoon, 2007; Ali, Iqbal, Tahir and Mahmood,

2008; Ali, Kanwal, Iqbal, Yaqub, Khan and Mahmood, 2012) but there is no study related to

mangrove areas.

The objective was to observe the seasonal effect on the rate of potential nitrification (PN) of

two sediment types, mangrove (Rhizoidal area, R) and fringe area (non-rhizoidal, NR) soils

by using the sediment slurry method of Belser and Mays, (1980). The sodium chlorate was

used as a nitrite oxidation inhibitor. It enabled us to measure NO2-N production in samples.

The samples after treatment were finally analyzed spectrophotometrically. The results were

to be graphically interpreted and statistically computed using Box plot method and Pearson

correlation method (p<0.005, N=3).

90

4.3. Material and Methods:

4.3.1. Sampling:

Sampling was conducted from study site (Fig. 2b and pg. 31) during late November 2014 till

late June 2015. Sediment samples rhizoidal (R, region having pneumatophores and covered

by benthic microbial mat) and non-rhizoidal (NR, region without pneumatophore and not

covered by benthic microbial mat) regions were collected during pre-monsoon (January),

monsoon (June) and post -monsoon (November) seasons respectively. The samples in

triplicate were cored with 50.8 mm diameter sterile plastic corers wrapped in aluminum foil

and immediately kept under crushed ice in an icebox and transported to laboratory. The

potential nitrification rate was determined by modified method of Belser and Mays, (1980)

(Kristensen, Jensen, Banta, Hansen, Holmer and King, 1998; Hoffmann, Schloter and

Wilke, 2007).

4.3.2. Lab and Statistical Analysis:

All samples were examined in triplicate. Briefly, each of the core samples were divided into

3 cm interval top (T), middle (M) and bottom (B) sediment sections. 3g of sediment slurry

was made in 15ml of phosphate buffer pH 7.5. Triplicate sets were amended with substrate

of ammonium sulphate 1mM (Merk). Because chlorate acts as an inhibitor of nitrification

process (Belser and Mays, 1980) therefore, samples were tested against two different

concentrations of sodium chlorate 15mM and 30Mm (BDH Chemicals) respectively, the

control set consists of flasks with no treatment of chlorate. All flasks were sealed with

stopper and incubated at room temperature on shaker at 150 rpm for 6h. Supernatant of

slurry samples were pipetted out after 2 hrs regular intervals over the incubation period and

91

filtered through 0.45 m (25 mm diameter, Whatman) and centrifuged at 3000 rpm for 5

min. The samples were then immediately frozen until further analysis. Finally, slurry

samples for N determination were analyzed spectrophotometrically by method of Strickland

and Parsons, (1972). The potential nitrification levels were observed by standard curve of

nitrite with time and concentrations during different seasons were observed. Field

parameters such as, temperature of air, water and sediment were recorded using standard

mercury thermometer. Field parameters such as temperature, salinity, pH and dissolved

oxygen were also observed (for details see page 29). The statistical analyses such as Pearson

correlation, box plots, graphs and tables were computed using the software Microsoft Excel

package, 2013 and Minitab Version, 17.1.0.

4.4. Results and Discussions:

4.4.1. Physicochemical and Potential Nitrification rates:

Sandspit Mangrove soils are made up of different combination of clay, sand and silt. The

rhizoidal (R) area is that part of the forest floor where topsoil is covered by thick microbial

mat and pneumatophores protrude out from the ground. That area is always moist, muddy

and often water logged. In contrast, the non- rhizoidal (NR) soil which is present on the

outskirts of mangrove vegetation having no microbial mat or pneumatophores, is relatively

less moist and comparatively loose with visibly low clay and high sand content. The

potential nitrification rates along with physico-chemical parameters were observed for these

two types of soil for all seasons (Fig. 12 a, b). Maximum figures recorded were temperature

28 ºC (monsoon), salinity 42 (pre-monsoon), DO 6.5 mg/L (monsoon) and pH 8.9 (post-

monsoon) respectively.

92

Figure 12. Seasonal observations of field parameters of study site (A) showing temperature

and salinity, (B) showing pH and dissolved oxygen, R= rhizoidal area, NR= non-rhizoidal

area. (N=3, ±S.D. error bars)

0

5

10

15

20

25

30

35

40

45

50

0

5

10

15

20

25

30

35

Pre-Monsoon Monsoon Post Monsoon

Salin

ity‰

Tem

per

ature

ºC

Air (ºC) Water (ºC) Soil (ºC) Salinity ‰(A)

0

1

2

3

4

5

6

7

0

1

2

3

4

5

6

7

8

9

10

Pre-Monsoon Monsoon Post Monsoon

DO

mg

/L

pH

pH water pH Soil R pH Soil NR DO mg/L (B)

93

It was observed that overall, the potential nitrification (PN) rates in the top layer (T) of both

sediments (R 0.43, NR 0.38g NO2- Ng w-1h-1) samples were relatively more as compared to

the middle(M) (R 0.27, NR 0.27 g NO2- Ng w-1h-1) and bottom(B) (R 0.30, NR 0.25 g

NO2- Ng w-1h-1) sections. The rhizoidal (R) samples have higher potential nitrification rates

as compared to non-rhizoidal (NR) soil samples. During 6h incubation maximum PN rates

of R soil sections were found to be 1.20(top, 0-3cm), 0.50(mid, 3-6cm), 0.60(bottom, 6-9

cm) g NO2- Ng w-1h-1. And, the highest rates of NR soil sections were 0.60(top, 0-3cm),

0.50(mid, 3-6 cm) and 0.50(bottom, 6-9cm) g NO2- Ng w-1h-1 respectively (Fig. 13)

We observed more fluctuations in PN values of Rhizoidal T section as compared to rest of

the sections. Similarly, the NR T section has more activity as compared to NR M and NR B

sections. The nitrite accumulation vs incubation period showed significant correlation.

Different concentrations of sodium chlorate (15mM and 30mM) at equal time interval were

also examined. It was found that the inhibition of NO2-N was affected more by 30mM than

15mM concentration. There was a significant correlation between dissolved oxygen and

temperature. The pH of water and soil were found to be highly significant (Table XV).

94

Figure 13. Box plot showing the difference in terms of Potential Nitrification activity (PN)

activity between Rhizoidal (R) and Non-Rhizoidal (NR) sediments. The top 0-3cm (RT,

NRT) mid 3-6cm (RM, NRM) and bottom 6-9cm (RB, NRB) sections during 0-6h

incubation time interval and 0,15,30mM concentration of Sodium Chlorate in Monsoon,

Pre-Monsoon and Post-monsoon seasons (N=3).

1 .2

1 .0

0.8

0.6

0.4

0.2

0.0

NR

M

1 .2

1 .0

0.8

0.6

0.4

0.2

0.0

RT

seasons

conc.

time

pre monsoonpost monsoonmonsoon

301 50301 50301 50

642064206420642064206420642064206420

1 .2

1 .0

0.8

0.6

0.4

0.2

0.0

NR

B

1 .2

1 .0

0.8

0.6

0.4

0.2

0.0

NR

T

1 .2

1 .0

0.8

0.6

0.4

0.2

0.0

RM

seasons

conc.

time

pre monsoonpost monsoonmonsoon

301 50301 50301 50

642064206420642064206420642064206420

1 .2

1 .0

0.8

0.6

0.4

0.2

0.0

RB

95

Tab

le X

V.

Pea

rso

n c

orr

elat

ion c

oef

fici

ent

mat

rix s

ho

win

g r

elat

ion

ship

bet

wee

n t

op

mid

bott

om

Rhiz

oid

al a

nd N

on

-Rhiz

oid

al s

ecti

on

s w

ith t

ime,

ch

lora

te c

on

centr

atio

ns

an

d p

hy

sico

chem

ical

par

amet

ers.

*=

Sig

nif

ican

t at

p<

0.0

05

, R

hiz

oid

al t

op

(R

T)

mid

(R

M)

bo

tto

m (

RB

), N

on

-Rh

izo

idal

top

(N

RT

), m

id (

NR

M),

bott

om

(NR

B),

Tim

e (h

), C

hlo

rate

Co

nce

ntr

atio

n (

mM

), *

sign

ific

ant]

.

96

Seasons significantly affected the potential nitrification rates. During monsoon season the

values varied between 1.20 g NO2- Ng w-1h-1 (RT,15 mM, 6h) to 0.08 g NO2

- Ng w-1h-1

(RB, 30mM, 2h). The rates decreased during pre- monsoon season 0.89 g NO2- Ng w-1h-1

(RT, 15 mM, 6h) to 0.17g NO2- Ng w-1h-1 (NRB, 15 mM, 6h) and were lowest during post

monsoon season 0.58 g NO2- Ng w-1h-1 (NRT, 30mM, 6h) to 0.06 g NO2

- Ng w-1h-1

(RM,15 mM, 2h) respectively.

4.4.2. State of Potential Nitrification at Sandspit Mangrove:

For the first time in Pakistan the potential nitrification PN rates of mangrove backwater area

were recorded. It was observed that the rates were higher in mangrove sediment (which was

covered with microbial mat) as compared to the fringed area (devoid of microbial mat). Our

results were in agreement with earlier study conducted by Luo, Qiu, Wei, Du, Zhao and

Yan, (2014) that also reported higher nitrification rates in mangrove areas in China as

compared to mud flats. Nitrification is a 2-step process in which nitrite is an intermediate

product and due to its fast reaction rate sodium chlorate NaClO3 was used as a specific

nitrite oxidation inhibitor. This type of inhibitor is useful in understanding the process of

nitrification and its associated bacteria as it permits the accumulation of nitrite by inhibiting

the oxidation. The rate of inhibition is proportional to the concentration of nitrite (Belser and

Mays, 1980). By using PN method we indirectly observed the nitrifying bacteria population

(Hansen, Henriksen and Blackburn, 1981; Schmidt and Belser, 1982). The increased rate of

reaction in RT section indicates high rate of bacterial population (Abbasi, Shah and Adams,

97

2001). Certain environmental factors were involved in the regulation of nitrification process

such organic matter, dissolved oxygen, temperature, salinity, pH (Isnansetyo, Thien,

Seguchi, Koriyama and Koga, 2011).

We found PN rates to be fairly constant throughout all seasons indicating that the nitrifying

bacteria involved in these processes are hardy and tolerant to variety of extreme physical

and chemical factors. The salinity tends to fluctuate during seasons due to waste water

runoff, rainfall input and evaporation rates. Current studys physicochemical observations

concur with the study of Miranda, Balachandran, Ramesh and Wafar, (2008) conducted in

Kochi backwaters. The soil pH values were usually above 8.5 suggesting that alkaline

conditions favors nitrification process which was found in earlier studies (Brierley and

wood, 2001; Isnansetyo, Thien, Seguchi, Koriyama and Koga, 2011). The nitrification

process manifested in sediments of up to 6-9cm throughout all seasons which proved that

the nitrifiers were present at such depth. The PN rates do not decrease with the passage of

incubation time at chlorate concentration 15 mM but at 30 mM the rates gradually started to

deplete. The inhibitor started to take visible effect after 5th hour of incubation. The PN rate is

increased in R soil because the Sandspit mangrove area have muddy soil and high clay

content (Farooqui, 2012) and clay due to its small size and potential to exchange cations

results in the ability to exhort a positive effect on microbial processes associated with soil

and water (Macura and Stotzky, 1980; Hoffmann, Schloter and Wilke, 2007). NR sediment

have relatively low water potential which can somewhat limit the bacterial movement (Berg

and Rosswall, 1987) result in less NP values. The amount of substrate which is flowing

continuously and may be changing slowly with seasons can also be the factor in decrease in

98

rates through pre-monsoon, increase in monsoon and then decrease again post-monsoon.

Another reason for yearlong PN activity is the presence of these bacteria in form of very

loose to tough slime layer creating a restrictive barrier between water stress and air drying.

The formation of micro colonies within soil particles helps nitrifiers survival up to 9 cm

deep in soil (Marshall, 1976; Klemedtsson, Berg, Clarholm, Schnürer and Rosswall, 1987).

We were unable to find a significant relation between nitrification rates and field parameters

but there was a strong correlation amid physicochemical factors such as water-soil pH and

dissolved oxygen-temperature. There was a significant correlation in PN rate and incubation

time. The PN rates of two soil types (R, NR) were also positively correlated with soil

sections (T, M, B) respectively (p<0.005). In future multidisciplinary approach is required to

observe the peak nitrification rates along with study of soil nitrifies in order to comprehend

the role of various physico-chemical aspects and rate limiting factors such as carbon content,

total nitrogen, chlorophyll and nutrient ion content involved so that we may gain better

understanding of nitrification process taking place in our Sandspit backwaters mangrove

forests.

99

PART III

DOMINANT CYANOBACTERIA FORMING GREEN

MICROBIAL MAT AND SCREENING OF

ANTAGONISTIC SUBSTANCES (BACTERIOCINS)

100

CHAPTER 5

SEASONAL ABUNDANCE OF SIX DOMINANT

FILAMENTOUS CYANOBACTERIAL SPECIES IN

MICROBIAL MATS FROM MANGROVE

BACKWATERS, SANDSPIT PAKISTAN

(Manuscript Published)

101

SEASONAL ABUNDANCE OF SIX DOMINANT

FILAMENTOUS CYANOBACTERIAL SPECIES IN

MICROBIAL MATS FROM MANGROVE BACKWATERS,

SANDSPIT PAKISTAN

5.1. Abstract:

Microbial mats in the mangrove forests of Sandspit coastal area, south of Karachi, Pakistan

were studied between Jan 2012-Jan 2014. Six major filamentous cyanobacteria belonging to

three genera Oscillatoria (3), Spirulina (2) and Phormidium (1) were identified in the

backwaters mat samples. One of the cyanobacterium species Spirulina labyrinthiformis is

reported from this site for the first time in Pakistan. The most dominant species was

Oscillatoria brevis (22% abundance), closely followed by Phormidium tenue (21%). These

filamentous forms were present in all seasons and tolerated varying physico-chemical

ranges, such as, temperature (15-28ºC), pH (6.8-7.5), salinity (36-42PSU) and dissolved

oxygen (0.201-0.543ppm). Chlorophyll a levels in mat area sediments were ranged between

0.039 up to 5.050 mg/g. The minimum and maximum biovolume was 0.174 and 1.649mm3/l

respectively. We observed a strong positive correlation (p<0.05) between observed

filamentous form of cyanobacteria and field parameters such as water-soil-air temperatures,

pH and dissolved oxygen. The outcome suggests a potential for detailed molecular study on

microbial mat. Further studies are required to understand the interactions of microbial mat

with soil and water components.

102

5.2. Introduction:

Pakistan has a coastline of 1050 km in the Arabian Sea (Amjad and Kamaruzaman, 2007;

Siddiqui, Farooq, Shafique and Farooqi, 2008). The mangrove population in Pakistan thrives

in the Indus delta. This fan shaped delta affects the coast of the Sindh and Baluchistan

provinces where mangrove forests are present at Sandspit, Korangi, Keti Bundar, Miani,

Kalmathor Jiwani and Gawadar bay respectively. Mangrove swamps are considered

significant in terms of coastline protection; they provide economic and cultural support

through food, fodder and fuel wood for local populations. Mangroves are also ecologically

significant, as they serve as breeding grounds and sustain various species of flora and fauna.

This habitat is influenced by tidal height and variations in temperature, salinity, pH, oxygen

content, organic and inorganic nutrients and humidity, among others. The forest floor is

covered by conspicuous microbial mats constituted by decomposers and primary producers

including bacteria, cyanobacteria, fungi and protista. Benthic cyanobacteria,

photoautotrophic, gram negative bacteria, (Prescott, 1998; Hoiczyk and Hansel, 2000)

constitute a significant proportion of these microbial communities (Cole, Hutchison,

Renslow, Kim, Chrisler, Engelmann, Dohnalkova, Hu, Metz, Fredrickson and Lindemann,

2014) as free–living, in associative or endo-symbiotic relationships (Puyana, Acosta, Bernal,

Velásquez and Ramos, 2015). In aquatic systems, cyanobacteria and some eukaryotic

microorganisms (e.g. diatoms) can form microbial mats and contribute to the local primary

productivity. Heterocystous and some non-heterocystous cyanobacteria fix nitrogen (Zehr,

Waterbury, Turner, Montoya, Omoregie, Steward, Hansen and Karl, 2001) reducing it to

ammonia that becomes available to other organisms including mangrove plants which then

103

proliferate in otherwise nitrogen-limited conditions. Cyanobacteria have a significant

potential in terms of nutrient recycling (Hegazi, Mostafa and Ahmed, 2010), prevention of

soil erosion (Sugumar, Ramanathan, Rajarathinam, Jeevarathinam, Abirami and

Bhoothapandi, 2011), increased tolerance to extreme variations in temperature and pH

levels, phosphorous and nitrogen storage (Özbay, 2011), and increased oxygen

concentrations (Mandal, Vlek and Mandal, 1999). Cyanobacteria can obtain carbon dioxide

where it is limited, decreased concentration sites, supporting low water retention times in

nitrogen limited sites (Miyachi, Iwasaki and Shiraiwa, 2003; Wu, Zou and Gao, 2008).

Although there has been a significant number of studies on the coastal flora of Pakistan

including macro and micro algae (Shameel and Tanaka, 1992; Siddiqui, Mansoor, Zaib-un-

Nisa, Shafique and Farooq, 2000; Bano and Siddiqui, 2004; Rizvi and Shameel, 2004;

Saifullah and Ahmed, 2007; Siddiqui, Farooqui, Valeem, Rasheed and Shafique, 2009;

Shafique, Siddiqui, Aziz, Burhan, Mansoor and Nafisa, 2013; Faroouqi, Siddiqui and

Rasheed, 2014), benthic filamentous cyanobacteria have not been studied yet in the

country´s mangrove swamps. Only one report describing in detail the systematic

characterization of mangrove associated microalgae, including cyanobacteria, is available

(Zaib-un-Nisa, Mansoor and Siddiqui, 2000). Therefore, the objective of this investigation

was to assess the abundance and seasonal variation of filamentous cyanobacteria growing at

the Sandspit mangrove forest, and identify some of the dominant species.

104

5.3. Material and Methods:

5.3.1. Field Sampling:

Sandspit backwaters are located approximately at 24º 49´ N and 66º 56´ E between Manora

and Hawksbay waters and adjacent to a Navy dockyard (Fig. 2b, site A, for details of site

description see pg. 31). Sampling took place every three months between January 2012 to

January 2014. The collection period was broadly divided into pre-monsoon (winter, NE

monsoon season), monsoon (spring, SW monsoon season) and post monsoon seasons

(autumn). Microbial mats from different forest floor areas were collected in triplicate using

glass slides and transferred into sterile plastic containers. These were marked (culture code,

site, date, and color) and kept in an ice cooler, then transferred to the laboratory for further

analysis.

5.3.2. Physicochemical parameters, Microscopy, Biovolume and Statistical analysis:

Samples (3.0 mm fractions ) were observed in triplicate within 24 hours using artificial

seawater without fixatives and kept at ambient temperature under light source (2000lux)

during analysis. Cells were observed under light microscope (Olympus, Japan) to record

morphological characteristic and measure morphometric features of interest. Despite

molecular taxonomic assessment which have facilitated a more detailed assessment of

cyanobacterial species (Engene, Paul, Byrum, Gerwick, Thor and Ellisman, 2013), classic

taxonomic assessment is still relevant for some preliminary evaluation (Puyana, Acosta,

Bernal, Velásquez and Ramos, 2015). Hence for our observations, cyanobacteria were

105

taxonomically identified following the identification keys of Komarek, (1992), Komárek

and Hauer, (2013), Guiry and Guiry, (2016). Environmental variables were recorded at

every collection. Air, sediment and water temperature (ºC) were measured with a (mercury

thermometer), salinity was measured with a ATAGO 0161633 refractometer (Japan) and pH

was determined with an ELEMETRON CP-401 pH meter., Chlorophyll a (benthic samples

using 30 mm polyethylene corers) and dissolved oxygen (channel water flowing over mat

area, sampled in ambient 80ml bottles) determinations were performed in triplicate

following Strickland and Parsons, (1972). Pearson correlations were calculated to determine

the relationship between field environmental variables and relative abundance of species.

Bio-volume, which is a measure of cyanobacterial biomass, was calculated using the

standard formulae (Hillebrand, Dürselen, Kirschtel, Pollingher and Zohary, 1999; Türkmen

and Kazanci, 2010). To determine the predominate filamentous cyanobacterial species

present in mat samples, the abundance of individual species was calculated by the methods

of Roger, Jimenez and Santiago, (1991) and Laslett, Clark and Jones, (1997). Statistical

analyses were performed using the Microsoft Excel 2013 and Minitab statistical software

Version 17.1.0.

5.4. Results and Discussion:

5.4.1. Physical and Chemical Parameters:

Experimental variables noted showed seasonal fluctuations (Table XVI). Slight differences

in temperature range were noted for air (19-24ºC), water (17-24.5 ºC) and sediments (15-24

ºC). Lower values were obtained during the pre-monsoon (Jan) and higher during the

106

monsoon (Apr, Jul) and post-monsoon (Oct) seasons. Both pH (6.8-7.5) and salinity (36-

42PSU) varied with seasons and lower values were observed during the monsoon season.

The dissolved oxygen concentration in water samples ranged from 3.70 to 7.18 ppm,

showing greater values during the monsoon season. Chlorophyll a (0.038 to 5.05 mg/g) had

greater values during the pre- monsoon and post-monsoon seasons, and lower values were

observed during the monsoon season.

Table XVI. Seasonal variations in physical and chemical parameters of water and sediments

from Sandspit backwaters mangroves (Mean± S.D., N=6).

Seasons Months DO Temperature ºC

pH Sal

PSU

Chl a

mg/g ppm Air Water Soil

Pre -Monsoon JAN 3.85

± 1.74

20

±2.22

17

±3.33

15

±5.50

7.2

±0.33

42

±3.00

1.13

±2.34

Monsoon

APR 6.25

±1.80

24

±2.65

23

±2.29

24

±2.31

7.5

±0.40

36

±3.06

0.24

±2.84

JUL 7.18

±2.46

19

±0.71

20

±3.18

28

±2.83

6.8

±0.50

42

±2.83

0.04

±3.54

Post -Monsoon OCT 3.70

±1.72

20

±2.65

24.5

±3.00

24

±6.66

7.5

±0.35

38

±3.46

5.05

±0.58

DO = Dissolved Oxygen; Chl a = Benthic Chlorophyll a content; Sal PSU = Salinity, JAN= January,

APR=April, JUL=July and OCT=October

107

Table XVII. List of organisms observed in microbial mats during the seasonal study period

of Sandspit mangrove area.

Seasons

Organisms Pre -monsoon Monsoon Post -monsoon

Cyanobacteria

Phormidium tenue ++ ++ ++

Spirulina major + + ++

S. labyrinthiformis + + ++

Oscillatoria brevis ++ ++ ++

O.limosa - ++ ++

O.princeps ++ ++ ++

O. subbrevis + + +

Aphanocapsa sp. + + +

Synechococcus sp. + + +

Diatom

Navicula sp. ++ ++ ++

Nitzschia sp. + + +

Cymbella sp. + + +

Amphora sp. + + +

Cocconeis sp. + + +

Pinnularia sp. + + +

Gyrosigma sp. + + +

Pleurosigma sp. + + +

Hantzschia sp. + + +

Protista

Ciliates - + +

- absent; + not densely present; ++ densely present)

108

5.4.2. Identification of Dominant Filamentous Cyanobacteria:

Six filamentous cyanobacterial species were dominant throughout the sampling periods at

Sandpit backwaters. The characteristics of these cyanobacterial species are outlined as

follows:

1) Phormidium tenue Gomont, 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 91-264, pls 1-7.

(Komárek, 1992; Guiry and Guiry, 2016) General characters: Filamentous; filaments

long, solitary or coiled into clusters and fine mats, arcuated, intensely coiled, isopolar,

thin, fine, 2 m wide, with simple, thin but firm, usually colourless facultative sheaths;

sheaths joined to the trichomes. Trichomes fine, cylindrical, slightly attenuated, with

rounded apical cells, slightly constricted at the cross walls, immotile. Cells longer than

wide, cylindrical, with homogeneous content, without aerotopes, pale blue-green, end

cells without thickened cell walls or calyptras, heterocytes and akinetes are absent (Fig.

14A).

2) Spirulina labyrinthiformis Kützing ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16:

255. (Komárek, 1992; Komárek and Hauer, 2013) General characters: Filamentous;

unbranched, no sheaths, free floating in fine mats, screw- like coiled along the whole

trichome length, screws are very densely tight trichomes; spirals width ratio being 2.

Trichomes isopolar, 2 m wide uniserial, not attenuated towards the ends, intensely

motile (rotation), usually with homogeneous content, olive green end cells widely

109

rounded, without thickened cell walls or calyptras. Heterocytes and akinetes absent (Fig.

14B).

3) Spirulina major Kützing ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 251.

(Komárek, 1992; Komárek and Hauer, 2013) General characters: Filamentous;

unbranched, no sheaths, free floating in fine mats, screw- like coiled along the whole

trichome length, screws are less densely tight trichomes; spirals width ratio being 2- 2.5.

Trichomes isopolar, 2 m wide and 4m distant uniserial, not attenuated towards the

ends, intensely motile (rotation), usually with homogeneous content, dark olive green

end cells widely rounded, without thickened cell walls or calyptras. Heterocytes and

akinetes absent (Fig. 14C).

4) Oscillatoria limosa Agardh ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 210.

(Komárek, 1992; Komárek and Hauer, 2013) General characters: Filamentous; never

branched, usually in fine, smooth, layered (but not leathery) strata (mats), Trichomes

slightly waved, 22 μm wide, uniserial, composed of shortly discoid cells, slightly

constricted at the cross walls, shortly attenuated to the ends, motile (waving, trembling,

oscillation). Cells without aerotopes but with fine granulation (at the cross walls), dark

green and brownish. End cells widely rounded, heterocytes and akinetes absent (Fig.

14D).

5) Oscillatoria brevis Kützing ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 229 =

Phormidium breve (Komárek, 1992; Komárek and Hauer, 2013) General characters:

Filamentous; unbranched, smooth, layered, rarely solitary or in small groups, without

110

sheaths, Trichomes isopolar, straight, 5 μm wide, uniserial, composed of shortly barrel-

like cells (always shorter than wide), unconstricted at the cross walls, shortly attenuated

to the ends, motile (waving, trembling, oscillation). Cells without aerotopes, olive green.

End cells widely rounded, heterocytes and akinetes absent (Fig. 14E).

6) Oscillatoria princeps Vaucher ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 206.

(Komárek, 1992; Komárek and Hauer, 2013) General characters: Filaments simple,

never branched, usually in fine, smooth, layered, rarely solitary or in small groups,

without sheaths, Trichomes straight, 16 μm wide, uniserial, composed of shortly

cylindrical cells (always shorter than wide), unconstricted at the cross walls, shortly

attenuated to the ends, motile (waving, trembling, oscillation). Cells without aerotopes,

greenish brown, end cells widely rounded, heterocytes and akinetes absent (Fig. 14F).

111

Figure 14. Filamentous cyanobacteria most abundant at Sandspit mangrove backwaters

during the study period. (A) Phormidium tenue (B) Spirulina labyrinthiformis (C) Spirulina

major (D) Oscillatoria limosa (E) Oscillaoria brevis and (F) Oscillatoria princeps. All the

pictures except Fig. 14 (D) (200x) were taken at 400x.

112

Figure 15. Biovolume of the six dominant benthic cyanobacteria at Sandspit mangrove

backwaters.

Figure 16. Average proportional distribution of the six most dominant cyanobacterial

species at Sandspit mangrove backwaters for the period 2012-2014. (where, pie section

21%= Phormidium tenue, 9%= Oscillatoria limosa, 16%= Oscillatoria princpes, 22%=

Oscillatoria brevis, 18%= Spirulina major and 14%= Spirulina labyrinthiformis.)

113

Figure 17. Abundance of the dominant cyanobacterial species in pre- monsoon (January),

monsoon (April, July) and post monsoon (October) at Sandspit mangrove area

114

Ta

ble

XV

III.

Pea

rso

n c

orr

elat

ion

s b

etw

een

do

min

ant

fila

men

tou

s cy

anobac

teri

al s

pec

ies

at S

and

spit

man

gro

ve

and

en

vir

on

men

tal

fiel

d p

aram

eter

s.

(p

<0.0

5, *

sign

ific

ant,

**

hig

hly

sig

nif

ican

t, D

O=

Dis

solv

ed o

xyg

en, S

al=

Sal

init

y P

SU

)

115

The distribution and biovolume of the six most dominant cyanobacterial species are shown

in Figures 15 and 16, respectively. Spirulina major, S. labyrinthiformis, Oscillatoria brevis,

O. princeps, O. limosa, and Phormidium tenue were the major constituents of cyanobacterial

mats throughout the year. Among them O. limosa and O.princeps had the greater bio-

volume compared to the other dominant species (Fig. 15). On the other hand, Phormidium

tenue and O. brevis were the most abundant (Fig. 16) among the dominant species.

The dominance of cyanobacterial species in microbial mats at Sandspit mangroves remained

fairly constant throughout the study. Some species varied in their abundance depending on

the season. Spirulina sp. and O. limosa were not observed in the pre monsoon season. By the

end of the post monsoon season, Spirulina labyrinthiformis and, S. major started to decline.

The growth pattern of Spirulina species was low in July (second half of monsoon season)

(Fig. 17). Other microorganisms which were observed frequently along with major

filamentous forms are listed in Table, (XVII).

The mats that were present all over the sediment displayed an array of colors. Although light

intensity is one of the main factors which exhibit these shades but we also observed that

these mat colors were stable under 4ºC temperatures for up to 72 hours in dark. This may be

due to the abundance or scarcity of certain observed diatoms and cyanobacterial species

(Delfano, Wanderley, Silva, Feder and Lopes, 2012; Taj, Aref and Schreiber, 2014). They

had different tones of brown, yellow or green in different intensities, sometimes attaining

very dark shades. Oscillatoria brevis and O. princepes appears to have cal poly (artichoke)

green, O. limosa displayed an olive green color and Phormidium tenue revealed a lighter

116

shade of forest green whereas, both Spirulina labyrinthiformis and S. major exhibited a dark

apple green shade. Often, O. brevis, O. princepes and O. limosa turned into black colonies.

Biofilms of Navicula sp. diatoms were observed during the winter and displayed dark brown

colour. Yellow and light brown mats usually contained more diatoms and less

cyanobacteria. Protista were occasionally found in mixed mats.

The Pearson correlation analyses (Table XVIII) showed a positive relation between major

filamentous cyanobacterial species and physico-chemical parameters. Oscillatoria sp. were

positively correlated with salinity (0.500), chlorophyll a (0.513), soil-water temperatures

(0.999, 1.000) and pH (0.999). Phormidium sp. was positively correlated with soil-water

temperature (0.971, 0.999), pH (0.971) and chlorophyll a concentration (0.558) whereas,

Spirulina spp. were positively correlated with dissolved oxygen (0.993), air-soil temperature

(0.993, 0.596) and pH (0.596) respectively. Field variables such as Dissolved oxygen was

positively correlated with air temperature (0.999), air temperature was correlated with soil

and water temperatures (0.500, 0.500), water temperature was correlated with soil

temperature, pH and chlorophyll a concentration (0.982, 0.982 and 0.513) and finally soil

temperature was positively significant with pH (1.000). We also observed a positive

correlation among major species. The presence of Oscillatoria brevis influenced by other

filamentous forms except O. princepes. O. limosa was positively correlated with

Phormidium tenue (Table XVIII).

117

5.4.3. Significance of Filamentous Cyanobacteria in microbial mat:

Sandspit backwater mangrove forests consist exclusively of stands of Avicennia marina. The

forest sediments are covered with dense microbial mats. Different microbial communities

are involved in these mats, where cyanobacteria are the dominant group. It was observed in

earlier studies (Seckbach, 2007; Rigonato, Alvarenga, Andreote, Dias, Melo, Kent and

Fiore, 2012; Shafique, Siddiqui, Aziz, Burhan, Mansoor and Nafisa, 2013) that microalgae

(including the genera from our study) associated with mangrove ecosystems enrich the soil

by releasing nutrients, fix carbon and nitrogen, and control soil moisture content thus

playing an integral part in sustaining the primary productivity of related habitats. Under the

same set of environmental conditions, Phormidium tenue and Oscillatoria brevis were the

hardiest of the six dominant cyanobacterial species. They tolerated extreme temperature,

salinity and pH ranges during all the seasons. Phormidium tenue is known to be halotolerant

(Thajuddin and Subramanian, 1992). Oscillatoria and Spirulina species have been known to

thrive in acidic and alkaline soil substrates (Nayak and Parsana, 2003).

There were different physical and chemical variables that correlated with the abundance of

the observed cyanobacterial species. When forming mats, these organisms when have a

greater assimilation efficiency when compared to phytoplankton (Fong and Zedler, 1993).

Cyanobacteria can tolerate a broad range of pH levels and salinity (Bano and Siddiqui,

2004). The pH was lower (6.8) during the monsoon season and greater during the pre

monsoon (7.2) and post monsoon (7.5), probably due to the uptake of carbon dioxide from

photosynthesis processes by cyanobacteria and phytoplankton (Chen and Durbin, 1994). Our

118

site is affected by moderate to high temperatures which are favorable for cyanobacterial

growth (Miyazono, Odate and Maita, 1992). Rainfall is also one of the main features which

brings about various hydrographical changes in the mangrove environment. The monsoon

season with flash flooding started in July and continued until September (approx.137.5 mm,

Pakistan Meteorological Data 2012-2013). The rainfall rate was below average ranges,

resulting in a late cyanobacterial bloom. Our observations (similar to the earlier studies of

Redekar and Wagh, 2000; Vargo, Heil, Ault, Neely, Murasko, Havens, Lester, Dixon,

Merkt, Walsh and Weisberg, 2004) showed that the level of chlorophyll a was high in the

pre monsoon season (1.13 mg/g, ±2.34), low during the monsoon (0.24 mg/g, ±2.84 and

0.04 mg/g, ±3.54) and higher in the post monsoon (5.05mg/g, ±0.58).

Although we found a significant positive correlation (p<0.05) between physical and

chemical parameters and predominate filamentous cyanobacteria, there was no consistent

positive relation between Chlorophyll a and other physical parameters (except for water

temperature) (Odate, Yanada, Castillo and Maita, 1990). Dissolved oxygen values were

greater during the monsoon due to increased biological activity, turbid conditions near the

microbial mat and fresh rainwater input (Satpathy, Mohanty, Sahu, Sarguru, Sarkar and

Natesan, 2011). Oxygen concentrations were low in the remaining seasons. Tidal height,

duration as well as wave movement and turbulence, these factors also affects development

of benthic cyanobacteria (Steinberg and Hartmann, 1988). Other reasons that might explain

their abundance and dominance can be their strong chemical defense system (Pajdak-Stos,

Fiakowska and Fyda, 2001) toxin production (Graham, Loftin, Ziegler and Meyer, 2008;

Frazão, Martins and Vasconcelos, 2010) and less copasetic or unpalatable attribute (Repka,

119

Veen and Vijverberg, 1999; Okogwu and Ugwumba, 2008) which keeps the organisms

away from grazing type feeders like some zooplanktonic organisms along with the lack of

organisms which do prefer it (Rautio and Warwick, 2006) but might not be able to survive in

polluted waters.

We also observed that the six filamentous cyanobacterial dominant species did not perish

under extreme conditions rather, it diminished its growth and seem to adjust acclimatize to

the new set of conditions such temperature, salinity, pH, dissolved oxygen and others. As a

result of this apparent adaptation, it started to bloom again and maintain its presence

throughout the year. Dominant cyanobacteria can thrive in oxidizable organic matter and in

low levels of dissolved oxygen. These species can therefore be found in polluted habitat and

can be considered good pollution indicators (Vijayakumar, Thajuddin and Manoharan, 2007;

Okogwu and Ugwumba, 2008). Cyanobacteria also have a great potential to accumulate

certain hazardous materials like heavy metals and industrial dyes (Rawat, Kumar, Mutanda

and Bux, 2011; Vijayakumar and Manoharan, 2012). Further research is required to

understand the survival mechanisms, and the bioaccumulation and bioremediation potential

of these microorganisms. In current study, less cyanobacterial diversity was observed than

an earlier study of the same site by Zaib-un-Nisa, Mansoor and Siddiqui, (2000) suggesting

that minor cyanobacterial species are indifferent to waste water pollution that may have

compromised this site (author, unpublished data). Further molecular research is required to

explore microbial mat that may facilitate detailed observation of species interaction and their

biochemical aspects.

120

CHAPTER 6

SCREENING OF ANTIMICROBIAL AND

CYTOTOXIC ACTIVITIES OF MARINE

CYANOBACTERIA APHANOCAPSA LITORALIS AND

PHORMIDIUM BREVE ISOLATED FROM

MANGROVE FOREST AT SANDSPIT, PAKISTAN.

(Manuscript submitted for Publication)

121

SCREENING OF ANTIMICROBIAL AND CYTOTOXIC

ACTIVITIES OF MARINE CYANOBACTERIA

APHANOCAPSA LITORALIS AND PHORMIDIUM BREVE

FROM MANGROVE FOREST AT SANDSPIT, PAKISTAN.

6.1. Abstract:

Two strains of cyanobacteria form backwaters mangrove forest were isolated and examined

for potential antagonist activity against clinical and environmental strains of bacteria and

yeast. The cyanobacterial fractions (from sea and distilled water, ethanol, sodium hydroxide)

exhibited variable activity. Results from agar spot assay revealed that the ethanolic fraction

of Phormidium breve and seawater extract of Aphanocapsa litoralis, exhibited positive

antagonistic activity against Candida albicans. Most of bacterial strains were resistant to test

extracts. The cytotoxicity test was employed using Artemia salina. The probit analysis (95%

confidence interval) revealed that the bioassay was highly sensitive against Phormidium

breve ethanolic extract and moderately sensitive against Aphanocapsa litoralis sea water

fraction. The undiluted crude fractions of ethanolic and seawater were found to be lethal and

effective. Median lethal concentration (LC50) values of Phormidium breve ethanolic extract

was 0.02 mg/ml (20 ppm) and Aphanocapsa litoralis sea water fraction was found to be 6.2

mg/ml (6200 ppm) after 24-hours respectively. These findings indicate the fractions were

biologically active and provide a baseline for further antifungal protein research of

mangrove associated cyanobacterial strains.

122

6.2. Introduction:

Cyanobacteria are ubiquitous in moist environment and are highly adaptable under extreme

conditions (Golubic, 1994; Golubic, 2000). They are commonly found in soils and saline

environments (Bhatnagar, Makandar, Garg and Bhatnagar, 2008; Abed, Dobrestov, Al-

Kharusi, Schramm, Jupp and Golubic, 2011) and are responsible for microbial mat

formation on mangrove forest floors (Stal, 2000; Yasmeen, Shafique, Zaib un Nisa and

Siddiqui, 2016). Cyanobacteria serve as a natural source of bioactive substances. Some

cyanobacterial strains have nutritional health benefits (Morton and Steve, 2008) and others

are treated for first generation biofuel production (Bigogno, Goldberg, Boussiba, Vonshak

and Cohen, 2002). Several cyanobacteria contain metabolites that are agriculturally,

pharmaceutically and ecologically important (Schwartz, Hirsch and Sesin, 1990; Schaeffer

and Krylow, 2000; Kim and Lee, 2006; Prabakaran, 2011). Marine cyanobacteria are among

the extensively researched organisms and are source of most of novel marine associated

pharmaceutical products (Gerwick and Moore, 2012).

In Pakistan some studies were found that were associated with cyanobacteria. Frequent

researches were related to taxonomic assessment of cyanobacterial strains of coastal areas

(Mansoor, Siddiqui, Bano and Zaib-un-Nisa, 2000; Zaib-un-Nisa, Mansoor and Siddiqui,

2000; Shameel, 2001; Siddiqui and Bano, 2001; Saifullah and Ahmed, 2007; Bano and

Siddiqui, 2015). Few studies were found related to metabolite such as analysis of

Microcystis aeruginosa metabolite by Aftab and Shameel, (2006) and antimicrobial,

cytotoxic activity of some marine cyanobacteria by Hameed, (2009). But no research has

been reported on mangrove associated cyanobacterial metabolite’s and related antagonistic

123

activity. Sandspit mangrove backwaters parallel to Karachi coast is covered with microbial

mat which may contain commercially and economically relevant metabolites.

The aim of present study was to observe the antagonistic and cytotoxic activity of crude

extracts of two test cyanobacteria belonging to genus Aphanocapsa and Phormidium against

common clinical bacterial and yeast strains. Two environmental strains SSC14011 and

SSC1407 (that are native of microbial mat of test cyanobacterial cultures, gram negative,

rods) were also included in test analysis. Research showed that different cyanobacterial

strains belonging to genus Aphanocapsa and Phormidium produced metabolites

(extracellular and intracellular) that are antibacterial (Ishida, Matsuda, Murakami and

Yamaguchi, 1997; Mundt, Kreitlow and Jansen, 2003; Prabakaran, 2011; Sakthivel and

Kathiresan, 2012; Abd, Zaki and Merthad, 2015) and pharmaceutically significant. Hietala,

Reinikainen and Walls, (1995) worked with Aphanocapsa specie and found that it effects

the feeding pattern of Daphnia. Gullege, Aggen, Huang, Nairn and Chamberlin, (2002) and

Hameed, (2013) observed the cytotoxic effect of Aphanocapsa species against Daphinds and

found that its extracts are hepatotoxic in nature. Current study is an initial step towards

marine cyanobacterial metabolite research coalesced with Pakistan coast.

6.3. Material and Methods:

6.3.1. Site and Sampling:

Sampling was conducted at Sandspit mangrove backwaters forest (24º49’05.63” N,

66º56’37.21” E) (Fig. 2b, site A and for site description see page 31) . Samples were

collected from top soil of mangrove forest floor during monsoon season (end of July 2015).

124

The specimens of green colour microbial mat were collected by glass slide. They were

preserved in autoclaved (15 lb pressure, 121 ºC for 20 minutes) seawater and modified ASN

III (Rippka, 1988, Appendix I) both served as transport media. The samples were kept in ice

box during transport and in laboratory samples were stored at 4ºC.

6.3.2. Isolation of Pure Culture:

Culture modified BG-11 medium (Stiner, Kunisawa, Mandel and Cohen, 1971), amended

with seawater or 35g/L of NaCl, was used for filamentous Phormidium and modified ASN

III was used for isolation of Aphanocapsa. Once the preliminary isolation was completed,

both strains were stored (long term) and further subcultured on modified ASN III medium as

it was found to be an effective medium for pure culture propagation and remained

cotaminanant free for longer time period as compared to BG-11 medium. Both cultures were

isolated and purified as follows, field samples were transferred in BG-11 and modified ASN

III media and observed periodically after 2 weeks, sub samples were transferred into fresh

media under sterile conditions. This method was repeated for 3 months. Streak plate method

(Phang and Chu, 1999) was used in which, agar plates of two respective media were

prepared and cultures were serially diluted and aseptically spread on agar plates and

incubated at 28 ºC under continuous 2500 Lux light regimen, for 15 days. After successive

sub culturing for 3 months, isolated colony (in case of unicellular form) and single filament

(in case of filamentous form) was picked by capillary isolation method (Acreman, 1994;

Andersen and Kawachi, 2005; Bui, 2014). The pure culture was further subcultured for 3

months. The pure culture was regularly gram stained and observed microscopically (to

observe and prevent any bacterial contamination). The cultures were then inoculated in

125

Erlenmeyer flasks containing of fresh media and maintained in flasks containing 1000 ml

medium and recultured (1:10 culture/media) after 1 month until further analysis (Bui, 2014).

6.3.3 Culture Identification:

Two pure strains which were selected for further analysis were identified according to

Desikachary, (1959), Komárek and Anagnostidis, (1999), Komárek and Hauer (2013). 0.1

ml samples were examined using 40X microscope (Olympus). 50 specimens were measured

for the dimensions of single cell (unicellular form) and filament (filamentous form). Pictures

were taken by digital camera (Olypmpus-100, 12M.P).

6.3.4. Preparation of Cyanobacterial Extracts:

For extraction of antagonistic substances, pure cultures were introduced into fresh media and

incubated for 15 days. The biomasses were harvested by filtration (Whatman No.1) and

weighed. The following protocol was used for extraction (Barbarino and Lourenço, 2005;

Aniket, 2012) all extracts were stored at 4ºC until further analysis (Fig. 22),

Phase1: The aqueous extracts from Aphanocapsa and Phormidium were obtained 1-10%

w/v biomass in autoclaved seawater and heated in water bath up to 50 ºC for 60 minutes.

The samples slurries were centrifuged (10,000 rpm, 10 minutes) to obtain extract in

supernatant (liquid phase). The pellets (sediment phase) were used for next phase. The

supernatant that are the first crude extracts (MCE01 (Aphanocapsa), OCE01 (Phormidium ))

126

Phase2: The pellets were then suspended 1-10% w/v in distilled water and heated in water

bath to 50 ºC for 60 minutes. These slurries were then centrifuged (10,000 rpm, 10 minutes)

and the second crude extracts (MCE02, OCE02) were obtained in liquid phase. The pellets

were used for third phase.

Phase3: The biomasses were then suspended in Ethanol (Sigma), 70% w/v mixture. These

were heated to 75 ºC for up to 60 minutes, centrifuged (10,000 rpm, 10 minutes). The

supernatant was collected and stored (MCE03, OCE03). The sediments were used for final

fourth phase.

Phase4: In the final extraction phase the pellets were suspended in an alkaline solution that

consisted of aqueous sodium hydroxide (NaOH), the pH of this solution was 9. The slurries

70% w/v mixture, were heated to 50 ºC for 60 minutes. These were centrifuged (10,000 rpm,

10 minutes), and liquid phase (MCE04, OCE04) stored for further analysis.

6.3.5. Screening for Antagonistic Activity:

6.3.5.1. Preparation of Test cultures:

To investigate the antimicrobial potential of selected cyanobacterial species, common

clinical strains were obtained from Microbiology Reference culture collection laboratory,

Department of Microbiology and Department of Biotechnology, University of Karachi. Two

environmental strains, SSC1407 and SSC14011 isolated by author from microbial mat of

test cyanobacteria by serial dilution and subsequent sub culturing on sodium chloride based

LB agar and broth. The bacterial strains were maintained and propagated for tests on LB

(Luria-Bertani) broth and agar at 37 ºC. The yeast strain was cultured and maintained on

127

Sabouraud dextrose agar at 30 ºC. 0.5 MacFarland turbidity index was used for all test

strains.

6.3.5.2. Spot agar method for screening of antagonistic activity:

The 50l extracts of two cyanobacterial cultures were spot inoculated on LB/SD agar plates

seeded with test culture incubated for 18 hours at 37 ºC. The spot lawn plates were then

incubated for further 24 hours (bacterial test strains, at 37 ºC) and 72 hours (yeast strain, at

30 ºC) respectively. The antagonistic activity was examined by measuring the clear zone of

inhibition’s diameter in mm (Schlegel, Doan, Chazal and Smith, 1998; Pawar and Puranik,

2008).

6.3.6. Protein determination by Bradford Assay:

The protein contents present in crude extracts of two cyanobacterial strains were measured

using Bradford assay (Bradford, 1976). Bovine serum albumin (BSA) was used to obtain

standard curve. The protein was estimated both in mg/ml and g/ml.

6.3.7. Cytotoxic assay:

Artemia salina due to its euryplastic nature (Panagoula, Panayiota and Iliopoulou, 2002) was

considered for the cytotoxic assay. 50mg of Artemia salina cysts were set for hatching in

500 ml of filtered (Whatman, NC 45) and autoclaved aged seawater for 24-48 hours at

ambient temperature in dark round bottom flask and aerated with automated aerator motor.

Within 48 hours nauplii were observed. The nauplii were collected by beaming the light

with torch at one side of the dark flask. The nauplii were gathered towards the light source

128

side and sterile pasture pipette were used to transfer ten nauplii in each test vial. 2-fold serial

dilution of each crude extracts of cyanobacterial strains were prepared in autoclaved

seawater. 1 ml of each dilution was transferred in vials. The tests were conducted in

duplicate. Seawater was used as control. the final concentrations were determined in g/ml

dose (Table XX). The results obtained were calculated as LC50 (Finney, 1971).

6.3.8. Statistical Analysis:

Experiments were performed and computed in in triplicate except for the cytotoxic assay

which was conducted in duplicate. Data was presented as the arithmetic mean (± standard

error). To assess the LC50 of cyanobacterial extracts of two test species, probit analysis was

performed by Minitab 17 statistical software. Microsoft Excel 2016 was used to analyze raw

data, construction of graphs and tables.

6.4. Results and Discussions:

6.4.1. Identification of Pure Culture:

Two cyanobacterial strains were isolated from mix microbial mat culture present at Sandspit

mangrove forest. After pure cultures were successfully separated, These strains were grown

in high salinity level medium. The optimum temperature for growth was found to 30±2 ºC.

The cyanobacterial strains were identified on the basis of form, color, dimensions, colony

morphology and motility.

129

(1) Kingdom: Eubacteria, Phylum: Cyanobacteria,

Class: Cyanophyceae, Order: Synechococcales, Family: Merismopediaceae

Aphanocapsa litoralis (Hansgirg) Forti 1907: 89 (Basionym: Aphanocapsa litoralis

Hansgirg, 1892) (Desikachary, 1959, Komárek and Anagnostidis, 1999, Guiry and Guiry,

2016). Identification characters: Colonies macroscopic, long, irregularly arranged, covered

with transparent and amorphous mucilage. Cells unicellular, dark green in color, spherical, 5

m broad, non-motile, cells divide by binary fission, gas vacuoles absent. Found with other

cyanobacteria throughout year (author observation). Bano and Siddiqui (2003) described this

specie (as Microcystis litoralis) from the intertidal rocky shores of Buleji, Karachi (Fig. 18

A, B, C, D).

(2) Kingdom: Eubacteria, Phylum: Cyanobacteria,

Class: Cyanophyceae, Order: Oscillatoriales, Family: Oscillatoriaceae.

Phormidium breve Kützing ex Gomont 1892 (Desikachary, 1959; Komárek and

Anagnostidis, 2005; Komárek and Hauer, 2013; Guiry and Guiry, 2016). Identification

characters: Colonies macroscopic, transparent mucilage. Filament green, unbranched,

densely aggregated, filament straight composed of disc like cells stacked together in

filament, cell 5 m broad, end filament slightly bent, terminal region cell attenuated, cells

with granules, calyptra absent, heterocystes absent, motile resembles waving motion. Found

with other cyanobacteria abundantly in all seasons throughout the year (author observation) .

Bano and Siddiqui (2015) observed this cyanobacterium from the tide pool of Buleji,

Karachi (Fig. 19 A, B).

130

Figure 18. Aphanocapsa litoralis circular cyanobacteria found in the microbial mat at

Sandspit mangrove area. (A) at stationary stage, 40x, (B) and (C) at exponential stage, 100x,

(D) at late exponential stage, 100x.

10 m

A B

C D

131

Figure 19. Phormidium breve filamentous cyanobacteria found in the microbial mat at

Sandspit mangrove backwaters. (A) at early stationary phase, 100x, (B) at mid exponential

phase and close to stationary phase, 100x, (C) left flask containing Phormidium breve

culture, forms sheath like mats, right flask containing Aphanocapsa litoralis culture, forms

fine granular suspension. Both flasks contain modified ASN III medium.

A B

C

132

(A)

(

B)

(C

)

Fig

ure 2

0.

Sp

ot

agar

tes

t o

f cy

anob

acte

rial

ex

trac

ts o

n p

ota

to d

extr

ose

ag

ar p

late

s se

eded

wit

h c

lin

ical

stra

in

of

Ca

nd

ida

a

lbic

an

s.

(A)

(B)

(C),

p

late

s sh

ow

ing

zo

ne

of

inh

ibit

ion

fo

rmed

, M

CE

01

is

th

e

Ap

ha

noca

psa

li

tora

lis

seaw

ater

ex

trac

t,

OC

E0

3

is

the

Ph

orm

idiu

m

bre

ve

eth

ano

lic

extr

act.

5

0

l

Un

dil

ute

d c

rud

e ex

trac

ts w

ere

test

ed.

133

Table XIX. Antagonistic activity of mangrove associated cyanobacteria (crude extracts)

against different strains.

(Where, (+) zone of inhibition 2-5(mm) , (++)zone of inhibition 10 mm, (-) No zone of inhibition, (LH) This

Localized strain was isolated form civil hospital, Karachi and provided by department of biotechnology,

University of Karachi, (SSC14011) gram negative, short rods isolated from microbial mat of native

cyanobacteria, (SSC1407) gram negative, short rods isolated from microbial mat of native cyanobacteria.

Concentrations of crude extracts were 300 g/ml.)

Cyanobacterial

Fractions/ Test Strains

Aphanocapsa litoralis Phormidium breve

Sea

water

Distilled

water Ethanol NaOH

Sea

water

Distilled

water Ethanol NaOH

Clinical strains

Escherichia coli 1030 - - - - - - - - Staphylococcus aureus 1161 - - - - - - - - Staphylococcus aureus

(LH) + + - - - - - -

Klebsiella pneumoniae - - - - - - - - Beta Haemolytic

Streptococci G - - - - - - - - Pseudomonas aeruginosa - - - - - - - -

Micrococcus sp. - - - - - - - -

Acinetobacter sp. - - - - - - - -

Proteus O - - - - - - - -

Candida albicans ++ - - - - - ++ -

Environmental strains

SSC14011 + - - - - - + -

SSC1407 - - - - - - - -

134

Figure 21 A. Probit analysis plot showing effect of Aphanocapsa litoralis seawater extract

towards Artemia salina (brine shrimps). 50% mortality is expected at log dose 3.8 g/ml

whereas, 90% mortality is expected at 4.4 g/ml of log dose. LC50 is computed as 10^ (log

dose50) g/ml

135

Figure 21 B. Probit analysis plot showing the cytotoxic effect of Phormidium breve ethanol

fraction towards Artemia salina (brine shrimps). 50% mortality is expected around log dose

1.3 g/ml whereas, 90% mortality is expected at 1.4 g/ml of log dose respectively.

LC50 is computed as 10^ (log dose50) g/ml.

136

Fig

ure 2

2. F

low

char

t o

f ex

trac

tion

of

bio

act

ive

pro

tein

ex

trac

ts f

rom

cyan

obact

eria

l st

rain

s.

137

6.4.2. Antagonistic Activity:

The results obtained from the antagonistic activity test revealed that only two extracts

MCE01 (Aphanocapsa litoralis, seawater extract) and OCE03 (Phormidium breve, ethanol

extract) were found to have significant inhibitory effect against Candida albicans (Table

XIX). MCE01 showed minimal zone of inhibition against Staphylococcus aureus (2 mm)

(LH) and SSC14011 (3 mm). MCE02 (Aphanocapsa litoralis, distilled water extract)

exhibited minor zone of inhibition (2 mm) against Staphylococcus aureus (LH). OCE03 also

revealed minimal zone of inhibition (5 mm) against SSC14011 strain respectively. It was

observed that the antagonistic activity against test microorganisms differed with respect to

cyanobacterial species and extraction method (Rao, 1994). For instance, the ethanolic

fractions of filamentous Phormidium breve were highly potent against Candida albicans

than other fractions and form clearer zones of inhibition. (Fig. 19 A, B, C) whereas,

Aphanocapsa litoralis extracts exhibited lower potency and formed turbid zones of

inhibition. The sodium hydroxide extracts were least effective. Most of the clinical test

organisms did not respond to all the extracts. This may be due the presence of some

inhibitory substances in extract that effect the antibacterial activity against clinical strains

(Martins, Ramos, Herfindal, Sousa, Skærven and Vasconcelos, 2008).

6.4.3. Protein Estimation and Cytotoxic Assay:

Bradford assay revealed that Phormidium breve was found to contain 1.49 mg/ml protein

and Aphanocapsa litoralis sample contained 24.93 mg/ml protein content. In both

cyanobacterial extracts the mortality rate was lower in diluted fractions as compared to

undiluted fractions. In case of cyanobacterial culture of Aphanocapsa litoralis, out of four

138

concentrated crude extracts only one extract MCE01 (Sea water fraction) exhibited cytotoxic

activity. The toxicity of Aphanocapsa litoralis (MCE01) towards Artemia salina showed

LC50 of 6.2 mg/ml (6237.3 g/ml) (Table XX). Rest of the extracts were not cytotoxic and

showed 100% survival rates in fractions of MCE02 (Distilled water), MCE03 (Ethanol) and

MCE04 (NaOH). In case of Phormidium breve, out of four extracts, OCE03 was found to be

most effective and showed cytotoxic activity against brine shrimps. The crude undiluted

OCE03 (Ethanol fraction) demonstrated 100% lethality which remained constant upon

subsequent dilutions. The LC50 of OCE03 was 0.02 mg/ml (20.3g/ml). Other fractions

which were eluted in seawater (OCE01), distilled water (OCE02) and NaOH (OCE04)

showed no lethality to brine shrimp. The probit analysis revealed that between two effective

cyanobacterial extracts, OCE03 exhibited increased potency than MCE01. This shows that

there must be highly toxic compounds in extract that which were lethal to Artemia salina in

increased dilutions. The probit results also indicated that at stress level of 0.9 log dose, 99%

of test brine shrimps exposed to MCE01 and 100% exposed to OCE03 may be killed (Fig.

20 A, B; Table XXI, XXII).

In this study two members of cyanobacteria, a filamentous form and coccoid form belonging

to genus Phormidium and Aphanocapsa were observed for their antibiotic and cytotoxic

activity. It was found that the filamentous form was more potent as compared to coccoid

cyanobacteria against Candida albicans. The same was also true for cytotoxic activity

against brine shrimps. Our results concur with the earlier study of Scholz and Liebezeit,

(2012) where most of the potential activities occurred in biomass extracts. As temperature

and light intensity also plays a significant role on antagonistic protein production in both

139

cyanobacterial genus (Sivonen, 1990; Utkilen and Gjolme, 1992), it was observed in current

investigation that, the increased amount of biomass was obtained when the cultural

conditions were 6.8 pH, even light source 2000 lux, temperature 29-30 ºC, 10-15 days

incubation period and 2 minutes agitation/day respectively. Under natural field conditions it

was observed that monsoon period was more favorable for both strains as compared to pre-

monsoon and post- monsoon seasons. Both strains were observed to be among primary

members of green microbial mat present in mangrove forest. Aphanocapsa litoralis was also

reported earlier by Bano and Siddiqui, (2003) on the rocky shores of Buleji, Karachi. The

cyanobacterial strains of Sandspit mangrove forest were found to be halotolerant and retain

bioactive substances. These strains were selected because there are several studies related to

metabolites of genus Aphanocapsa and Phormidium demonstrating inherent natural

chemical products that can be effective against microorganisms of clinical and ecological

significance.

140

Table XX. Cytotoxic assay of crude extracts of cyanobacteria. (Where, *1 is the fraction

from seawater extract, *2 is the fraction from Ethanolic extract. The data of extracts showing

brine shrimp mortality are presented in tabular form.)

Cyanobacteria

Sample

Concentration

(g/ml)

Concentration

(Log)

Mortality

(%)

LC50

(g/ml)

Aphanocapsa

litoralis MCE01*1

0 0.0 0

779 2.9 10

1558 3.2 40

3116 3.5 30 5900.7

6232 3.8 60

12465 4.1 40

24930 4.4 90

Phormidium

breve

OCE03*2

0 0 0

23 1.4 80

47 1.7 100

94 2.0 100 20.3

188 2.3 100

375 2.6 100

750 2.9 100

1500 3.2 100

141

Table XXI. Probit analysis of Aphanocapsa litoralis (seawater fraction).

S.No. Parameters

1)

Statistics log dose g/ml

Mean 3.7709

StDev 0.871227

Median 3.7709

IQR 1.17527

2)

Regression

Variable Coefficient

Standard

Error Z P

Constant -4.32826 0.417732 -10.36 0.00

log Dose 1.14781 0.11285 10.17 0.00

3)

Goodness-of-Fit Tests

Method

Chi-

Square DF P

Pearson 55.9524 5 0.00

Deviance 55.8714 5 0.00

4)

Tolerance Distribution

Parameter Estimate Standard 95.0%CI

Error Lower Upper

Mean 3.7709 0.048538 3.67577 3.86603

StDev 0.871227 0.085658 0.718526 1.05638

5)

Table of Percentiles

Percent Percentile Standard 95.0% CI

Error Lower Upper

10 2.65438 0.110579 2.39089 2.83953

50 3.7950 0.048538 3.67776 3.87182

90 4.88742 0.128783 4.67289 5.19585

6)

Table of Survival Probabilities

Stress Probability 95.0%CI

Lower Upper

0.9 0.999508 0.997217 0.999976

142

Table XXII. Probit analysis of Phormidium breve (Ethanolic fraction).

S.No. Parameters

1)

Statistics log dose g/ml

Mean 1.30803

StDev 0.063806

Median 1.30803

IQR 0.086073

2)

Regression

Variable Coefficient

Standard

Error Z P

Constant -20.5002 996.518 -0.02 0.98

log Dose 15.6726 731.804 0.02 0.98

3)

Goodness-of-Fit Tests

Method

Chi-

Square DF P

Pearson 6E-07 6 1.00

Deviance 1.2E-06 6 1.00

4)

Tolerance Distribution

Parameter Estimate Standard 95.0%CI

Error Lower Upper

Mean 1.30803 2.50746 -3.6065 6.22256

StDev 0.063806 2.97929 0 -

5)

Table of Percentiles

Percent Percentile Standard 95.0% CI

Error Lower Upper

10 1.22626 6.32557 - -

50 1.30803 2.50746 - -

90 1.3898 1.31071 - -

6)

Table of Survival Probabilities

Stress Probability 95.0%CI

Lower Upper

0.9 1.00 - -

143

Aphanocapsa litoralis has been taxonomically studied (Shah, Garg and Madamwar, 2001;

Silambarasan, Ramanathan and Kathiresan, 2012; Sakthivel and Kathiresan, 2013) but there

are few antagonistic activity study of this strain. On the other hand, studies on Phormidium

breve both from fresh water and saline water sources are not rare. This cyanobacterial strain

has been researched for antimicrobial activity (Metting and Pyne, 1986; Scholz and

Liebezeit, 2012), taxonomic assessment (Nagarkar, 2002), presence of odorous compounds

such as geosmin and 2-methylisoborneol (Berglind, 1983; Naes, Aarnes, Utkilen, Nilsen and

Skulberg, 1985) and heavy metal tolerance (Tong, Nakashima, Shibasaka, Katsuhara and

Kasamo 2002) respectively, that signify the importance of investigating these strains from

native mangrove areas. Hameed, (2009) examined the antimicrobial and cytotoxic activities

of Synechocystis sp., Chroococcus sp., Pseudoanabaena sp. and Geitlerinema sp. form

Pakistan’s coastal region but there were no recent studies related to current test

cyanobacterial strains. Therefore, present research acknowledges the antibiotic potential of

marine cyanobacteria of the Sandspit mangrove backwaters. The information obtained can

be used as a base line to observe new peptides and minor compounds. Further molecular and

bioactive compounds analysis according to recent research works (Golubic, Abed, Palińska,

Pauillac, Chinain and Laurent, 2010; Richert, Golubic, Le Guédès, Ratiskol, Payri and

Guezennec, 2005; Abed, Golubić, Garcia, Camoin and Lee, 2003) are recommended to fully

examine the pharmaceutical potential of these two cyanobacteria.

144

CHAPTER 7

CHARACTERIZATION OF TWO ANTAGONISTIC

SUBSTANCES PRODUCED BY MANGROVE

BACTERIA FROM SANDSPIT BACKWATERS,

PAKISTAN.

(Manuscript in progress)

145

CHARACTERIZATION OF TWO ANTAGONISTIC

SUBSTANCES PRODUCED BY MANGROVE

BACTERIA PROTEUS SP. SSC1407 AND

KLEBSIELLA PNEUMONIAE SSC14011

FROM SANDSPIT BACKWATERS, PAKISTAN.

7.1. ABSTRACT:

Mangrove ecosystem sustains variety of microbes that are involved in various biological and

physicochemical processes. These bacteria are major components of decomposers and

primary producers and also facilitate in the expansion of mangrove forest floor. Present

study examines bacteriocin characteristics and its antagonistic activity against clinical

isolates of two cultivable heterotrophic bacteria SSC1407 and SSC14011, that were isolated

from the microbial mat present on the top sediment of Sandspit mangrove forest. 16S rRNA

gene sequencing was performed to confirm the identity of isolates. Isolate SSC1407 was

found to be closely related to Proteus sp. (99% homology) and displays an inhibitory pattern

against Escherichia coli 1030. The cell free crude extract was insensitive to different

chemical solvents except for toluene and butanol, tolerated temperatures from 4- 40 ºC and

pH 5-12. Cytotoxic activity against Artemia salina showed LC50 52.03 g/ml. Isolate

SSC14011 was found to be distinctly related to Klebsiella pneumoniae strain. The cell free

crude proteinaceous extract exhibited antagonistic activity against Proteus O clinical isolate.

This bacteriocin showed relatively higher growth rate, it was active between 4- 40 ºC

temperatures, tolerated 5-9 pH, was insensitive to prolonged UV- exposure (4 minutes) and

displayed relatively narrow inhibitory spectrum when exposed to chemical solvents and

provided higher purified protein yield. The LC50 values were found to be 46.17 g/ml. Both

strains were isolated and reported for the first time in Pakistan. Further studies are required

to fully explore the metabolites antagonistic potential against common bacterial and fungal

agents and to observe other bacteria associated with mangrove microbial mat.

146

7.2. INTRODUCTION:

Bacteriocins (Antagonistic substances in nature) are bacterial metabolites that are mainly

polypeptide in nature. These substances inhibit or kill the growth of both gram negative and

positive microorganisms (Cleveland, Montville, Nes and Chikindas, 2001). This antagonistic

phenomenon is common for survival and sustenance of bacterial colony. The mode of action

is effective against strains that are closely related to producer (Klaenhammer, 1988). These

protein antibiotics are heterogeneous in nature and consist of wide range of molecular mass

and exhibit variable biochemical and inhibitory traits (Sullivan, Ross and Hill, 2002). The

attributes responsible for stability of bacteriocin depend upon the nature of producing

organisms. These antagonistic substances are broadly divided into four classes according to

Klaenhammer, (1993), (A) Class І bacteriocin or Lantibiotics that are effective against broad

spectrum pathogenic and non-pathogenic bacteria, (B) Class ІІ bacteriocins are low

molecular weight and non heat labile, (C) Class ІІІ bacteriocin are high molecular weight

and heat sensitive proteins and (D) Class ІV are complex bacteriocins.

Marine microbes are an integral component of marine ecosystem (Ahmed and Yasmeen,

1988). The marine related bacteriocins usually exhibit restricted antagonistic activity

spectrum (Smarda and Taubeneck, 1968; Lee, Jun, Kim and Paik, 2001). Various

experiments were conducted to explore bacteriocin produced by marine microbes (Das

Sharma and Arora, 1997; Platas, Meseguer and Amils, 2002). These include exploring its

potential as a source of secondary metabolites (Jensen and Fenical, 1994). Extensive

research has been carried out to screen bacteriocins from sources such as seawater

(Jayaraman, Rajesh and Karthikeyan, 2012), estuarine waters (Singh, Sivasubramani,

147

Jayalakshmi, Satheesh and Selvi, 2013), marine sediments (Elayaraja, Annamalai, Mayavu

and Balasubramanian, 2014) and mangrove sediments (Lee, Zainal, Azman, Eng, Goh, Yin,

AbMutalib and Chan, 2014), sponges (Anand, Bhat, Shouche, Roy, Siddharth and Sarma,

2006), clams (Shayesteh, Ahmad and Usup, 2014).

Marine microbes are also responsible for diverse cache of flora in Pakistan coastal waters

(Jamil, Erum, Ahmed, Yasmeen and Ahmed, 1999). The coastline along with the estuarine

areas of Pakistan offers a valuable source for bacteriocin research of marine associated

bacteria. Mangroves (which are natural barriers of coastline and protects against natural

disasters such as tsunami and thunderstorms) are nutrient rich and provide a unique habitat

for estuarine flora and fauna (Jennerjahn and Ittekkot, 2002). Among them bacteria, serve as

the primary decomposers, that are an essential component of food, web (Becks, Hilker,

Malchow, Jürgens and Arndt, 2005; Long, Xiang, Zhuang and Lin, 2005; Benincà,

Huisman, Heerkloss, Jöhnk, Branco, Van Nes, Scheffer and Ellner, 2008). The presence of

extreme physico chemical factors such as salinity, pH and temperature culminate into

diverse and hardy microbial community in mangrove habitat that is bound to generate

unique metabolites to tolerate harsh conditions. Recent studies focusing on mangrove-

associated bacteria revealed a great potential in terms of Pharmacognosy (Long, Xiang,

Zhuang and Lin, 2005; Ara, Kudo, Matsumoto, Takahashi and Omura, 2007; Hong, Gao,

Xie, Gao, Zhuang, Lin, Yu, Li, Yao, Goodfellow and Ruan, 2009; Yan, Wang, Mao, Ma, Li,

Ouyang, Guo and Cao, 2010; Sánchez, Luna, Campa, Escamilla, del Carmen Flores and

Mazón, 2015).

148

In Pakistan, most bacteriocin studies were form terrestrial sources (Jabeen, Gul, Subhan,

Hussain, Ajaz and Rasool, 2009; Saleem, Ahmad, Yaqoob and Rasool, 2009). Some of the

marine bacteriocin studies were associated with marine catfish related vibriocin (Zai,

Ahmad and Rasool, 2009), fisheries, sediment and seawater associated bacteriocin (Ahmed,

Jamil, Khan, Yasmeen, Haq, Ahmed and Rahman, 2000; Pirzada, Nasir and Rasool, 2000).

Salt tolerance levels of some mangrove bacteria were determined by Amir, Ahmed and

Talat, (1993). These forests were investigated for variety of fauna and flora (Chaghtai and

Saifullah, 1992; Saifullah, Nizamuddin and Gul, 2005; Sohail and Solaha; 2005; Nazim,

Ahmed, Shaukat, Khan, Rao, Ali and Sherwani, 2012; Nazim, Ahmed, Shaukat, Khan and

Ali, 2013; Shafique, Siddiqui and Farooqui, 2015; Nasira and Shahina, 2016; Qureshi, Farah

and Saher, 2016) but no recent studies are available investigating the bioactive bacterial

metabolites of mangrove area. This location is expected to provide source of secondary

metabolites that may be relevant for either clinical or industrial use. The purpose of current

study is isolation, identification and characterization of bacteriocins/antagonistic substances

from indigenous microbial mat bacteria of mangrove forest at Sandspit backwater.

7.3. Material and Methods:

7.3.1. Sample Collection and Preliminary Isolation:

Top soil containing microbial mat samples were aseptically collected during the month of

July 2014 at Sandspit backwater forest (24º49’05.63” N, 66º56’37.21” E) (Fig. 2b, site A

and for site description see pg. 31) using sterile corers. 30 gm of top soil section containing

mat sample was dissolved (1:1w/v) in sterile distilled water, vortexed, stand for half hour at

ambient temperature, then serially diluted (1:10 v/v), spread 0.1 ml on nutrient and Luria-

149

Bertani (LB) agar plates (Sigma), incubated at 30ºC for 24-48 hours. Selected single

colonies were plated against several clinical strains (obtained from Reference Culture

Collection Lab, Microbiology department, University of Karachi) and antagonistic activities

were observed by agar stab and streak method. The strains that showed zone of inhibition

were finally selected for further analysis. All strains were maintained on LB agar slants and

kept at 4ºC respectively.

7.3.2. Identification of Bacterial Strains:

The morphological characters were observed by gram staining and microscopy (100x,

Olympus) and colonial characters were observed on nutrient agar (NA) plates. The

biochemical characteristics were analyzed by API 20E Kit (bioMerieux). The molecular

identification of selected isolates was carried out by 16S rRNA gene sequencing. Briefly,

for DNA extraction 1ml culture was centrifuged (12000xg, 5 minutes) and pellets washed

and suspended in phosphate buffered saline PBS (pH 7.2). The suspension was then boiled

and kept on ice (10 minutes each) before PCR analysis (Lauerman, Hoerr, Sharpton, Shah

and van Santen, 1993). The primer sequences were designed from the earlier reported

conserved regions for bacterial 16S rRNA gene (Weisburg, Barns, Pelletier and Lane, 1991).

Sequencing was done using the forward primer (fD1) (5`-AGAGTTTGATCCTGGCTCAG-

3`) and reverse primer (rP2) (5`ACGGCTACCTTGTTACGACTT - 3`). PCR reaction

mixture contained following reagents, 1.5mM MgCl2, 200M of each dNTP (Promega),

1M of primers fD1 and rP1, 1l template DNA, 1.0 U Go Taq DNA polymerase, and 1x

Go Taq reaction buffer (Promega) in a 40 μl final reaction volume. The PCR reactions were

150

performed under following conditions, denaturation at 95ºC for 2 min, 35 cycles of 95ºC for

15 seconds, 55ºC for 30 seconds, 72ºC for 2 minutes, followed by a final extension at

72ºCof 7 minutes (Applied Biosystem, Veritti 96 well). The presence and approximate

concentration of the PCR products were verified by electrophoresis using 1% Agarose gel

stained with Ethidium bromide in (1x) TBE Buffer. An automated DNA Sequencer

(Macrogen) examined the 16S rRNA gene sequence

7.3.3. Preparation of Crude Extracts:

Bacteria were grown in 200ml of LB broth at 30ºC for 24 hours. The cells were harvested

after centrifugation at 10,000xg for 15 minutes. The cell free supernatant (CFS) were

syringe filtered (0.45m) and stored in sterile screw cap tubes at 4ºC. pH was adjusted to 7.5

using 1N NaOH/1N HCL (Jabeen, Gul, Subhan, Hussain, Ajaz and Rasool, 2009).

7.3.3.1. Bioassay of Bacteriocin (Antagonistic Substance):

To examine the viability of crude extract, agar well diffusion method was carried out to

detect the antagonistic activity against indicator strains. Indicator strains corresponding to

0.5 McFarland turbidity index were plated and agar well was cut using gel borer. 50 l test

supernatant introduced into respective wells and incubated at 30ºC for 24 hours (Geis, Singh

and Teuber, 1983; Bizani and Brandelli, 2002). Distilled water used as control.

7.3.3.2. Growth curve assay:

The growth assay was performed to obtain the viable number of cells or colony forming

units (CFU/ml) for maximum bacteriocin yield. The culture(s) (1:10 v/v) were added in

151

fresh LB broth and incubated at 30ºC for 9 hours. After each 3 hrs interval, 1ml of the

bacterial suspension was withdrawn and loaded onto LB agar plates and incubated at 30ºC

for 24 hours. The plates were then counted for number of colonies and data recorded (Motta

and Brandelli, 2002).

7.3.3.3. Bacteriocin activity unit (AU) assay:

Two-fold serial dilutions of (a) test CFS crude extract (b) partially purified ammonium

sulphate (NH4)2SO4 precipitated (80%) bacteriocin and (c) purified dialyzed (12 kDa)

bacteriocin were prepared and antagonistic activity was observed by disk diffusion assay

(Kimura et. al., 1998). The zone of inhibition around each disk was measured in mm. The

bacteriocin titer was expressed as activity unit/ml. One activity/arbitrary unit of bacteriocin

is the reciprocal of last serial dilution exhibiting significant inhibitory effect and is presented

in the following formula (Barefoot and Klaenhammer, 1983),

AU/ml= Reciprocal of highest dilution/ Volume of test bacteriocin added × 100

7.3.4. Characterization of test Bacteriocin:

Partially purified supernatants of test bacteriocins were characterized with respect to pH,

temperature, chemicals and ultra violet light.

7.3.4.1. Temperature effect on bacteriocin Activity:

Effect of temperature on partially purified bacteriocin was performed by incubating 5ml

samples at different temperatures ranging from ambient to 121ºC (15 psi) for 30 minutes and

4ºC for 6 months. Each fraction was then, assayed for bacteriocin residual activity (Ten

brink, Minekus, Van der Vossen and Leer, 1994; Ogunbanwo, Sanni and Onilude, 2003) by

152

agar well method. Residual activity was defined as the ratio of the diameter (mm) of

inhibition halo produced by the treated test sample compared to the untreated control

(Mathys, Ah, Lacroix, Staub, Mini, Cereghetti and Meile, 2007). Residual activity is

expressed in percent (%).

7.3.4.2. pH effect on bacteriocin activity:

To determine bacteriocin activity at different pH levels, partially purified bacteriocins were

adjusted to various pH ranges from 3 up to 11. The acidic pH was adjusted by sterile 1N

HCL and basic pH was obtained by adding sterile 1N NaOH. The samples were incubated

for one hour at 28 ºC. The agar well diffusion method was used to examine the residual

activity against sensitive strains (Larsen, Vogensen and Josephsen, 1993; Saeed et. al.,

2006).

7.3.4.3. Chemical effect on bacteriocin activity:

Partially purified bacteriocin (18hour old culture) was assessed for its sensitivity to different

chemicals. Chemicals (Sigma) of 10% v/v (liquid) or 10 mmol/lit (soild) concentrations

were introduced to bacteriocin and the samples were incubated for one hour at 28 ºC before

being analyzed for residual activity via agar well diffusion assay against sensitive strains

(Bizani and Brandelli, 2002).

7.3.4.4. Ultra-violet effect on bacteriocin activity:

Two 10ml partially purified test bacteriocin samples were placed in sterile petri plates and

exposed to ultra violet light (15-watt Philips) at 25 cm distance. The plates were exposed to

time intervals from 0 to 5 minutes. After each one-minute time interval samples withdrawn

153

via pipette and bacteriocin residual activity was determined by agar well diffusion method

(Zaid, Nasir and Rasool, 2000).

7.3.5. Bacteriocin Purification:

Crude extract of bacteriocin was precipitated with 80% ammonium sulphate (Merck). The

ammonium sulphate saturation was conducted at 4ºC with continuous stirring for 2 hours

followed by overnight incubation at 4 ºC. The precipitates were collected by centrifugation

at 10,000g for 20 minutes. The precipitates were re-dissolved in 10mM PBS buffer (pH 7.5)

and stored at 4ºC for dialysis (Harris and Angal, 1989). Dialysis was carried out in dialysis

bag (10 kDa, Sigma). 1 ml precipitate was dialyzed against 500x buffer (500 ml autoclaved

distilled water) with constant stirring at 4ºC for 4hrs then buffer was changed for overnight

dialysis at 4ºC (Scopes, 2013). The samples were kept at 4ºC for further analysis.

7.3.6. Protein Estimation:

The amount of protein (g/ml and mg/ml) present in crude and purified extracts were

calculated by the method of Bradford, (1976). Bovine serum albumin (BSA) was used as

standard.

7.3.7. SDS-PAGE Gel Electrophoresis:

The molecular weight of purified extracts was analyzed by 12% SDS polyacrylamide gel

electrophoresis unit. The gel was run under reducing and denaturing conditions. The

samples were treated with beta mercaptoethanol and heated at 99±1ºC. The gel was run at

constant voltage of 80 volts for 2hours. After, electrophoresis, the gel was stained with

154

Coomassie brilliant blue R-250 stain (Laemmli, 1970). Standard Protein Marker

(MOLECULE-ON PINK) was run with 11 proteins that resolve in to bands in the range of

10-175 kDa respectively.

7.3.8. Cytotoxicity Test:

Brine shrimp lethality test was conducted to observe the cytotoxic effect of selected

bacteriocin on brine shrimp (Meyer, Ferrigni, Putnam, Jacobsen, Nichols and McLaughlin,

1982; Rajaram, Manivasagan, Gunasekaran, Ramesh, Ashokkumar, Thilagavathi and

Saravanakumar, 2010). Briefly, the Artemia salina eggs were hatched in an autoclaved

seawater. 10 nauplii stage larvae were kept in each sample vials. The test bacteriocin crude

extract was serially diluted 2-fold in an autoclaved seawater and 10 ml of each dilution was

added in each vial. The test was conducted in duplicate. Autoclaved seawater plus 10

shrimps were used as control. The samples were incubated at ambient temperature under

constant aeration for 24 hours. The mortality rate was observed and lethal percentage of

each extract was recorded (Bhatt, Khushboo and Maitreyi, 2016; Waliullah, Yeasmin, Alam,

Islam and Hassan, 2016).

7.3.9. Statistical analysis:

All experimental results are presented in means of triplicate or duplicate trials. For

computation of raw data and graphs, Microsoft excel 2016 was used. Minitab 17.0 statistical

software package was used to analyze data of lethal concentration (LC50) of selected

extracts by probit analysis method (Finney, 1971). LC50 is computed as 10^ (log dose50)

g/ml

155

For molecular identification, The PCR products were sequenced at Macrogen Inc., South

Korea. Sequencing was successful and partial sequences for both strains were obtained.

Homology with sequences in GenBank database was evaluated using BLASTN 2.5.1+

software. Using these obtained sequences, phylogenetic tree by neighbor-joining method

was constructed by the NCBI Tree Viewer 1.11.1. software (Altschul, Gish, Miller, Myers

and Lipman, 1990; Zhang, Schwartz, Wagner and Miller, 2000; Morgulis, Coulouris,

Raytselis, Madden, Agarwala and Schäffer, 2008).

7.4. Results and Discussions:

7.4.1. Isolation and Identification of bacterial strains:

In current study, two mangrove microbial mat bacterial strains (culture code, SSC1407 and

SSC14011) exhibiting antagonistic activity against two clinical cultures Escherichia coli

1030 and genus Proteus O strain were selected for detailed bacteriocin analysis. The culture

SSC1407 showed inhibitory activity against Escherichia coli 1030 and bacterial culture

SSC14011 showed antagonistic activity against Proteus O strain respectively (Table XXIV).

Based on the biochemical characteristics the strain SSC1407 belongs to genus Proteus

whereas the strain SSC14011 is closely related to Klebsiella genus. The microscopic,

colonial and biochemical characters of both strains are represented in Table XXIII (Fig. 23).

A BLAST search using the FASTA sequences of the two cultures showed a close match

with ‘Uncultured Proteus sp. clone W60 16S ribosomal RNA gene, accession JF733467.1’

for Strain SSC1407 and with ‘Klebsiella pneumoniae strain CCFM8368 16S ribosomal

RNA gene, accession KJ803925’ for strain SSC14011 respectively.

156

Figure 23. Bacteria isolated from the microbial mat of sandspit mangrove forest. Strain

SSC1407 is shown in plates A to F, the inhibitory effect was examined against E. coli 1030.

Strain SSC14011 is represented in plates G to L, the antagonistic effect was observed

against Proteus O sp. (A), (G) showing inhibitory effect against sensitive strains, (B), (H)

showing isolated test cultures, (C), (I) showing general morphology and gram negative

reaction under 100x magnification, (D), (J) showing disk diffusion assay crude extracts, (E),

(K) showing agar well diffusion assay of crude extracts, (F), (L) showing disk diffusion

assay after dialysis, (M) showing biochemical reactions via analytical profile index (API) kit

method. Arrows mark the formation of zone of inhibiton (measured in mm).

A

F E

D C

B G

H

I

L

J

K

M

157

Table XXIII. General and Colonial characters of isolated mangrove bacterial strains.

(Where, (-) negative, (+) positive, No2 nitrate redution test, H2S production of hydrogen sulfide, Pellicle=

growth concentrated more towards surface as compared to bottom, Entire= margin without serration, Staph=

in groups, Dipplo= in groups of two cells, Colonial Characters on LB agar.)

Observations SSC1407 SSC14011

Morphology

Gram Reaction - -

Shape Rods Rods

Arrangement Scattered/dipplo forms Bunches/Staph forms

Spores + +

Colonial Characters

Form Circular Circular

Size Pinpointed Pinpointed

Margin Entire Entire

Surface Smooth Smooth

Elevation Convex Convex

Opacity Translucent Opaque

Color Off white creamy White

Turbidity (LB broth) Uniform Granular

Sediment (LB broth) Powdery Granular

Surface growth (LB broth) Fine Pellicle

Biochemical Characters

Indole + -

Methyl red + -

Voges Proskauer - +

Citrate - +

Carbohydrate test

Glucose + +

Sucrose + +

Mannitol + +

Sorbitol - +

Rhamnose - +

Oxidase - -

NO2 + +

H2S + +

Urease + +

Gelatinase + +

158

7.4.2. Bioassay and growth curve:

Bacterial biomass was determined in LB broth and agar. The two strains showed variable

growth conditions. Strain SSC1407 showed optimum growth at 0-3 hrs. interval and the

strain SSC14011 showed steady growth rate up to 9 hours. The rate of bacteriocin

production corresponds to their growth rate (Fig. 24 A).

7.4.3. Characterization of bacteriocin:

Temperature, both strains were found to be temperature sensitive and showed minimal to no

activity after 80 ºC. SSC1407 was not stable at freezing temperature in contrast with 011

that give 85% residual activity. Both strains were stable at 4ºC for about a year and half

(with subsequent sub culturing) (Fig. 24 B). Although both strains were found to give

optimal activity up to 40ºC, the 30ºC was found to be most favorable temperature for culture

propagation and bacteriocin yield.

pH, the optimum pH range was found to be between 6.7-7.9. Both cultures were able to

tolerate either extreme acidic or basic conditions and exhibited residual activity. Strain

SSC1407 was found to tolerate range of basic pH effectively (Fig. 25).

159

Chemicals, different chemicals were tested to observe the effect chemicals on bacteriocin

activity. strain SSC1407 was more stable against test chemicals as compared to SSC14011

strain. SSC1407 exhibited 100% residual activity against Acetone, Di ethyl ether, Di methyl

sulfoxide, and Acetic acid, whereas, SSC14011 strain was resistant to Acetone and Acetic

acid (Table XXV).

Ultra-violet, effect of UV-light on bacteriocin activity was also carried out. It was observed

that out of the two SSC14011 test bacteriocin was able to provide minimal activity after 4

minutes of exposure. The SSC1407 did not maintain its stability that long and give moderate

activity at one -minute exposure (Fig. 26). These results reveal that the bacteriocin activity

produced by the test strains is sensitive to UV-light.

Table XXIV. Antagonistic activity of Sandspit mangrove cyanobacteria against different

clinical strains.

(key = (+) zone of inhibition (mm), (-) No zone of inhibition)

Indicator Strains SSC1407 SSC14011

Escherichia coli 1030 + -

Staphylococcus aureus 1161 - -

Klebsiella pneumoniae - -

Beta Haemolytic Streptococci G - -

Pseudomonas aeruginosa - -

Micrococcus sp. - -

Acinetobacter sp. - -

Proteus O - +

Candida albicans - -

160

Table XXV. Effect of different chemicals on antagonistic activity of mangrove bacteria.

The test crude extracts were obtained after18 hours incubation and then test chemical was

introduced for one hour, after incubation test bacteriocin extracts were assayed for

antagonistic activity against selective sensitive strains.

(1*= 1mg/ml concentration used.)

S. No. Chemicals Concentration

(V/V)

Strain Residual

activity (%)

SSC1407 SSC14011

1) Ethanol 10% 60 0

2) Methanol 10% 60 0

3) Acetone 10% 100 100

4) Chloroform 10% 50 20

5) Di ethyl ether 10% 100 50

6) Dimethyl sulfoxide 10% 100 50

7) Acetic acid 10% 100 100

8) Toluene 10% 0 50

9) Butanol 10% 0 0

10) Sodium dodecyl sulfate 1* 50 0

11) Tween 80 10% 60 60

161

Figure 24 A. Growth curve and production of antagonistic activity in LB medium. The

activity was monitored at 30 ºC.

Figure 24 B. Effect of Temperature on Bacteriocin Activity.

0

200

400

600

800

1000

1200

9.910.010.110.210.310.410.510.610.710.810.911.0

0 2 4 6 8 10

Bacterio

cin (A

U/m

l)log C

FU

/mL

Time (hours)

AU, SSC1407 AU, SSC14011 log, SSC1407 log, SSC14011

0

20

40

60

80

100

-10 10 30 50 70 90 110

Res

idu

al a

ctiv

ity (

%)

Temperature (ºC)

SSC1407 SSC14011

162

Figure 25. Effect of pH on Bacteriocin Activity.

Figure 26. The effect of UV-light on the isolated bacterial strains. Bacteriocin producing

activity after exposure were examined. (zone size, 0-2 mm= minimal activity, 3-5 mm=

moderate activity)

0

20

40

60

80

100

0 2 4 6 8 10 12

Res

idu

al a

ctiv

ity (

%)

pH

SSC1407 SSC14011

0

1

2

3

4

5

0 1 2 3 4 5

Zone

size

(m

m)

Exposure Time (minutes)

SSC1407 SSC14011

163

7.4.4. Purification of Bacteriocin:

Purification step required filtration, centrifugation, ammonium sulphate precipitation and for

final purification, desalting by dialysis. The final recovered proteins along with proteins

present in every subsequent step were quantified and the overall protein activity and %

recovery/yield was calculated. It was observed that the SSC1407 showed low purification

fold (0.10) and yield (0.13%) as compared to SSC14011 that showed high (3.37)

purification fold and (3.28%) yield (Table XXVI).

7.4.5. SDS-PAGE Gel electrophoresis:

Bacteriocins of both of two test cultures were resolved using standard SDS-polyacrylamide

gel electrophoresis. The peptide bands were visualized (Fig. 27). SSC1407 sample showed

multiple light bands in the range of 70-42 kDa. SSC14011 sample showed multiple bands in

the range of 95-29 kDa respectively.

7.4.6. Cytotoxicity Test:

Test bacterial crude extracts in two fold dilutions were analyzed for cytotoxic assay.

Concentrations were determined after pilot ad-Hoc experiment. The premediated experiment

revealed that each concentration exhibited different mortality rates. Increased concentrations

of test extracts rise the mortality rate of brine shrimps. The SSC14011 extract showed high

mortality rate than SSC1407 test extract. The LC50 values with confidence limits 95% were

164

determined by Probit analysis (Table XXVII, XXVIII). Linear correlation was found

between concentration dose (log) and Probit mortality (%). LC50 values for extracts

SSC1407 were 0.052 mg/ml (52.03 ug/ml) and for SSC14011 0.046 mg/ml (46.17 ug/ml)

respectively (Fig. 28, 29). The results indicate that the test extracts were significantly

effective and biologically active as both concentrated extracts were found exhibit lethal

effect.

165

Ta

ble

XX

VI.

Pu

rifi

cati

on

of

bac

teri

oci

n(s

) fr

om

cu

ltu

re s

up

ern

atan

t o

f m

ang

rov

e b

acte

ria.

(Th

e to

tal

acti

vit

y w

as c

alcu

late

d m

ult

iply

ing

sam

ple

vo

lum

e b

y a

ctiv

ity

, to

tal

pro

tein

was

det

erm

ined

by

un

its

ob

tain

ed b

y a

ctiv

ity

ass

ay (

Bra

dfo

rd m

etho

d)

mu

ltip

lied

by

to

tal

vo

lum

e, s

pec

ific

act

ivit

y w

as

exam

ined

by d

ivid

ing

th

e to

tal

acti

vit

y b

y t

ota

l p

rote

in,

pu

rifi

cati

on

fo

ld w

as o

bta

ined

by

div

idin

g t

he

bef

ore

an

d a

fter

val

ues

of

spec

ific

act

ivit

y,

reco

ver

y o

r y

ield

is

the

rem

ain

ing

per

cen

t o

f p

rote

in o

ut

of

the

init

ial

con

cen

trat

ion

o

f p

rote

in

(Og

unb

anw

o,

San

ni

and

O

nil

ud

e,

200

3;

Raj

aram

, M

aniv

asag

an

,

Gu

nas

ekar

an, R

ames

h, A

sho

kk

um

ar, T

hil

agav

ath

i an

d S

arav

anak

um

ar,

20

10

))

166

Figure 27. SDS-PAGE of Dialyzed fractions of test strains. Samples after dialysis with 12

kDa cut off membrane. Test Strains showing multiple bands between the range of 95-29 kDa

respectively.

175

95

130

62

70

42

51

22

29

14

10.5

SSC1407 SSC14011 Std.

kDa

167

Figure 28. Probit analysis plot showing effect of crude extracts of Bacterial Strain SSC1407

on Artemia salina (brine shrimps). 50% mortality is expected at log dose (1.6532) 52.03

g/ml whereas, 90% mortality is expected at (1.9542) 4.4 g/ml of log dose.

168

Figure 29. Probit analysis plot showing effect of crude extract of strain SSC14011 on

Artemia salina. 50% mortality is expected at log dose (1.663) 46.17 g/ml whereas, 90%

mortality is expected at (1.968) 89.51 g/ml of log dose.

169

Table XXVII. Probit analysis of Crude extract of Strain SSC14011.

S.No. Parameters

Statistics log dose g/ml

1) mean 1.66438

median 1.66438

Std Dev 0.224332

Inter Qurtile 0.302619

2) Regression Table

Variable Coefficient Standard Error Z P

Constant -7.42 0.59 -12.68 0.00

log Dose 4.46 0.35 12.79 0.00

3) Goodness-of-Fit Tests

Method Chi-Square DF P

Pearson 1.17 4 0.88

Deviance 1.97 4 0.74

4) Tolerance Distribution

Parameter Estimate Standard

95.0% Normal

CI

Error Lower Upper

Mean 1.66 0.02 1.63 1.70

StDev 0.22 0.02 0.19 0.26

5) Table of Percentiles

Percent Percentile Standard 95.0% CI

Lower Upper

10 1.38 0.03 1.31 1.43

50 1.66 0.02 1.63 1.70

6) 90 1.95 0.03 1.90 2.02

Table of Survival Probabilities

Stress Probability 95.0% Fiducial CI

Lower Upper

0.9 0.99967 0.99830 0.99997

170

Table XXVIII. Probit analysis of Crude extract of Strain SSC1407.

S.No. Parameters

Statistics log dose mg/ml

1) mean 1.71629

median 1.71629

Std Dev 0.168991

Inter

Qurtile 0.227966

2) Regression Table

Variable Coefficient

Standard

Error Z P

Constant -10.16 0.95 -10.71 0.00

log Dose 5.92 0.55 10.83 0.00

3) Goodness-of-Fit Tests

Method Chi-

Square DF P

Pearson 2.92 4 0.57

Deviance 4.28 4 0.37

4) Tolerance Distribution

Parameter Estimate Standard 95.0% Normal CI

Error Lower Upper

Mean 1.72 0.02 1.68 1.75

StDev 0.17 0.02 0.14 0.20

5) Table of Percentiles

Percent Percentile Standard 95.0% CI

Lower Upper

10 1.49971 0.02682 1.43805 1.54605

50 1.71629 0.01683 1.68241 1.7495

90 1.93286 0.02543 1.88869 1.99102

6) Table of Survival Probabilities

Stress Probability 95.0% Fiducial CI

Lower Upper

0.9 1.00000 0.99998 1.00000

171

Marine environments mostly consist of gram negative bacteria (Sattar and Ahmed, 1988)

that are generally halotolerant (Siddiqui, 1990). Amir, Ahmed and Talat, (1993) isolated

some bacterial species from mangrove soils of Pakistan that were found to be halotolerant

and antibiotic resistant. Some were found to be gram negative rods but unlike current

observations, isolates were not identified up to genus or species level. In present research we

examined the productions of bacteriocins by isolates SSC1407 and SSC14011from

mangrove soil associated microbial mat. The bacteriocin activity of bacterial strain may be

due to the presence of peptides, alkaloids and lippopolysaccharides. In present study we

were successfully able to cultivate two isolates reported via 16S rRNA gene sequencing on

LB media. It was observed that the antagonistic substances were proteinaceous in nature.

The overall inhibitory spectrum of both isolates were narrow, as gram negative bacteria

usually exhibit narrow spectrum as compared to gram positive bacteria (Burns and Slater,

1982). Loss of activity was observed at temperatures less than 50ºC indicating that the

metabolite was less heat stable.

It was observed that both metabolites have different characteristics as bacteriocins usually

differ in their antagonistic nature and structures (Sablon, Contreras and Vandamme, 2000).

Both isolates were able to grow in peptone containing medium exhibiting that the

bacteriocin producing cells can grow in a complex medium. Extraction of bacteriocin from

enriched media indicates that both bacteriocins can be recovered from aqueous phase.

Concurring with earlier studies, temperature and pH was found to be one of the significant

factors that influence the bacteriocin production (Noman, Khaleafa and Zaky, 2004;

172

Todorov, Velho and Gibbs, 2004). Antagonistic activity may also be influenced by

physiological factors and test organisms (Schlegel, Doan, de Chazal and Smith, 1998).

The decrease of bacteriocin activity during growth curve experiment indicates that the

bacteriocins are sensitive to extracellular proteases. This may be due to the fragmentary

digestion of metabolites by proteolytic enzymes from native cells (Ghanbari, Rezaei, Sultani

and Hosseini, 2009). The growth curve also revealed that the bacteriocin activity of both

strains SSC1407 and SSC14011 were observed during stationary phase indicating that the

antagonistic substances are secondary metabolic products. Both bacteriocins of present

research are able to tolerate extreme saline conditions as they were isolated from mangrove

area having salinity usually ranging from 28 to 43 PSU. The UV- exposure experiment

suggested that the bacteriocins of both isolates were not inducible and exhibited tolerance to

radiations. This concur with earlier studies revealing that marine associated bacteria usually

remain uninduced (Hescox and Carlberg, 1972; Meseguer and Rodriguez, 1985; Pirzada,

Nasir and Rasool, 2000). The protein purification steps resulted in loss of concentration of

protein content. The distilled water dialysis buffer was more efficient against SSC1407 than

SSC14011. The highest recovery was achieved during precipitation via ammonium sulphate

which are in agreement with the studies of Ivanova, Kabadjova, Pantev, Danova and

Dousset (2000) and Ogunbanwo, Sanni and Onilude (2003). Brine shrimp lethality tests

revealed that the isolate’s extracts were biologically active.

173

The phylogenetic trees were constructed using the strains sequences, isolate SSC1407 was

placed in a broad cluster comprising of all Proteus species supported by a high bootstrap

value of 99% to previously reported Proteus sp. clone W60, JF733467.1 isolated from

wetland area and it is sulphate reducing and aluminum degrading in nature (Martins,

Taborda, Silva, Assunção, Matos and Costa, 2012) (Fig. 30).

Whereas, isolate SSC14011 was situated with Klebsiella pneumoniae strain in phylogenetic

tree, separated by a boot strap value of 92% earlier reported as K. pneumoniae CCFM8368

that can utilize lactose and is associated with human gastrointestinal system (Mao, Li, Zhao,

Liu, Gu, Chen, Zhang and Chen, 2014) (Fig.31). Our both observed isolates did not match

100% with any of the sequences of Gene bank. This indicates that these cultures were

unidentified bacteria that are present in mangrove associated microbial mat under polluted

conditions.

174

Figure 30. Neighbour joining phylogenetic tree (upper) and fast minimum evolution tree

(lower) based on 16S r RNA gene sequence of isolated SSC1407 bacterial strain. Bootstrap

probability values of > 90% are showing by green colour. Yellow dots indicates limited

identification of bacterial. Scale bars indicates substitutions per nucleotide position.

175

Figure 31. Neighbour joining phylogenetic tree (upper) and fast minimum evolution tree

(lower) based on 16S r RNA gene sequence of isolated SSC14011 bacterial strain. Bootstrap

probability values of > 90% are showing by green colour it also represents

enterobacteriaceae. Yellow indicates limited identification of bacteria and blue dots

indicates unknown sequences. Scale bars indicates substitutions per nucleotide position.

SSC14011

176

Recent study conducted on mangrove bacteria by Sakhia, Prajapati, Shetty, Bhatt and

Bhadalkar, (2016) observed bacteria that also belong to family of our isolates indicating they

are commonly found in mangrove area. Similar to earlier studies (Sakhia, Prajapati, Shetty,

Bhatt and Bhadalkar, 2016), we also observed that the 16S rRNA gene sequencing was

primary method that can confirm genus level identification. We observed that biochemical

tests and molecular tools work hand in hand and are relevant for conclusive examination of

environmental samples. The strain SSC1407 that was isolated in current experiment

corresponded morphologically to genus that is commonly found in most ecosystems.

Proteus are some of the most abundant bacteria which successfully colonize versatile soil

substrates. Bacteria related to genus Proteus are ubiquitous in nature and are present in soil

and water and are found to produce enzymes L-asparaginase and α-amylase which are used

for chemotherapeutic purposes and ethanol, corn syrup, sugar production (Sudha, 2009;

Oseni and Ekperigin, 2013). The polluted mangrove habitat adaptations might have resulted

in genetic and may be in biochemical modifications that are reported in present study. This

also suggests that these isolates are one of the hardiest bacteria that can survive under

extreme conditions. Proteus sp. isolated form Niger delta, Nigeria was found to be among

hydrocarbon utilizing bacteria (Benka-Coker and Ekundayo, 1997). Strains belonging to

genus Proteus were also isolated from mangrove water and soil of Paraiba do Norte, Brazil

(Grisi and Gorlach, 2010).

The second isolate SSC14011 was closely related to Klebsiella species that are conventional

enteric halobacteria (Gilmour, 1990). Genus Klebsiella is commonly found in mangrove

soils (Sen and Naskar, 2003). Klebsiella sp. present in mangrove soils also possess bio-

177

surfactant properties (Saimmai, Tani, Sobhon and Maneerat, 2012). The Klebsiella

pneumoniae isolates from anthropogenically compromised mangrove forests (similar to our

Sandspit study area) have been reported from Mattang Malaysia (Ghaderpour, Nasori,

Chew, Chong, Thong and Chai, 2014). Swarnakumar, Thangaradjou, Sivakumar, Kannan,

(2007) and Ashokkumar, Rajaram, Manivasagan, Ramesh, Sampathkumar and Mayavu,

(2011) reported Klebsiella pneumoniae from Indian Muthupettai and Nicobar mangroves

respectively. This organism is commonly found in water, soil and human gastrointestinal

tract (Aissani, Messai, Alouache and Bakour, 2013). It is associated with fauna and

halophytic plants such as Salicornia bigelovii and can fix nitrogen in saline ecosystem

(Sengupta and Chaudhuri, 1990; Rueda‐Puente, Castellanos, Diéguez, Alvarez, and Amador,

2003). Jalal, Mardiana, Shahbudin and Omar, (2010) observed various bacterial strains from

mangrove soil, among them Klebsiella pneumoniae was found to be resistant against

different antibiotics. Klebsiella pneumoniae from mangrove soil can also degrade glycerol to

1,3-propanediol which is used in polymer industry (Zhou, Li, Wei and Qin, 2013).

Bacteriocin associated treatment is relatively cost effective, non-toxic and ecofriendly and

can be considered as an alternative for management of certain disease control (Miles, Lesser

and Sears, 1992; De Oliveira, Abrantes, Cardoso, Sordelli and Bastos, 1998). As bacteria

can develop resistance against conventional bacteriocins (Rasch and Knöchel, 1998; van

Schaik, Gahan and Hill, 1999), the search for novel antibacterial metabolites or antagonistic

substances is always significant. Present knowledge related to isolates will contribute

towards detailed experimentations for natural antibiotics. As the tests were performed using

crude extracts, presences of other antibacterial and antifungal compounds cannot be ruled

178

out. Further studies are required to observe the protein structures and effect of other possible

factors (such as media composition) on the production of these biocontrol substances against

other clinical/environmental bacterial, fungal and yeast strains. The isolated strains could be

further developed to produce more effective bacteriocins against gram negative

enterobacteria.

179

PART IV

GENERAL DISCUSSION

180

Mangrove forests are halophilic, highly productive, ecologically and commercially

significant ecosystems (Walters, Rönnbäck, Kovacs, Crona, Hussain, Badola, Primavera,

Barbier and Dahdouh, 2008). These forests are sometimes sole habitat for fishes and other

crustaceans (Brown, 1997; Nagelkerken, Blaber, Bouillon, Green, Haywood, Kirton,

Meynecke, Pawlik, Penrose, Sasekumar and Somerfield, 2008) and provides sanctuary to

variety of migratory and non-migratory animals (Field, 1998). All these facts lead to the

following study to investigate native forests. In Pakistan, mangrove forests of Sandpit have

been studied in past for various aspects. The present research augments to scientific data

associated with this mangrove area. Microbial mat contributes nutrients to adjacent systems

in terms of biogeochemical cycling (Bouillon, Moens, Overmeer, Koedam and Dehairs,

2004; Visscher and Stolz, 2005). The nutrients are an essential component (Lovelock and

Feller, 2003; Alongi, Clough and Robertson, 2005) and microbial organisms are key group

responsible for most of these nutrient flux cycles and decomposition of carbon based content

(Holguin, Vazquez and Bashan, 2001; Cherif and Loreau, 2009). Concurring with the

research of Cowan and Boynton, (1996) and Friedrich, Dinkel, Friedl, Pimenov, Wijsman,

Gomoiu, Cociasu, Popa and Wehrli, (2002), the seasonal variations in nutrient content were

also observed in present study. The mean average nutrient values of the Sandspit mangrove

backwaters were similar to median figures Indonesian mangrove study of Moll, (2011).

Overall It was estimated that during monsoon season there were lower rates of release or

export of nutrients (Table VIII). This concur with earlier works of Robertson, Alongi and

Boto, (1992) and Moll, (2011). It was observed that the cyclone ‘Nanauk’ in the year 2014

which devastated the mangrove area, also influenced the nutrient levels. The samples

collected before the storm showed increased nutrient levels (Table XII) as compared to

181

samples after the storm (Table VII). Even after the recolonization, the levels were still not

similar as before. Another thunderstorm ‘Nilofar’ was also reported in the late October of

2014, but comparatively did not cause much damage.

Sultana and Mustaquim (2003) conducted a survey of physico-chemical properties and grain

size analysis of sandspit area in 1988. The current mean average salinity, temperature, DO

and grain size ratios are similar to earlier observations. But the mean pH values have

increased from 7.6 to 8.4 and the organic carbon content is decreased form average 8.32% to

<2%. This may be due to increased pollution that has minimized the faunal population and

as a result lowered the average carbon content over the years. The analysis of sand spit

mangrove soil revealed steady conditions for potential nitrification. There was a direct

relationship between soil texture and other physical and chemical parameters with soil

associated microbial mat (Rietz and Haynes, 2003; Sardinha, Müller, Schmeisky and

Joergensen, 2003; Stolz, 2003; Müller and Höper, 2004). Recent study conducted by

Kirwan and Mudd, (2012) revealed that the fluxes of organic material mainly carbon are

dependent on two factors, first the climate change that favors top soil vegetation and second,

the sea level rise which increase burial space thus increasing carbon rates in sediments. The

presence of mat along with invertebrate activity such as fiddler crabs transforms the highly

saline, loose, dry soil into lesser saline, compact, wet, aerated soil (Smith, Boto, Frusher and

Giddins, 1991; author observation) that pave a way for advancement and increase efficacy in

mangrove sediment such as sediment trapping up to 40-80% (Furukawa, Wolanski and

Mueller, 1997; Kitheka, Ongwenyi and Mavuti, 2002; Victor, Golbuu, Wolanski and

Richmond, 2004) and water movement (Mazda and Ikeda, 2006). This as a result, structures

182

a favorable habitat for associated flora and fauna (Guadrado, Carmona and Bournod, 2011).

It is imperative to find out more factors that might influence the nutrient rates and soil

characteristics.

The microbial mat consists of variety of cyanobacterial and diatoms strains which give mat

its green or brown colour (Stal, van Gemerden and Krumbein, 1985; Pierson, Oesterle and

Murphy, 1987). The population and abundance of species affects the colour intensity of

microbial mat. Filamentous cyanobacteria were most abundant (author unpublished data).

The community structure was somewhat similar to Kerala mangrove forests of India

described by Rejil, (2012). Culture independent methods used in the experiments of Stolz,

(1983), Ram, VerBerkmoes, Thelen, Tyson, Baker, Blake, Shah, Hettich and Banfield,

(2005), Ley, Harris, Wilcox, Spear, Miller, Bebout, Maresca, Bryant, Sogin and Pace,

(2006) and Bachar, Omoregie, Wit and Jonkers, (2007) must be used in future to fully

observe the diversity of microbial mat studied site. The Sandspit mat related bacteria and

cyanobacteria were primary members along with others organisms (Castenholz, 2001;

Noffke, Knoll and Grotzinger, 2002). They were found to be hardy microbes and as

substances from natural sources are significant component of miscellany pharmaceutics,

research in this direction may lead to new bioactive substances. Several studies have

assessed antagonistic potential of cyanobacteria from marine source (Burja, Banaigs, Abou,

Burgess and Wright, 2001; Kelecom, 2002; Berdy, 2005; Tan, 2007; Gademann and

Portmann, 2008; Bhatnagar and Kim, 2010; Nunnery, Mevers and Gerwick, 2010; Tan,

2010). Present investigation revealed that secondary metabolites of mangrove associated

183

bacteria (gram negative) and cyanobacteria were found to be antimicrobial and Cytotoxic in

nature.

One of the reasons Cyanobacterial metabolite exhibited active inhibition, may be owing to

similarity with gram negative bacteria (Mundt, Kreitlow, Nowotny and Effmert, 2001;

Dahms, Xu and Pfeiffe, 2006). The antagonistic effect against Candida albicans favors

earlier suggestions that these cyanobacterial extracts serves the purpose of defense against

outer environment (Piccardi, Frosini, Tredici and Margheri, 2000; Bhadury and Wright,

2004) and were found to exhibit antifungal activity (Soltani, Khavari, Yazdi, Shokravi and

Fernandez, 2005; Kim, 2006; Pawar and Puranik, 2008). Current investigation revealed that

filamentous form of cyanobacteria may exert more toxic effect. This was similar with the

study of Lopes, Fernández, Martins and Vasconcelos, (2010) where, filamentous

Leptolyngbya and Microcoleus from estuarine waters were found to have most toxic

extracts. As ethanolic extract showed strong antagonistic activity, therefore mid to low

polarity enzymatic and fatty acid assessment are recommended. Furthermore, molecular

assessment is required in future to understand the overall bioactivity of these strains.

Like bacteria (which produce peptide that can be either bacteriostatic or bactericidal in

nature (Cleveland, Montville, Nes and Chikindas, 2001)), marine cyanobacteria also

produce metabolites that were cytotoxic in nature and may be used for innovative drugs

(Dunlap, Battershill, Liptrot, Cobb, Bourne, Jaspars, Long and Newman, 2007). Brine

shrimp lethality test was conducted for both cyanobacterial and cyanobacterial extracts

because it was inexpensive and there were no ethical restrictions associated with this test

184

(Sánchez-Fortún, Sanz and Barahona, 1996; Caldwell, Bentley and Olive, 2003; Jaiswal,

Singh and Prasanna, 2008). Also, it serves as a basic screening tool for preliminary

assessment of ecological, biological and chemical substances (Carballo, Hernández, Pérez

and García, 2002; Nunes, Carvalho, Guilhermino and Van Stappen, 2006; Abourashed,

2010). In future, cytotoxicity of crude extracts to mammalian cell lines are recommended as

the test solely on brine shrimp may not reveal the true potency against human cells (Hisem,

Hrouzek, Tomek, Tomšíčková, Zapomělová, Skácelová, Lukešová and Kopecký, 2011).

Presence of versatile bacteria in mangrove environment is very common. As compared to

other mangrove flora and fauna studies, observations related to mangrove bacteria are

relatively low. Earlier studies on Karachi coast including Sandspit mangrove areas reported

bacteria belonging to genus Pseudomonas, Micrococcus, Methanococcus, Staphylococcus,

Salmonella, Marinococcus and Bacilli (Zubari, 1986; Ahmed and Yasmin, 1988; Amir,

Ahmed and Talat, 1993). Some of them were extreme halotolerant and resistant to common

antibiotics. Now years later in 2016, the presence of enterobacteriaceae in mangrove soil of

same locality indicates increased levels of pollution stress caused mainly by anthropogenic

factors.

Two of the previously uncultured bacteria (SSC1407 and SSC14011) were found to exhibit

antagonistic activity against two common clinical strains (E. coli and Proteus O). The 16S

rRNA gene sequencing is among modern molecular tools to identify unknown mangrove

bacterial strains at least up to genus level (Sakhia, Prajapati, Shetty, Bhatt and Bhadalkar,

2016). It was observed that our isolates belong to genus Proteus (SSC1407) and Klebsiella

185

(SSC14011) which are also pathogenic in nature and were found in polluted areas

(Swarnakumar, Thangaradjou, Sivakumar and Kannan, 2007). They were insensitive to

increased salinity, pH, radiations and chemical solvents. Bacterial extracts were more active

against clinical strain whereas, cyanobacterial strain were effective against yeast strain.

During the initial screening process, no gram positive bacterial strain was effective against

any clinical or environmental culture this may be due to the fact that gram positive is less

resistant than gram negative bacteria (Taton, Grubisic, Ertz, Hodgson, Piccardi, Biondi,

Tredici, Mainini, Losi, Marinelli and Wilmotte, 2006; Volk and Furkert, 2006; Martins,

Ramos, Herfindal, Sousa, Skarven and Vasconcelos, 2008). The gram negative bacteria

possess lippopolysaccharides on outer membrane which makes these microbes resistant to

foreign toxic substances (Martins, Ramos, Herfindal, Sousa, Skarven and Vasconcelos,

2008). Due to constant exposure to extreme environment, these type of bacteria become

hardy enough to breakdown complex pollutant into simpler forms (Martins, Taborda, Silva,

Assunção, Matos, and Costa, 2012). All these characteristics can help in experimental

engineering of organisms for environmental cleanup or as antibacterial and antifungal

agents. On the other hand, continuous presence may potentially transmit these organisms

into benthic and pelagic sites and incorporate into food chain. This leads to contaminated

fisheries and may permanently compromise the water quality. Consumption of such fish

food could cause serious illness in humans. By regularly observing soil and microbial mat

associated bacteria, we can observe the soil status, identify potential pathogens and

determine microbial pollution level.

186

Although mangroves have been found to remove pollutants from anthropogenic sources

(Tam and Wong, 1993), extreme stress caused by pollution limits this potential. It was

estimated that pollution stress leads to loss of almost 50,000 ha of Pakistani mangrove

forests (Damhoureyeh and Ghalib, 2014). Sandspit mangroves are among highly polluted

areas of Pakistan coast (Chan, Ibrahim, Saeed, Siddiqui, Zafar and Rasheed, 2016) and the

adverse effect was evident in terms of low number of species and presence of mainly

pollution tolerant flora (Yasmeen, Shafique, Zaib un Nisa and Siddiqui, 2016). This was also

true for fauna close to forest floor, only invertebrates such as fiddler and mud crabs, slugs,

some gastropods mainly Cerithideopsilla cingulate and Telescopium sp. (Shafique, 2004;

Shafique, Siddiqui and Farooqui, 2015), sponge, mudskippers and small school of fish (that

swim along with the tide) were evidently observed during the four-year study period. On

microscopic scale, nutrient enrichment due to anthropogenic factors may also lead to

increased rates of decomposition and negatively influence primary producers (Hessen,

Ågren, Anderson, Elser and De Ruiter, 2004). Remote sensing study of Sandspit area

conducted by Rehman, Khanum and Kazmi, (2016) revealed that the Sandspit area is under

serious threat of climate change and factors such sea water intrusion, reduced fresh water

input, low rainfall and storms stimulate degradation of this site and enhance risk levels. To

prevent this site from further destruction and maintain ecological balance, rigorous planning

for environmental cleanup is urgently required. These investigations basically cover the base

line data of Sandspit mangrove area. Further long term investigations are required to closely

observe more nutrient levels and fully explore new substances that might be ecologically or

pharmaceutically applicable.

187

PART V

REFERENCES

188

Abbas, G. (2002). Growth, Feed Conversion, and Body Composition of Juvenile Mangrove

Red Snapper, Lutjanus argeniimaculatus (Pisces, Lutjanidae) Reared in Concrete

Tanks (Doctoral dissertation). Centre of Excellence in Marine Biology, University of

Karachi, Pakistan.

Abbas, G. and Siddiqui, P. J.A. (2003). Effect of feeding rate on growth, feed conversion

and body composition of juvenile mangrove red snapper reared in seawater tanks.

Pakistan Journal of Zoology, 35(2), 151-156.

Abbas, G. and Siddiqui, P. J. (2009). Effects of different feeding level on the growth, feed

efficiency and body composition of juvenile mangrove red snapper, Lutjanus

argentimaculatus (Forsskal, 1775). Aquaculture Research, 40(7), 781-789.

Abbas, G., Siddiqui, P. J., and Jamil, K. (2011). The optimal protein requirements of

juvenile mangrove red snapper, Lutjanus argentimaculatus fed isoenergetic diets.

Pakistan Journal of Zoology, 44(2), 469-480.

Abbas, S., Mueen, Q. F., Ghaffar, A. N. K. T., Khurram, S. R. S. and Gilani, H. (2013). An

Assessment of status and distribution of mangrove forest cover in Pakistan. Journal

of Biodiversity and Environmental Sciences, 3(6), 64-78.

Abbas, S., Qamer, F. M., Hussain, N., Saleem, R. and Nitin, K. T. (2011, September).

National level assessment of mangrove forest cover in Pakistan. In: Workshop

Proceedings Earth Observation for Terrestrial Ecosystem, 187-192.

Abbasi, M. K., Shah, Z. and Adams, W. A. (2001). Mineralization and nitrification

potentials of grassland soils at shallow depth during laboratory incubation. Journal

of Plant Nutrition and Soil Science, 164(5), 497-502.

Abd, G. H., Zaki, N. H. and Merthad, A. S. (2015). The effect of some extracted compounds

from the algae Oscillatoria tenius against pathogenic bacteria. Journal of

Pharmaceutical and Scientific Innovation, 4(1), 36-39.

Abed, R. M., Golubić, S., Garcia-Pichel, F., Camoin, G. and Lee, S. J. (2003). Identity and

speciation in marine benthic cyanobacteria: The Phormidium-complex. Algological

Studies, 109(1), 35-56.

189

Abed, R. M., Dobrestov, S., Al-Kharusi, S., Schramm, A., Jupp, B. and Golubic, S. (2011).

Cyanobacterial diversity and bioactivity of inland hypersaline microbial mats from a

desert stream in the Sultanate of Oman. Fottea, 11(1), 215-224.

Abourashed, E. A. (2010). Book Review of Bioactive Natural Products− Detection,

Isolation, and Structural Determination. Journal of Natural Products, 73(8), 1460-

1460.

Acreman, J. (1994). Algae and cyanobacteria: isolation, culture and long-term maintenance.

Journal of Industrial Microbiology and Biotechnology, 13(3), 193-194.

Adeel, Z. and Pomeroy, R. (2002). Assessment and management of mangrove ecosystems in

developing countries. Trees, 16(2-3), 235-238.

Adhikari, B., Baig, S. P. and Iftikhar, U. A. (2010). The use and management of mangrove

ecosystems in Pakistan. The Journal of Environment and Development, 19(4), 446-

467.

Ahmad, M. (1997). Natural and human threats to biodiversity in the marine ecosystem of

coastal Pakistan. In: Coastal zone management imperative for maritime developing

nations, Springer Netherlands, 319-332.

Ahmad, S., Iqbal, A. and Rasool, S. A. (2003). Bacteriocin-like inhibitory substances (BLIS)

from indigenous clinical streptococci: Screening, activity spectrum and biochemical

characterization. Pakistan JournaL of Botany, 35(4), 499-506.

Ahmed, N. and Yasmeen, A. (1988). Isolation, Characterization and Genetic studies of

Marine Bacteria. In: Marine sciences of Arabian Sea, Thompson, M.F. and Trimizi,

N.M. (Eds.), AIBS, Washington, U.S.A. 485-492.

Ahmed, N., Jamil, N., Khan, O.Y., Yasmeen, S., Haq, -U., Z., Ahmed, V. and Rahman, A.

(2000). Commercially important products from marine bacteria: Marine

biotechnology. In: Proceedings of national ONR symposium on Arabian sea as a

resource of biological diversity. 104-114.

Ahmedani, M. A., Yasmin, S., Arain, M. A., Shah, K. H., Abro, H. and Nahyoon, M. A.

(2007). Effect of bactericidal plants treatments on urea hydrolysis and nitrification in

190

soils of different cropping histories. part-2. nitrification. Pakistan Journal of Botany,

39(7), 2673-2680.

Aissani, E.-F.R., Messai, Y., Alouache, S. and Bakour, R. (2013). Virulence profiles and

antibiotic susceptibility patterns of Klebsiella pneumoniae strains isolated from

different clinical specimens. Pathologie Biologie, 61(5), 209-216.

Alfaro, A.C. (2006). Benthic macro-invertebrate community composition within

mangrove/seagrass estuary in northern New Zealand. Estuarine and Coastal Shelf

Sciences, 66, 9-10.

Ali, R., Iqbal, J., Tahir, G. R. and Mahmood, T. (2008). Effect of 3, 5-dimethylpyrazole and

nitrapyrin on nitrification under high soil temperature. Pakistan Journal of Botany,

40(3), 1053-1062.

Ali, R., Kanwal, H., Iqbal, Z., Yaqub, M., Khan, J. A. and Mahmood, T. (2012). Evaluation

of some nitrification inhibitors at different temperatures under laboratory conditions.

Soil Environment, 31(2), 134-145.

Ali, Z., Arshad, M. and Akhtar, M. (2003). Biological analysis of Mekran coastal wetlands

complex, Pakistan. Proceedings Pakistan Congress of Zoology, 23, 99-140.

Allen, D., Dalal, R.C., Rennenberg, H. and Schmidt, S. (2010). Seasonal variation in nitrous

oxide and methane emissions from subtropical estuary and coastal mangrove

sediment, Australia. Plant Biology, 13, 126-133.

Alongi, D. M. (1989). The role of soft-bottom benthic communities in tropical mangrove

and coral reef ecosystems. CRC Critical Review in Aquatic Sciences-pages: 1: 243-

280.

Alongi, D. M., Boto, K. G. and Tirendi, F. (1989). Effect of exported mangrove litter on

bacterial productivity and dissolved organic carbon fluxes in adjacent tropical

nearshore sediments. Marine ecology progress series. Oldendorf, 56(1), 133-144.

Alongi, D. M., Boto, K. G. and Robertson, A. I. (1992). Nitrogen and phosphorus cycles.

Tropical Mangrove Systems, 251–292.

191

Alongi, D. M., Boto, K. G. and Robertson, A. I. (1993). Nitrogen and phosphorus cycles.

American Geophysical Union. 251-292.

Alongi, D. M. (1994). The role of bacteria in nutrient recycling in tropical mangrove and

other coastal benthic ecosystems. In Ecology and Conservation of Southeast Asian

Marine and Freshwater Environments including Wetlands (pp. 19-32). Springer

Netherlands.

Alongi, D. M. (1996). The dynamics of benthic nutrient pools and fluxes in tropical

mangrove forests. Journal of Marine Research 54, 123–148.

Alongi, D., Trott, L., Wattayakorn, G. and Clough, B. (2002). Below-ground nitrogen

cycling in relation to net canopy production in mangrove forests of southern

Thailand. Marine Biology, 140(4), 855-864.

Alongi, D. M., Sasekumar, A., Chong, V. C., Pfitzner, J., Trott, L. A., Tirendi, F., Dixon, P.

and Brunskill, G. J. (2004). Sediment accumulation and organic material flux in a

managed mangrove ecosystem: estimates of land–ocean–atmosphere exchange in

peninsular Malaysia. Marine Geology, 208(2), 383-402.

Alongi, D.M., Clough, B.F. and Robertson, A.I. (2005). Nutrient-use efficiency in arid-zone

forests of the mangroves Rhizophora stylosa and Avicennia marina. Aquatic Botany,

82, 121-131.

Alongi, D.M. (2007). The contribution of mangrove ecosystems to globalcarbon cycling and

greenhouse gas emissions. In: Tateda, Y., Upstill-Goddard, R., Goreau, T., Alongi,

D., Nose, A., Kristensen, E. and Wat-tayakorn, G. (Eds.), Greenhouse Gas and

Carbon Balances in Mangrove Coastal Ecosystems. Maruzen, Tokyo, 1–10.

Alongi, D.M. and Carvalho, N.A. (2008). The effect of small-scale logging on stand

characteristics and soil biogeochemistry in mangrove forests of Timor Leste. Forest

Ecology and Management, 255, 1359-1366.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J. (1990). Basic local

alignment search tool. Journal of molecular biology, 215(3), 403-410.

Amin, M. and Flowers, T. H. (2004). Effect of two applications of substrate on nitrification

and pH of soils. Journal of Research Sciences. 15(3), 263-269.

192

Amir, R., Ahmed, N. and Talat, M. (1993). Salt-tolerance in mangrove soil bacteria.

Pakistan Journal of Marine Sciences, 2(2), 129-135.

Amjad, A. S. and Kamaruzaman, J. (2007). Mangrove Conservation through Community

Participation in Pakistan: The Case of Sonmiani Bay. International Journal of

Systems Applications, Engineering and Development, 1(4).

Amjad, A. S., Kasawani, I. and Kamaruzaman, J. (2007). Degradation of Indus delta

mangroves in Pakistan. International Journal of Geology, 3(1), 27-34.

Anand, T.P., Bhat, A.W., Shouche, Y.S., Roy, U., Siddharth, J. and Sarma, S.P. (2006).

Antimicrobial activity of marine bacteria associated with sponges from the waters off

the coast of South East India. Microbiological research, 161(3), 252-262.

Andersen, F. Ø. and Kristensen, E. (1988). The influence of macrofauna on estuarine

benthic community metabolism: a microcosm study. Marine Biology , 99, 591-603.

Andersen, M. and Kristensen, E. (2002). The importance of bacteria and microalgae in the

diet of the deposit feeding polychaete Arenicola marina. Ophelia, 56, 179-196.

Andersen, R.A. and Kawachi, M. (2005). Traditional microalgae isolation techniques. In

,Algal culturing techniques, Andersen, R.A. (Ed.). Physological Society of America׃

Elsevier academic Press, 83-100.

Aniket, K. (2012). Extraction of proteins by a two solvent method, U.S. Patent No.

US8211309 B2. Heliae Development, LlcWashington, DC: U.S. Patent and

Trademark Office.

AOAC. (1970). Official methods of analysis. Association of Official Analytical Chemists.

11th Ed.

Ara, I., Kudo, T., Matsumoto, A., Takahashi, Y. and Omura, S. (2007). Nonomuraea

maheshkhaliensis sp. nov., a novel actinomycete isolated from mangrove rhizosphere

mud. The Journal of general and applied microbiology, 53(3), 159-166

Ashokkumar, S., Rajaram, G., Manivasagan, P., Ramesh, S., Sampathkumar, P. and

Mayavu, P. (2011). Studies on hydrographical parameters, nutrients and microbial

193

populations of mullipallam creek in muthupettai mangroves (southeast coast of

India). Research Journal of Microbiology, 6(1), 71.

Asmus, R. M., Sprung, M. and Asmus, H. (2000). Nutrient fluxes in intertidal communities

of a South European lagoon (Ria Formosa)–similarities and differences with a

northern Wadden Sea bay (Sylt-Rømø Bay). Hydrobiologia, 436(1-3), 217-235.

Ayub, Z. and Muzammil, A. (2002). Distribution and Abundance of Penaeid Shrimp

Juveniles in the Backwaters and Creeks Along the Coast of Sindh. Pakistan Journal

of Zoology, 34(1), 19-28.

Aziz, I. and Khan, M. A. (2000). Physiological adaptations to seawater concentration in

Avicennia marina from Indus delta, Pakistan. Pakistan Journal of Botany, 32, 151-

170.

Aziz, I., and Ajmal, M. (2001). Seasonal variation in ecophysiology of Avicennia marina

populations growing in polluted Arabian sea coast around Karachi. Pakistan Journal

of Botany, 33(4), 429-441.

Bachar, A., Omoregie, E., de Wit, R. and Jonkers, H.M. (2007). Diversity and function of

Chloroflexus-like bacteria in a hypersaline microbial mat: phylogenetic

characterization and impact on aerobic respiration. Applied and environmental

microbiology, 73(12), 3975-3983.

Badola, R. and Hussain, S. A. (2003). Valuation of the Bhitarkanika mangrove ecosystem

for ecological security and sustainable resource use. Study report. Wildlife Institute

of India, Dehra Dun.

Baig, M. B., Ahmad, S., Khan, N., Ahmad, I. and Straquadine, G. S. (2008). The history of

social forestry in Pakistan: An overview. International Journal of Social Forestry,

1(2), 167-183.

Baig, S. P. and Iftikhar, U. A. (2010). Are the Mangroves for the Future? Empirical

evidence of the value of Miani Hor Mangrove Ecosystem as the basis for

investments. IUCN. Karachi.

Bandaranayake, W. M. (1998). Traditional and medicinal uses of mangroves. Mangroves

and salt marshes, 2(3), 133-148.

194

Banerjee, D., Chakrabarti, S., Hazra, A. K., Banerjee, S., Ray, J. and Mukherjee, B. (2008).

Antioxidant activity and total phenolics of some mangroves in Sundarbans. African

journal of biotechnology, 7(6).

Bano, A. and Siddiqui, P. J. A. (2003). Intertidal cyanobacterial diversity on a rocky shore at

Buleji near Karachi, Pakistan. Pakistan Journal of Botany, 35(1), 27-36.

Bano, A. and Siddiqui, P. J. A. (2004). Characterization of five marine cyanobacterial

species with respect to their pH and salinity requirements. Pakistan Journal of

Botany, 36(1), 133-144.

Bano, A. and Siddiqui, P. J. A. (2015). A Preliminary Report on Diazotrophic Ability of

Marine Cyanobacterial Isolates in Laboratory Conditions. Lasbela, University

Journal of Science and Technology, 4, 172-176.

Bano, N., Nisa, M. U., Khan, N., Saleem, M., Harrison, P. J., Ahmed, S. I. and Azam, F.

(1997). Significance of bacteria in the flux of organic matter in the tidal creeks of the

mangrove ecosystem of the Indus River delta, Pakistan. Marine Ecology Progress

Series, 157, 1-12.

Barbarino, E., and Lourenço, S. O. (2005). An evaluation of methods for extraction and

quantification of protein from marine macro-and microalgae. Journal of Applied

Phycology, 17(5), 447-460.

Barbier, E. B., Hacker, S. D., Kennedy, C., Koch, E. W., Stier, A. C. and Silliman, B. R.

(2011). The value of estuarine and coastal ecosystem services. Ecological

Monographs, 81(2), 169-193.

Barefoot, S.F. and Klaenhammer, T.R. (1983). Detection and activity of lactacin B, a

bacteriocin produced by Lactobacillus acidophilus. Applied and Environmental

microbiology, 45(6), 1808-1815.

Barkati, S. and Tirmizi, N. M. (1987). Population structure and some aspects of the breeding

behaviour of three gastropod species from Karachi mangroves. Pakistan Journal of

Scientific and Industrial Research, 30(7), 539-544.

Barkati, S. and Rahman, S. (2005). Species composition and faunal diversity at three sites of

Sindh mangroves. Pakistan Journal of Zoology, 37(4), 17.

195

Bartoli, M., Nizzoli, D. and Viaroli, P. (2003). Microphytobenthos activity and fluxes at the

sediment-water interface: interactions and spatial variability. Aquatic Ecology, 37(4),

341-349.

Beck, M. W., Heck Jr, K. L., Able, K. W., Childers, D. L., Eggleston, D. B., Gillanders, B.

M., Hughes, A.R., Kendrick, G.A., Kenworthy, W.J., Olyarnik, S. and Weinstein, M.

P. (2001). The identification, conservation, and management of estuarine and marine

nurseries for fish and invertebrates: A better understanding of the habitats that serve

as nurseries for marine species and the factors that create site-specific variability in

nursery quality will improve conservation and management of these areas.

Bioscience, 51(8), 633-641.

Becks, L., Hilker, F. M., Malchow, H., Jürgens, K. and Arndt, H. (2005). Experimental

demonstration of chaos in a microbial food web. Nature, 435(7046), 1226-1229.

Behera, B. C., Singdevsachan, S. K., Mishra, R. R., Sethi, B. K., Dutta, S. K. and Thatoi, H.

N. (2016). Phosphate Solubilising Bacteria from Mangrove Soils of Mahanadi River

Delta, Odisha, India. World Journal of Agricultural Research, 4(1), 18-23.

Belser, L. W. and Mays, E. L. (1980). Specific inhibition of nitrite oxidation by chlorate and

its use in assessing nitrification in soils and sediments. Applied and environmental

microbiology, 39(3), 505-510.

Benfield, A. (2014). Annual global climate and catastrophe report, impact forecasting 2014.

Benincà, E., Huisman, J., Heerkloss, R., Jöhnk, K.D., Branco, P., Van Nes, E.H., Scheffer,

M. and Ellner, S.P. (2008). Chaos in a long-term experiment with a plankton

community. Nature, 451(7180), 822-825.

Benka-Coker, M. O. and Ekundayo, J. A. (1997). Applicability of evaluating the ability of

microbes isolated from an oil spill site to degrade oil. Environmental Monitoring and

Assessment, 45(3), 259-272.

Berdy, J. (2005). Bioactive microbial metabolites. Journal of Antibiotics, 58(1), 1.

Berg, P. and Rosswall, T. (1987). Seasonal variations in abundance and activity of nitrifiers

in four arable cropping systems. Microbial ecology, 13(1), 75-87.

196

Berglind, L., Johnsen, I. J., Ormerod, K. and Skulberg, O. M. (1983). Oscillatoria brevis

(Kutz.) Gom. and some other especially odouriferous benthic cyanophytes in

Norwegian inland waters. Water Science and Technology, 15(6-7), 241-246.

Bhadury, P. and Wright, P.C. (2004). Exploitation of marine algae: biogenic compounds for

potential antifouling applications. Planta, 219(4), 561-578.

Bhatnagar, A., Makandar, M.B., Garg, M.K. and Bhatnagar, M. (2008). Community

structure and diversity of cyanobacteria and green algae in the soils of Thar Desert

(India). Journal of Arid Environment, 72, 73-83.

Bhatnagar, I. and Kim, S. K. (2010). Immense essence of excellence: Marine microbial

bioactive compounds. Marine drugs, 8(10), 2673-2701.

Bhatt, D., Khushboo J. and Maitreyi Z. (2016). Cytotoxicity Screening of the Commonly

Used Indigenous Medicinal Plants Using Brine Shrimp Lethality Bio-Assay.

International Journal of Pharmaceutical Sciences Review and Research, 37(2), 147-

150.

Bhavsar, D.O., Jasrai, Y.T., Pandya, H.A., Singh, V. and Patel, A. (2014). Monitoring

Mangrove Status using Remote Sensing and Geo-informatics in Piram Island, Gulf

of Khambhat, Gujarat State, India. International Journal of Scientific and

Engineering Research (IJSER), 5(6), 999-1005.

Bigogno, C., Goldberg, I.K., Boussiba, S., Vonshak, A. and Cohen, Z. (2002). Lipid and

fatty acid composition of the green oleaginous alga Parietochloris incisa, the richest

plant source of arachidonic acid. Phytochemistry, 60(5), 497–503

Bizani, D., and Brandelli, A. (2002). Characterization of a bacteriocin produced by a newly

isolated Bacillus sp. Strain 8 A. Journal of Applied Microbiology, 93(3), 512-519.

Boto, K.G. (1979). Nutrient and organic fluxes in mangroves. In: Mangrove ecosystems in

Australia, structure, function and management, Clough, B.F., (Ed.). Color craft,

Hong Kong, 239–257.

Bouillon, S., Moens, T., Overmeer, I., Koedam, N., and Dehairs, F. (2004). Resource

utilization patterns of epifauna from mangrove forests with contrasting inputs of

local versus imported organic matter. Marine Ecology Progress Series, 278, 77–88.

197

Bouillon. S., Borges, A.V., Castaneda-Moya, E., Diele, K., Dittmar, T., Duke, N.C.,

Kristensen, E., Lee, S.Y., Marchand, C., Middelburg, J.J., Rivera-Monroy, V.H.,

Smith, T.J. and Twilley, R.R. (2008). Mangrove production and carbon sinks, a

revision of global budget estimates. Global Biogeochemical Cycle, 2, 22.

Boyer, J. N., Fourqurean, J. W. and Jones, R. D. (1999). Seasonal and long-term trends in

the water quality of Florida Bay (1989–1997). Estuaries, 22, 417–430.

Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Analytical

biochemistry, 72(1-2), 248-254.

Bragadeeswaran, S., Rajasegar, M., Srinivasan, M. and Rajan, U. K. (2007). Sediment

texture and nutrients of Arasalar estuary, Karaikkal, south-east coast of India.

Journal of Environmental Biology, 28(2), 237-240.

Brierley, E. D. R. and Wood, M. (2001). Heterotrophic nitrification in an acid forest soil:

isolation and characterisation of a nitrifying bacterium. Soil Biology and

Biochemistry, 33(10), 1403-1409.

Brown, B.E. (1997). Integrated coastal Management: South Asia. Department of Marine

sciences and coastal Management, University of Newcastle, UK.

Bui, T.H. (2014). Cyanobacteria as source of new antifungals (Doctoral dissertation).

http://d-nb.info/1051958008/34.

Bulleid, N. C. (1984). Deoxygenation and remineralization above the sediment-water

interface; an in situ experimental study. Estuarine, coastal and shelf science, 19(1),

15-25.

Buresh, R.J. and Patrick, W.H. (1981). Nitrate reduction to ammonium and organic nitrogen

in an estuarine sediment. Soil Biology and Biochemistry, 13(4), 279-283.

Burja, A. M., Banaigs, B., Abou-Mansour, E., Burgess, J. G. and Wright, P. C. (2001).

Marine cyanobacteria—a prolific source of natural products. Tetrahedron, 57(46),

9347-9377.

198

Burns, R. G. and Slater, J. H. (1982). Experimental microbial ecology. Blackwell Scientific

Publications. 368-379.

Cabrita, M. T. and Brotas, V. (2000). Seasonal variation in denitrification and dissolved

nitrogen fluxes in intertidal sediments of the Tagus estuary, Portugal. Marine

Ecology Progress Series, 202, 51-65.

Caldwell, G. S., Bentley, M. G. and Olive, P. J. (2003). The use of a brine shrimp (Artemia

salina) bioassay to assess the toxicity of diatom extracts and short chain aldehydes.

Toxicon, 42(3), 301-306.

Carballo, J. L., Hernández, -I., Z. L., Pérez, P. and García, -G., M. D. (2002). A comparison

between two brine shrimp assays to detect in vitro cytotoxicity in marine natural

products. BMC biotechnology, 2(1), 1.

Cardona, P. and Botero, L. (1998). Soil characteristics and vegetation structure in a heavily

deteriorated mangrove forest in the Caribbean coast of Colombia. Biotropica, 30(1),

24-34.

Castenholz, R.W. (2001) Phylum BX. Cyanobacteria. Oxygenic photosynthetic bacteria. In:

Bergey’s manual of systematic bacteriology, Boone, D. R., Castenholz, R. W.,

Garrity, G. M. (Eds.). Springer, New York, 474–487.

Cerón-Bretón, J.G., Cerón, -B., R.M., Rangel, -M., M., Murielgarcia, M., Cordova, -Q.,

A.V. and Estrella, -C., A. (2011). Determination of carbon sequestration rate in soil

of a mangrove forest in Campeche, Mexico. WSEAS Transactions on. Environment

and Development, 7(2), 55-64.

Chaghtai, F. and Saifullah, S.M. (1992) First recorded bloom of Navicula Bory in a

mangrove habitat of Karachi. Pakistan Journal of Marine Sciences, 1(2), 139-140.

Chan, M.W.H., Ibrahim, M., Saeed, Q., Siddiqui, P.J.A., Zafar, U. and Rasheed, M. (2016,

January). Antimicrobial activity of mangrove extracts against multi-drug resistant

(MDR) strains. Poster presented at the 14th National and 5th International Conference

of Botany, University of Karachi, Pakistan.

199

Chandran, R. and Ramamoorthy, K. (1984). Hydrobiological studies in the gradient zone of

the Vellar estuary-nutrients. Mahasagar bulletin of the National Institute of

Oceanography, 17, 133-140.

Chapman, M.G. and Tolhurst, T.J. (2007). Relationships between benthic macrofauna and

biogeochemical properties of sediments at different spatial scales and among

different habitats in mangrove forests. Journal of Experimental Marine Biology and

Ecology, 343(1), 96-109.

Chaudhuri, A. B. (2007). Biodiversity of mangroves. Daya Books, India.

Chen, G.C., Tam, N.F. and Ye, Y. (2012). Spatial and seasonal variations of atmospheric N2

O2 and CO2 fluxes from a subtropical mangrove swamp and their relationships with

soil characteristics. Soil Biology and Biochemistry, 48, 175-181.

Chen, R. and Twilley, R.R. (1999a). Patterns of mangrove forest structure and soil nutrient

dynamics along the Shark River estuary, Florida. Estuaries, 22(4), 955-970.

Chen, R., and Twilley, R. R. (1999b). A simulation model of organic matter and nutrient

accumulation in mangrove wetland soils. Biogeochemistry, 44(1), 93-118.

Chenl, Y. and Celia, D. G. (1994). Effects of pH on the growth and carbon uptake of marine

phytoplankton. Department of Biological Sciences, Dartmouth College, Hanover,

New Hampshire, 3755, 83-94.

Cherif, M. and Loreau, M. (2009). When microbes and consumers determine the limiting

nutrient of autotrophs: a theoretical analysis. Proceedings of the Royal Society of

London B: Biological Sciences, 276(1656), 487-497.

Chiozzini, V. G., Agostinho, K. L., Delfim, R. and Braga, E. D. S. (2014). Tide influence on

hydrochemical parameters in two coastal regions of Sao Paulo (Brazil) under

different environmental occupations. In: Proceedings of Safety, Health and

Environment World Congress 10, 1-4.

Cintron, G., Lugo A. E., Martínez, R. and Correa A. (1985). Structural and functional

properties of mangrove forests. In: The botany and natural history of Panama, La

botánica e historia natural de Panamá, D’Arcy, W.G. and Correa M.D.A (Eds.). 53-

66. Monographs in systematic botany from the Missouri Botanical Garden, USA.

200

Cleveland, J., Montville, T. J., Nes, I. F. and Chikindas, M. L. (2001). Bacteriocins: safe,

natural antimicrobials for food preservation. International journal of food

microbiology, 71(1), 1-20.

Cole, C. V., and Sanford, R. L. (1989). Biological aspects of the Phosphorus cycle. In:

Proceedings and symposium on phosphorous requirements for sustainable

agriculture in Asia and Oceania, SCOPE/UNEP.

Cole, J.K., Hutchison, J.R., Renslow, R.S., Kim, Y.M., Chrisler, W.B., Engelmann, H.E.,

Dohnalkova, A.C., Hu, D., Metz, T.O., Fredrickson, J.K. and Lindemann, S.R.

(2014). Phototrophic biofilm assembly in microbial-mat-derived unicyanobacterial

consortia: model systems for the study of autotroph-heterotroph interactions.

Frontiers in microbiology, 5(109): 1-18.

Cowan JLW. and Boynton, W.R. (1996) Sediment-water oxygen and nutrient exchanges

along the longitudinal axis of Chesapeake Bay: seasonal patterns, controlling factors

and ecological significance. Estuaries, 19, 562-580.

Craft, C.B., Seneca, E.D. and Broome, S.W. (1991). Loss on ignition and Kjeldahl digestion

for estimating organic carbon and total nitrogen in estuarine marsh soils. Estuaries,

14, 175–179.

Cuadrado, D.G., Carmona, N.B. and Bournod, C. (2011). Biostabilization of sediments by

microbial mats in a temperate siliciclastic tidal flat, Bahia Blanca estuary

(Argentina). Sedimentary Geology, 237(1), 95-101.

Dagar, J. C. (1995). Characteristics of halophytic vegetation in India. In: Biology of salt

tolerant plants, Khan, M.A. and Ungar, I.A.(Eds), University of Karachi, Pakistan,

255-276.

Dahms, H.-U., Xu, Y. and Pfeiffer, C. (2006). Antifouling potential of cyanobacteria: a

minireview. Biofouling, 22, 317–327.

Damhoureyeh, S.A. and Ghalib, S.A. (2014). An overview of the status and distribution of

the mangrove forests and their wildlife in Sindh. Canadian Journal of Pure and

Applied Sciences, 8(3), 3051-3055.

201

Danielsen, F., Sørensen, M.K., Olwig, M.F., Selvam, V., Parish, F., Burgess, N.D., Hiraishi,

T., Karunagaran, V.M., Rasmussen, M.S., Hansen, L.B. and Quarto, A. (2005). The

Asian tsunami: a protective role for coastal vegetation. Science (Washington),

310(5748), 643.

Das Sarma, S. And Arora, P. (1997). Genetic analysis of the gas vehicle gene cluster in

haloarchaea. FEMS Microbiology Letters. 153, 1-10.

Davis, III S.E., Childers, D.L., Day, J.W., Rudnick, D.T. and Sklar, F.H. (2001). Wetland-

water column exchanges of carbon, nitrogen, and phosphorus in a Southern

Everglades dwarf mangrove. Estuaries, 24, 610-622.

Davis, S. E., Childers, D. L., Day, J. W., Rudnick, D. T. and Sklar, F. H. (2001). Nutrient

dynamics in vegetated and unvegetated areas of a southern Everglades mangrove

creek. Estuarine, Coastal and Shelf Science, 52(6), 753-768.

Decho, A.W., Hummon, D. and Fleeger, J.W. (1985). Meiofauna-sediment interactions

around subtropical seagrass sediments using factor analysis. Journal of Marine

Research, 43, 237-255.

Delfino, D. O., Wanderley, M. D., Silva, L. H. S., Feder, F. and Lopes, F. A. (2012).

Sedimentology and temporal distribution of microbial mats from Brejo do Espinho,

Rio de Janeiro, Brazil. Sedimentary Geology, 263, 85-95.

Depommier, D. (2003). The tree behind the forest: ecological and economic importance of

traditional agroforestry systems and multiple uses of trees in India. Tropical Ecology,

44(1), 63-71.

Dittmar, T. and Lara, R. J. (2001a). Do mangroves rather than rivers provide nutrients to

coastal environments south of the Amazon River? Evidence from long-term flux

measurements. Marine ecology Progress series, 213, 67-77.

Dittmar, T. and Lara, R.J., (2001b). Driving forces behind nutrient and organic matter

dynamics in a mangrove tidal creek in North Brazil. Estuarine, Coastal and Shelf

Science, 52(2), 249-259.

Dittmar, T., Hertkorn, N., Kattner, G., and Lara, R.J. (2006). Mangroves, a major source of

dissolved organic carbon to the oceans. Global Biogeochemical Cycles, 20, 1-7.

202

doi, 10.2112/JCOASTRES-D-15-00059.1.

Doran, J. W., Elliott, E. T. and Paustian, K. (1998). Soil microbial activity, nitrogen cycling,

and long-term changes in organic carbon pools as related to fallow tillage

management. Soil and Tillage Research, 49(1), 3-18.

Duke, N.C. (1992). Mangrove floristics and biogeography. In: Tropical Mangrove,

Robertson, A.I. and Alongi, D.M. (Eds.). 63-100. Ecosystems, American

Geophysical Union, Washington DC., USA

Dunlap, W.C., Battershill. C.N., Liptrot, C.H., Cobb, R.E., Bourne, D.G., Jaspars, M., Long,

P.F. and Newman, D.J. (2007) Biomedicinals from the phytosymbionts of marine

invertebrates: A molecular approach. Methods, 42(4), 358-376.

Durranee, J., Hasnain, S.A. and Ahmad, E. (2008). Observations On the Birds of

Sandspit/Hawkes Bay Coastal Wetland Complex, Karachi Coast. Pakistan Journal of

Zoology, 40(4), 229-237).

Elayaraja, S., Annamalai, N., Mayavu, P. and Balasubramanian, T. (2014). Production,

purification and characterization of bacteriocin from Lactobacillus murinus AU06

and its broad antibacterial spectrum. Asian Pacific Journal of Tropical Biomedicine,

4(3), 5-11.

Elser, J.J., Bracken, M.E., Cleland, E.E., Gruner, D.S., Harpole, W.S., Hillebrand, H., Ngai,

J.T., Seabloom, E.W., Shurin, J.B. and Smith, J.E. (2007). Global analysis of

nitrogen and phosphorus limitation of primary producers in freshwater, marine and

terrestrial ecosystems. Ecology letters, 10(12), 1135-1142.

Engene, N., Paul, V. J., Byrum, T., Gerwick, W. H., Thor, A. and Ellisman, M. H. (2013).

Five chemically rich species of tropical marine cyanobacteria of the genus Okeania

gen. nov.(Oscillatoriales, Cyanoprokaryota). Journal of phycology, 49(6), 1095-

1106.

Ensign, S. H., Hupp, C. R., Noe, G. B., Krauss, K. W. and Stagg, C. L. (2014). Sediment

accretion in tidal freshwater forests and oligohaline marshes of the Waccamaw and

Savannah Rivers, USA. Estuaries and Coasts, 37(5), 1107-1119.

203

Facca, C., and Sfriso, A. (2007). Epipelic diatom spatial and temporal distribution and

relationship with the main environmental parameters in coastal waters. Estuarine,

Coastal and Shelf Science, 75(1), 35-49.

Faheem, F., Saeed, S. A. D. I. A. and Rasool, S. A. (2007). Studies on brevicin AF01: a

bacteriocin like inhibitory substance active against methicillin resistant

Staphylococcus aureus. Pakistan Journal of Botany, 39(4), 1293.

Fan, L. F., Shieh, W. Y., Wu, W. F. and Chen, C. P. (2006). Distribution of nitrogenous

nutrients and denitrifiers strains in estuarine sediment profiles of the Tanshui River,

northern Taiwan. Estuarine, Coastal and Shelf Science, 69(3), 543-553.

FAO. (2007). The world’s mangrove 1980-2005. FAO forestry paper No. 153. Rome.

Farooq, S. (2010). Distribution of order Hymenoptera in mangrove forests near Karachi,

Pakistan. Pakistan Journal of Entomology, 25(2), 87-90.

Farooq, S., and Siddiqui, P. J. A. (2011). Distribution of chlorophyll in the mangrove

sediments of Sonmiani bay, Pakistan. Pakistan Journal of Botany, 43(1), 405-410.

Farooqui, Z. (2012). Studies on Mangrove ecosystem with respect to Biodiversity,

Productivity and Nutrient dynamics (Doctoral Thesis). Institute of Marine Sciences,

University of Karachi, Karachi, Pakistan.

Farooqui, Z., Shafique, S., Khan, K. L., Ali, A., Iqbal, P. and Siddiqui, P. J. A. (2012).

Assessment of litter production in semi-arid mangroves forests near active Indus

River mouth (Hajambro creek) and Karachi backwaters, Pakistan. Pakistan Journal

of Botany, 44(5), 1763-1768.

Farooqui, Z., Siddiqui, P. J. A. and Rasheed, M. (2014). Changes in Organic, Inorganic

contents, Carbon Nitrogen ratio in decomposing Avicennia marina and Rhizophora

mucronata leaves on tidal mudflats in Hajambro creek, Indus delta, Pakistan.

Journal of Tropical Life Science, 4(1), 37-45.

Fernandes, S. O., Bonin, P. C., Michotey, V. D., Garcia, N. and Loka, B., P. A. (2012).

Nitrogen-limited mangrove ecosystems conserve N through dissimilatory nitrate

reduction to ammonium. Scientific reports, 2, 419.

204

Field, C.D. (1998). Rehabilitation of mangrove ecosystems: an overview. Marine Pollution

Bulletin, 37, 383-392.

Finney, D.J. (1971). Probit analysis (3rd edition). Cambridge University Press.

Fong, R.M.D.P. and Zedler, J. B. (1993). Competition with macroalgae and benthic

cyanobacterial mats limits phytoplankton abundance in experimental microcosms.

Marine Ecology Progress Series, 100, 97-102.

Francis, C. A., Beman, J. M. and Kuypers, M. M. (2007). New processes and players in the

nitrogen cycle: the microbial ecology of anaerobic and archaeal ammonia oxidation.

The ISME journal, 1(1), 19-27.

Frazão, B., Martins, R. and Vasconcelos, V. (2010). Are known cyanotoxins involved in the

toxicity of picoplanktonic and filamentous North Atlantic marine cyanobacteria?

Marine drugs, 8(6), 1908-1919.

Friedrich J, Dinkel C, Friedl G, Pimenov N, Wijsman J, Gomoiu M-T, Cociasu A, Popa L.

and Wehrli, B. (2002) Benthic Nutrient Cycling and Diagenetic Pathways in the

North-western Black Sea. Estuarine, Coastal and Shelf Science, 54, 369-383.

Friend, P.L., Lucas, C.H., Holligan, P.M. and Collins, M.B., (2008). Microalgal mediation

of ripple mobility. Geobiology, (6), 70–82.

Furukawa, K., Wolanski, E. and Mueller, H. (1997). Currents and sediment transport in

mangrove forests. Estuarine, Coastal and Shelf Science, 44(3), 301-310.

Gademann, K. and Portmann, C. (2008). Secondary metabolites from cyanobacteria:

complex structures and powerful bioactivities. Current Organic Chemistry, 12(4),

326-341.

Garnier, J., Billen, G., Némery, J. and Sebilo, M. (2010). Transformations of nutrients (N, P,

Si) in the turbidity maximum zone of the Seine estuary and export to the sea.

Estuarine, Coastal and Shelf Science, 90(3), 129-141.

Geis, A., Singh, J. and Teuber, M. (1983). Potential of lactic streptococci to produce

bacteriocin. Applied and Environmental Microbiology, 45(1), 205-211

205

Gerwick, H. W. and Moore, S. B. (2012). Lessons from the past and charting the future of

marine natural products drug discovery and chemical biology. Chemistry and

Biology. 19(1): 85-98.

Ghaderpour, A., Nasori, K. N. M., Chew, L. L., Chong, V. C., Thong, K. L., & Chai, L. C.

(2014). Detection of multiple potentially pathogenic bacteria in Matang mangrove

estuaries, Malaysia. Marine pollution bulletin, 83(1), 324-330.

Ghanbari, M., Rezaei, M., Soltani, M. and Shah-Hosseini, G. (2009). Production of

bacteriocin by a novel Bacillus sp. strain RF 140, an intestinal bacterium of Caspian

Frisian Roach (Rutilus frisii kutum). Iranian Journal of Veterinary Research, 10(3),

267-272.

Ghanbari, M. and Jami, M. (2013). Chp.16: Lactic Acid Bacteria and Their Bacteriocins: A

Promising Approach to Seafood Biopreservation. 381-404, INTECH.

http://dx.doi.org/10.5772/50705

Ghosh, A., Dey, N., Bera, A., Tiwari, A., Sathyaniranjan, K. B., Chakrabarti, K. and

Chattopadhyay, D. (2010). Culture independent molecular analysis of bacterial

communities in the mangrove sediment of Sundarban, India. Saline systems, 6(1), 1.

Ghulam, A., Khalid, J., Rukhsana, A. and Lin, H. (2005). Effects of dietary protein level on

growth and utilization of protein and energy by juvenile mangrove red snapper

(Lutjanus argentimaculatus). Journal of Ocean University of China, 4(1), 49-55.

Giesen, W., Wulffraat, S., Zieren, M., & Scholten, L. (2007). Mangrove guidebook for

Southeast Asia. Mangrove guidebook for Southeast Asia. FAO and Wetlands

International, Rap Publications.

Gill, S., Abid, M. and Azam, F. (2006). Root-induced changes in potential nitrification and

nitrate reductase activity of the rhizospheric soil of wheat (Triticum aestivum L.) and

chickpea (Cicer arietinum L.). Pakistan Journal of Botany, 38(4), 991.

Gilman, E. L., Ellison, J., Duke, N. C. and Field, C. (2008). Threats to mangroves from

climate change and adaptation options: a review. Aquatic botany, 89(2), 237-250.

Gilmour, D. 1990. Holotolerant and holophilic microorganisms. In: Microbiology of extreme

environments, Edwards, C. (Ed.), McGraw-Hill Publishing Company, 147-177.

206

Giri, C., Pengra, B., Zhu, Z., Singh, A. and Tieszen, L. L. (2007). Monitoring mangrove

forest dynamics of the Sundarbans in Bangladesh and India using multi-temporal

satellite data from 1973 to 2000. Estuarine, coastal and shelf science, 73(1), 91-100.

Giri, C., Ochieng, E., Tieszen, L.L., Zhu, Z., Singh, A., Loveland, T., Masek, J. and Duke,

N. (2011). Status and distribution of mangrove forests of the world using earth

observation satellite data. Global Ecology and Biogeography, 20(1), 154-159.

Glick, B. R. (1995). The enhancement of plant growth by free-living bacteria. Canadian

Journal of Microbiology, 41(2), 109-117.

Golubic, S. (1994). The continuing importance of cyanobacteria. In: Early Life on Earth,

Bengtson, S. (Ed.). New York: Nobel Symposium 84. Columbia University Press.

334–340.

Golubic, S, Seong-Joo Lee. and Browne, K. (2000). Cyanobacteria: Architects of

sedimentary structures. In: Microbial Sediments, Riding, R and Awramik, S. (Eds.).

Berlin, Heidelberg, New York: Springer-Verlag. 57–67.

Golubic, S., Abed, R. M., Palińska, K., Pauillac, S., Chinain, M. and Laurent, D. (2010).

Marine toxic cyanobacteria: diversity, environmental responses and hazards.

Toxicon, 56(5), 836-841.

Gomezulu, E. S. (2013). Assessment of Nitrogen Nutrients Removal efficiency in

Constructed Mangrove Wetlands. TaJONAS: Tanzania Journal of Natural and

Applied Sciences, 4(2), 656-665.

Gondal, M. A., Saher, N. U. and Qureshi, N. A. (2012). Diversity and biomass distribution

of intertidal fauna in Sonmiani bay (Miani Hor), Balochistan (Pakistan). Egyptian

Journal of Biological Science, 4(1), 219-234.

Gonzalez, -A., B., Bashan, Y., Hernandez-Saavedra, N.Y., Ascencio, F. and De la Cruz-

Agüero, G. (2006). Seasonal seawater temperature as the major determinant for

populations of culturable bacteria in the sediments of an intact mangrove in an arid

region. FEMS Microbiology Ecology, 55(2), 311-321.

GoP. (2007). Pollution in Karachi harbor and areas around Pakistan air force bases in

Karachi. Senate Committee Report, 1-45.

207

Graham, A. (2013). Nitrogen Fixation and The Fate and Turnover of Carbon Fixed Through

Hydrogen-Coupled Carbon Dioxide Fixation in Soybeans (Master’s thesis). Queens

University Kingston, Ontario, Canada.

Graham, J. L., Loftin, K. A., Ziegler, A. C. and Meyer, M. T. (2008). Cyanobacteria in

lakes and reservoirs Toxin and taste and odor sampling guidelines. (ver. 1.0) U.S.

Geological Survey Techniques of Water Resources Investigations Book 9(A7), 7.5.

Grisi, T. And Gorlach, -L., K. (2010). The abundance of some pathogenic bacteria in

mangrove habitats of Paraiba do Norte estuary and crabmeat contamination of

mangrove crab Ucides cordatus. Brazilian archives of biology and technology, 53(1),

227-234.

Grossman, A.R., Lemaux, P.G., Conley, P.B., Bruns, B.U. and Anderson, L.K. (1988).

Characterization of phycobiliprotein and linker polypeptide genes in Fremyella

diplosiphon and their regulated expression during complementary chromatic

adaptation. Photosynthesis Research, 17, 23–56.

Guadrado, D. G., Carmona, N. B. and Bournod, C. (2011). Biostabilization of sediments by

microbial mats in a temperate siliciclastic tidal flat. Bahia Blanca estuary

(Argentina). Sedimentary Geology, 237, 95-101.

Guiry, M.D. and Guiry, G.M. (2016). AlgaeBase. World-wide electronic publication,

National University of Ireland, Galway.

http://www.algaebase.org.

Gulledge, B. M., Aggen, J. B., Huang, H.-B., Nairn, A. C. and Chamberlin, A. R. (2002).

The Microcystins and Nodularins: Cyclic Polypeptide Inhibitors of PP1 and PP2A.

Current Medicinal Chemistry, 9, 1991-2003.

Hall-Stoodley, L., Costerton, J. W. and Stoodley, P. (2004). Bacterial biofilms: from the

natural environment to infectious diseases. Nature reviews microbiology, 2(2), 95-

108.

Hameed, S. (2013). Investigation of the production and isolation of bioactive compounds

from cyanobacteria (Doctoral dissertation). United Kingdom.

http://openair.rgu.ac.uk

208

Hameed, S. (2009). Isolation, identification, screening of toxicity and oligopeptides of some

marine and brackish cyanobacteria from Norwegian and Pakistani waters, in the

search for bioactive natural compounds (Doctoral dissertation). Norway.

Hamilton, L. S., and Snedaker, S. C. (1984). Handbook for mangrove area management.

Han, L., Huang, X.S., Sattler, I., Fu, H.Z., Grabley, S., and Lin, W.H. (2007). Two new

constituents from mangrove Bruguiera gymnorrhiza. Journal of Asian natural

products research, 9(4), 327-331.

Hansen, J. I., Henriksen, K. and Blackburn, T. H. (1981). Seasonal distribution of nitrifying

bacteria and rates of nitrification in coastal marine sediments. Microbial Ecology,

7(4), 297-304.

Hara, S., Hashidoko, Y., Desyatkin, R. V., Hatano, R. and Tahara, S. (2009). High rate of

N2 fixation by East Siberian cryophilic soil bacteria as determined by measuring

acetylene reduction in nitrogen-poor medium solidified with gellan gum. Applied

and environmental microbiology, 75(9), 2811-2819.

Hargrave, B. T. and Connolly, G. F. (1978). A device to collect supernatant water for

measurement of the flux of dissolved compounds across sediment surfaces1.

Limnology and Oceanography, 23(5), 1005-1010.

Harris, E.L. and Angal, S. (1989). Protein purification methods. Oxford University: IRL

Press.

Harrison, P. J., Khan, N., Yin, K., Saleem, M., Bano, N., Nisa, N., Ahmed, S.I., Rizvi, N.

and Azam, F. (1997). Nutrient and Phytoplankton dynamics in two mangrove tidal

creeks of the Indus river delta, Pakistan. Marine ecology Progress series, 157, 13-19.

Hegazi, A. Z., Mostafa, S. S. and Ahmed, H. M. (2010). Influence of different

cyanobacterial application methods on growth and seed production of common bean

under various levels of mineral nitrogen fertilization. Nature and Science, 8(11),

183-194.

Hennig, H.F.O., Eagle, G.A., Fielder, L., Fricke, A.H., Gledhill, W.J., Greenwood, P.J. and

Orren, M.J. (1983). Ratio and population density of psammo littorial meiofauna as a

209

perturbation indicator of sandy beaches in South Africa. Environmental Monitoring

Assess, 3, 45-60.

Hescox, M. A. and Carlberg, D. M. (1972). Photoreactivation in Halobacterium cutirubrum.

Canadian journal of microbiology, 18(7), 981-985.

Hessen, D. O., Ågren, G. I., Anderson, T. R., Elser, J. J. and De Ruiter, P. C. (2004). Carbon

sequestration in ecosystems: the role of stoichiometry. Ecology, 85(5), 1179-1192.

Hietala, J., Reinikainen, M. and Walls, M. (1995). Variation in life history responses of

Daphnia to toxic Microcystis aeruginosa. Journal of Plankton Research, 17, 2307-

2318.

Hillebrand, H., Dürselen, C. D., Kirschtel, D., Pollingher, U. and Zohary, T. (1999).

Biovolume calculation for pelagic and benthic microalgae. Journal of phycology,

35(2), 403-424.

Hisem, D., Hrouzek, P., Tomek, P., Tomšíčková, J., Zapomělová, E., Skácelová, K.,

Lukešová, A. and Kopecký, J. (2011). Cyanobacterial cytotoxicity versus toxicity to

brine shrimp Artemia salina. Toxicon, 57(1), 76-83.

Hoffmann, H., Schloter, M. and Wilke, B. M. (2007). Microscale-scale measurement of

potential nitrification rates of soil aggregates. Biology and Fertility of Soils, 44(2),

411-413.

Hogarth, P.J. (1999). The Biology of Mangroves. Oxford University Press Inc. NY, USA.

Hogarth, P. J. (2015). The biology of mangroves and seagrasses. Oxford University Press

Inc. NY, USA.

Hogue., E.W. and Miller., C.B. (1981). Effects of sediment microtopography on small-scale

spatial distributions of meiobenthic nematodes. Journal of Experimental Marine

Biology and Ecology, 53(2), 181-191.

Hoiczyk, E. and Hansel, A. (2000). Cyanobacterial cell walls: news from an unusual

prokaryotic envelope. Journal of Bacteriology, 182(5), 1191-1199.

Holguin, G., Guzman, M. A. and Bashan, Y. (1992). Two new nitrogen-fixing bacteria from

the rhizosphere of mangrove trees: Their isolation, identification and in vitro

210

interaction with rhizosphere Staphylococcus sp. FEMS Microbiology Letters, 101(3),

207-216.

Holguin, G., Vazquez, P. and Bashan, Y. (2001). The role of sediment microorganisms in

the productivity, conservation, and rehabilitation of mangrove ecosystems: an

overview. Biology and fertility of soils, 33(4), 265-278.

Hong, K., Gao, A.H., Xie, Q.Y., Gao, H.G., Zhuang, L., Lin, H.P., Yu, H.P., Li, J., Yao,

X.S., Goodfellow, M. and Ruan, J.S. (2009). Actinomycetes for marine drug

discovery isolated from mangrove soils and plants in China. Marine drugs, 7(1), 24-

44.

Horincar, V.B., Parfene, G. and Bahrim, G. (2011). Evaluation of bioactive compound in

extracts obtained from three Romanian marine algae species. Romanian

Biotechnological Letters, 16(6): 72-78.

Hosack, G. R., Dumbauld, B. R., Ruesink, J. L. and Armstrong, D. A. (2006). Habitat

associations of estuarine species: comparisons of intertidal mudflat, seagrass

(Zostera marina), and oyster (Crassostrea gigas) habitats. Estuaries and Coasts,

29(6), 1150-1160.

Hossain, M.Z., Aziz, C.B. and Saha, M.L. (2012). Relationships between soil physico-

chemical properties and total viable bacterial counts in Sunderban mangrove forests,

Bangladesh. Dhaka University Journal of Biological Sciences, 21(2), 169-175.

Hotel, W. T. (1995). Ecology and management of mangrove restoration and regeneration in

East and Southeast Asia. Proceedings of the Ecotone IV, 18, 22.

Hou, L.J., Liu, M., Xu, S.Y., Ou, D.N., Yu, J., Cheng, S.B., Lin, X. and Yang, Y. (2007).

The effects of semi-lunar spring and neap tidal change on nitrification, denitrification

and N 2 O vertical distribution in the intertidal sediments of the Yangtze estuary,

China. Estuarine, Coastal and Shelf Science, 73(3), pp.607-616.

Hussain, M., Khan, M. T., Wajid, A. and Rasool, S. A. (2008). Technological

characterization of indigenous enterococcal population for probiotic potential.

Pakistan Journal of Botany, 40(867), e75.

211

Hwang, Y.H. and Chen, S.C., (2001). Effects of ammonium, phosphate, and salinity on

growth, gas exchange characteristics, and ionic contents of seedlings of mangrove

Kandelia candel (L.) Druce. Botanical Bulletin of Academia Sinica, 42, 131-139.

Ilyas, M. and Siddiqui, S.A. (1989). Inorganic constituents of mangrove leave Avicennia

marina from Karachi coast. Turkish Journal of Agriculture and Forestry, 13I, 595-

599.

Indus for All Program (IFAP). (2008). Mangroves of Pakistan. WWF- Pakistan, Karachi,

16.

Ishida, K., Matsuda, H., Murakami, M. and Yamaguchi, K. (1997) Kawaguchipetin B, an

antibacterial cyclic undecapeptide from the cyanobacterium Microcystis aeruginosa.

Journal of Natural Products, 60, 724-726.

Islam, M.S.N. (2007). Cultural Landscape Changing due to Anthropogenic Influences on

Surface Water and Threats to Mangrove Wetland Ecosystems: A Case Study on the

Sundarbans, Bangladesh. (Doctoral Thesis).

Isnansetyo, A., Thien, N. D., Seguchi, M., Koriyama, M. and Koga, A. (2011). Nitrification

Potential of Mud Sediment of the Ariake Sea Tidal Flat and the Individual Effect of

Temperature, pH, Salinity and Ammonium Concentration on its Nitrification Rate.

Research Journal of Environmental and Earth Sciences, 3(5), 587-599.

IUCN. (2007). The economic costs of upstream freshwater flow loss: Indus Delta. 6-7.

Islamic Republic of Pakistan Country Environment Analysis, Asian Development

Bank.

Ivanova, I., Kabadjova, P., Pantev, A., Danova, S. and Dousset, X. (2000). Detection,

purification and partial characterization of a novel bacteriocin substance produced by

Lactococcus lactis subsp. lactis B14 isolated from boza-Bulgarian traditional cereal

beverage. Biocatalysis, 41(6), 47-53.

Jabeen, N., Gul, H., Subhan, S.A., Hussain, M., Ajaz, M. and Rasool, S.A. (2009).

Biophysicochemical characterization of bacteriocins (S) from indigenously isolated

Agrobacterium radiobacter NA6. Pakistan Journal of Botany, 41(6), 3227-3237.

212

Jaiswal, P., Singh, P. K. and Prasanna, R. (2008). Cyanobacterial bioactive molecules-an

overview of their toxic properties. Canadian Journal of Microbiology, 54(9), 701-

717.

Jalal, K. C. A., UT, N. F., Mardiana, M. A., Shahbudin, S. and Omar, M. N. (2010).

Antibiotic resistance microbes in tropical mangrove sediments in east coast

peninsular, Malaysia. African Journal of Microbiology Research, 4(8), 640-645.

Jamil, K., Abbas, G., Akhtar, R., Lin, H. and Li, Z. (2007). Effects of replacing fishmeal

with animal by-products meal supplementation in diets on the growth and nutrient

utilization of mangrove red snapper. Journal of Ocean University of China, 6(3),

292-298.

Jamil, N., Erum, A., Ahmed, N., Yasmeen, S. and Ahmed, V.U. (1999). Biodiversity:

Characterization of bacteria isolated from marine environment. In: Aquatic

biodiversity of Arabian Sea, Qazmi, Q.B. (Ed.). University Press, Karachi. 77-85.

Jansen, D.H. (1985). Mangroves, where is the understory? Journal of Tropical Ecology, 1,

89-92.

Jayaraman, G., Rajesh, D. and Karthikeyan, S. (2012). Isolation and partial characterization

of a new bacteriocin from Bacillus pumilus DR2 isolated from seawater. CIBTech.

Journal of Microbiology, 133-41.

Jennerjahn, T. C., and Ittekkot, V. (2002). Relevance of mangroves for the production and

deposition of organic matter along tropical continental margins.

Naturwissenschaften, 89(1), 23-30.

Jensen, P.R. and Fenical, W. (1994). Strategies for the discovery of secondary metabolites

from marine bacteria: Ecological perspectives. Annual Review of Microbiology, 48,

559-584.

Kathiresan, K. and Bingham, B. L. (2001). Biology of mangroves and mangrove

ecosystems. Advances in marine biology, 40, 81-251.

Kelecom, A. (2002). Secondary metabolites from marine microorganisms. Anais da

Academia Brasileira de Ciências, 74(1), 151-170.

213

Khalil, S. (1999). Economic valuation of the mangrove ecosystem along the Karachi coastal

areas. The Economic Value of the Environment: Cases from South Asia. Published by

IUCN.

Khalil, S. (2000). The economic valuation methods of environment: Application to

mangrove ecosystem (products) along Karachi coastal areas. Pakistan Economic and

Social Review, 16-46.

Khan, A. M., Ameen, M., Naz, S. and Noureen, S. (2012). Bio screening of marine

organisms from the coasts of Pakistan. Journal of the Chemical Society of Pakistan,

34(1), 184-194.

Khan, A. U. (1998). Industrial operations and interaction with ecology: the case of Pakistan.

Forest, 3, 4-3.

Khan, F., Adnan, M. Y. and Aziz, I. (2016). Metabolic implications of salt induced osmolyte

accumulation in avicennia marina. Pakistan Journal of Botany, 48(1), 29-36.

Khan, M. A., Saifullah, S. M., Qureshi, N., Shaukat. S. and Chaghtai, F. (1999). Population

Structure and a Pattern of the Gastropod Potámides cingulatus (Gmelin) in a

Mangrove Habitat of Karachi, Pakistan. Pakistan Journal of Biological Sciences,

2(1), 178-181.

Khan, M. A. and Aziz, I. (2001). Salinity tolerance in some mangrove species from

Pakistan. Wetlands Ecology and Management, 9(3), 229-233.

Khan, M. S. (1999). Herpetology of habitat types of Pakistan. Pakistan journal of zoology,

31(3), 275-289.

Khan, S. H. and Saleem, M. (1988). A preliminary study of Pollution in Karachi Harbour.

Marine Science of the Arabian Sea, Thompson, M.F. and Tirmizi, N.M. (Eds.).

American Institute of Biological Sciences, Washington, DC, 539-548.

Khanam, S., Mustaquim, J. and Ayub, Z. (2014). Study of the Seasonal Abundance and

Occurrence of Macrobenthic Crustaceans in Mangrove Swamps of Sandspit

Backwaters, Karachi. International Journal of Biological Research, 2(2), 147-152.

214

Kim, J. D. and Lee, C. G. (2006). Diversity of heterocystous filamentous cyanobacteria

(blue-green algae) from rice paddy fields and their differential susceptibility to ten

fungicides used in Korea. Journal of microbiology and biotechnology, 16(2), 240-

246.

Kim, J.-D. (2006). Screening of cyanobacteria (blue-green algae) from rice paddy soil for

antifungal activity against plant pathogenic fungi. Mycrobiology. 34(3): 138-142.

Kimura, H., Matsusaki, H., Sashihara, T., Sonomoto, K. and Ishizaki, A. (1998). Purification

and partial identification of bacteriocin ISK-1, a new lantibiotic produced by

Pediococcus sp. ISK-1. Bioscience, biotechnology and biochemistry, 62(12), 2341-

2345

Kirwan, M. L. and Mudd, S. M. (2012). Response of salt-marsh carbon accumulation to

climate change. Nature, 489(7417), 550-553.

Kitheka, J. U., Ongwenyi, G. S. and Mavuti, K. M. (2002). Dynamics of suspended

sediment exchange and transport in a degraded mangrove creek in Kenya. AMBIO: A

Journal of the Human Environment, 31(7), 580-587.

Klaenhammer, T. R. (1988). Bacteriocins of lactic acid bacteria. Biochimie, 70(3), 337-349.

Klaenhammer, T. R. (1993). Genetics of bacteriocins produced by lactic acid bacteria.

FEMS microbiology reviews, 12(1-3), 39-85.

Klemedtsson, L., Berg, P., Clarholm, M., Schnürer, J. and Rosswall, T. (1987). Microbial

nitrogen transformations in the root environment of barley. Soil Biology and

Biochemistry, 19(5), 551-558.

Komárek, J. (1992). Diversita a moderní klasifikace sinic (Cyanoprocaryota) (Doctoral

dissertation), University of Trebon, Trebon, Czech Republic.

Komárek, J. and Anagnostidis, K. (1999). Cyanoprokaryota. 1. Chroococcales. In:

Süßwasserflora von Mitteleuropa. Begründet von A. Pascher. Band 19/1, Ettl, H.,

Gärtner, G., Heynig, H. and Mollenhauer, D. (Eds.). Heidelberg and Berlin:

Spektrum, Akademischer Verlag, 1-548.

215

Komárek, J. and Anagnostidis, K. (2005). Cyanoprokaryota: 2. Teil/2nd Part:

Oscillatoriales. In: Süsswasserflora von Mitteleuropa 19/2. München, Büdel, B., L.

Krienitz, G. Gärtner and Schagerl, M. (Eds.). Elsevier Spektrum Akademischer

Verlag, 1-759.

Komárek, J. and Hauer, T. (2013). On-line database of cyanobacterial genera. Word-wide

electronic publication, University of South Bohemia and Institute of Botany AS CR

http:// Cyanodb.cz/

Koop-Jakobsen, K. and Giblin, A. E. (2009). Anammox in tidal marsh sediments: the role of

salinity, nitrogen loading, and marsh vegetation. Estuaries and coasts, 32(2), 238-

245.

Krishnan, K. P., Fernandes, S. O., Chandan, G. S., and Bharathi, P. L. (2007). Bacterial

contribution to mitigation of iron and manganese in mangrove sediments. Marine

pollution bulletin, 54(9), 1427-1433.

Krishnan, K. P. and Bharathi, P. L. (2009). Organic carbon and iron modulate nitrification

rates in mangrove swamps of Goa, south west coast of India. Estuarine, Coastal and

Shelf Science, 84(3), 419-426.

Kristensen, E., Jensen, M. H., Banta, G. T., Hansen, K., Holmer, M. and King, G. M.

(1998). Transformation and transport of inorganic nitrogen in sediments of a

southeast Asian mangrove forest. Aquatic microbial ecology, 15(2), 165-175.

Kristensen, E., Andersen, F. Ø., Holmboe, N., Holmer, M. and Thongtham, N. (2000).

Carbon and nitrogen mineralization in sediments of the Bangrong mangrove area,

Phuket, Thailand. Aquatic Microbial Ecology, 22(2), 199-213.

Kristensen, E. and Alongi, D.M. (2006). Control by fiddler crabs (Uca vocans) and plant

roots (Avicennia marina) on carbon, iron and sulfur biogeochemistry in mangrove

sediment. Limnology and Oceanography, 51, 1557–1571.

Kristensen, E. (2008). Mangrove crabs as ecosystem engineers; with emphasis on sediment

processes. Journal of sea Research, 59(1), 30-43.

216

Kromkamp, J. (1987). Formation and functional-significance of storage products in

cyanobacteria. New Zealand Journal of Marine and Freshwater Research, 21, 457–

465.

Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature, 227, 680-685.

Larsen, A.G., Vogensen, F.K., and Josephsen, J. (1993). Antimicrobial activity of lactic acid

bacteria isolated from sour doughs: purification and characterization of bavaricin A,

a bacteriocin produced by Lactobacillus bavaricus MI401. Journal of Applied

Bacteriology, 75(2), 113-122.

Laslett, G. M., Clark, R. and Jones, G. J. (1997). Estimating the precision of filamentous

blue-green algae cell concentration from a single sample, Environmetrics, 8(4): 313-

339.

Latif, S., Ayub, Z. and Siddiqui, G. (2013). Seasonal variability of phytoplankton in a

coastal lagoon and adjacent open sea in Pakistan. Turkish Journal of Botany, 37(2),

398-410.

Lauerman, L.H., Hoerr, F.J., Sharpton, A.R., Shah, S.M., and Santen, -V.V.L. (1993).

Development and application of a polymerase chain reaction assay for Mycoplasma

synoviae. Avian Diseases, 829-834.

Lee, K.H., Jun, K.D., Kim, W.S. and Paik, H.D. (2001). Partial characterization of

polyfermenticin SCD, a newly identified bacteriocin of Bacillus polyfermenticus.

Letters in Applied Microbiology, 32, 146-151.

Lee, L.H., Zainal, N., Azman, A.S., Eng, S.K., Goh, B.H., Yin, W.F., Ab Mutalib, N.S. and

Chan, K.G. (2014). Diversity and antimicrobial activities of actinobacteria isolated

from tropical mangrove sediments in Malaysia. The Scientific World Journal, 1-14.

Lee, R. Y., Porubsky, W. P., Feller, I. C., McKee, K. L. and Joye, S. B. (2008). Porewater

biogeochemistry and soil metabolism in dwarf red mangrove habitats (Twin Cays,

Belize). Biogeochemistry, 87(2), 181-198.

Lee, S. Y. (1990). Primary productivity and particulate organic matter flow in an estuarine

mangrove-wetland in Hong Kong. Marine Biology, 106(3), 453-463.

217

Lee, S.Y. (2008). Mangrove macrobenthos, assemblages, services, and linkages. Journal of

Sea Research, 59(1), 16-29.

Levin, L.A., Boesch, D.F., Covich, A., Dahm, C., Erséus, C., Ewel, K.C., Kneib, R.T.,

Moldenke, A., Palmer, M.A., Snelgrove, P. and Strayer, D. (2001). The function of

marine critical transition zones and the importance of sediment biodiversity.

Ecosystems, 4(5), 430-451.

Ley, R.E., Harris, J.K., Wilcox, J., Spear, J.R., Miller, S.R., Bebout, B.M., Maresca, J.A.,

Bryant, D.A., Sogin, M.L. and Pace, N.R. (2006). Unexpected diversity and

complexity of the Guerrero Negro hypersaline microbial mat. Applied and

Environmental Microbiology, 72(5), 3685-3695.

Long, H., Xiang, W., Zhuang, T. and Lin, P. (2005). Microorganism resource of mangrove

ecosystems. Chinese journal of ecology, 24(6), 696-702.

Lopes, V. R., Fernández, N., Martins, R. F. and Vasconcelos, V. (2010). Primary screening

of the bioactivity of brackishwater cyanobacteria: Toxicity of crude extracts to

Artemia salina larvae and Paracentrotus lividus embryos. Marine drugs, 8(3), 471-

482.

Lourey, M. J., Alongi, D. M., Ryan, D. A. J. and Devlin, M. J. (2001). Variability of nutrient

regeneration rates and nutrient concentrations in surface sediments of the northern

Great Barrier Reef shelf. Continental Shelf Research, 21(2), 145-155.

Lovelock, C.E., Feller, I.C., McKee, K.L. and Thompson, R. (2005). Variation in mangrove

forest structure and sediment characteristics in Bocas del Toro, Panama. Caribbean

Journal of Science, 41(3), 456-464.

Lovelock, C.E. and Feller, I.C. (2003). Photosynthetic performance and resource utilization

of two mangrove species coexisting in a hypersaline scrub forest. Oecologia, 134,

455-462.

Lugo, A. E. and Snedaker, S. C. (1974). The ecology of mangroves. Annual review of

ecology and systematics, 39-64.

Luo, Z., Qiu, Z., Wei, Q., Du, L.G., Zhao, Y. and Yan, C. (2014). Dynamics of ammonia -

oxidizing archaea and bacteria in relation to nitrification along simulated dissolved

218

oxygen gradient in sediment–water interface of the Jiulong river estuarine wetland,

China. Environmental Earth Sciences, 72(7), 2225-2237.

Luther, D. A. and Greenberg, R. (2009). Mangroves: a global perspective on the evolution

and conservation of their terrestrial vertebrates. BioScience, 59(7), 602-612.

Mackey, A.P. and Smail, G. (1995). Spatial and temporal variation in litter fall of Avicennia

marina (Forssk) vierh in the Brisbane-River, Queensland, Australia. Aquatic Botany,

52, 133-142.

Macnae, W. and Kalk, M. (1962). The Ecology of the Mangrove Swamps at Inhaca Island,

Moξ̧ambique. The Journal of Ecology, 19-34.

Macnae, W. (1969). A general account of the fauna and flora of mangrove swamps and

forests in the Indo-West-Pacific region. Advances in marine biology, 6, 73-270.

Macura, J. and Stotzky, G. (1980). Effect of montmorillonite and kaolinite on nitrification in

soil. Folia microbiologica, 25(2), 90-105.

Magalhães, C. M., Joye, S. B., Moreira, R. M., Wiebe, W. J. and Bordalo, A. A. (2005).

Effect of salinity and inorganic nitrogen concentrations on nitrification and

denitrification rates in intertidal sediments and rocky biofilms of the Douro River

estuary, Portugal. Water Research, 39(9), 1783-1794.

Mandal, B., Vlek, P. L. G. and Mandal, L. N. (1999). Beneficial effects of blue-green algae

and Azolla, excluding supplying nitrogen, on wetland rice fields: a review. Biology

and Fertility of Soils, 28(4), 329-342.

Mann, F.D. and Steinke, T.D. (1989). Biological nitrogen fixation (acetylene reduction)

associated with green algal (cyanobacterial) communities in the Beachwood

Mangrove Nature Reserve. The effect of environmental factors on acetylene

reduction activity. South African Journal of Botany, 55, 438–444.

Mann, F.G. and Saunders, B.C. (1978). Practical Organic chemistry. 4th edition. Longman,

USA., 491-497.

Mansoor, S.N., Siddiqui, P.J.A., Bano, A. and Zaib-un-Nisa. (2000). Microbial flora

associated with mangroves. In: The Arabian Sea as a source of Biological Diversity,

219

Ahmed, V.U. (Ed.). Proceedings of the National O.N.R. Symposium. H.E.J. Institute

of Chemistry, University of Karachi, 157-164.

Mao, B., Li, D., Zhao, J., Liu, X., Gu, Z., Chen, Y.Q., Zhang, H. and Chen, W. (2014). In

vitro fermentation of lactulose by human gut bacteria. Journal of agricultural and

food chemistry, 62(45), 10970-10977.

Marchand, C., Elisabeth L., and Baltzer F. (2003). The composition of sedimentary organic

matter in relation to the dynamic features of the mangrove-fringed coast in French

Guiana. Estuarine, Coastal and Shelf Science, 56, 119-130.

Marchand, C., Baltzer, F., Lallier-Vergès, E. and Albéric, P. (2004). Pore-water chemistry in

mangrove sediments, relationship with species composition and developmental

stages (French Guiana). Marine Geography, 208, 361-381.

Marshall, K.C. (1976). Interfaces in microbial ecology. HUP, Cambridge, Mass., USA.

Martins, M., Taborda, R., Silva, G., Assunção, A., Matos, A. P. and Costa, M. C. (2012).

Aluminum and sulphate removal by a highly Al-resistant dissimilatory sulphate-

reducing bacteria community. Biodegradation, 23(5), 693-703.

Martins, R.F., Ramos, M., Herfindal, L., Sousa, J.A., Skarven K. and Vasconcelos V.M.

(2008). Antimicrobial and cytotoxic Assessment of Marine cyanobacteria

Synechocystis and Synechococcus. Marine Drugs, 6, 1-11.

Mathys, S., Ah, -V., U., Lacroix, C., Staub, E., Mini, R., Cereghetti, T. and Meile, L. (2007).

Detection of the pediocin gene pedA in strains from human faeces by real-time PCR

and characterization of Pediococcus acidilactici UVA1. BMC biotechnology, 7(1), 1.

Mazda, Y. and Ikeda, Y. (2006). Behavior of the groundwater in a riverine-type mangrove

forest. Wetlands Ecology and Management, 14(6), 477-488.

McLeod, E. and Rodney, S. V. (2006). Managing Mangroves for Resilience to Climate

Change. 64. IUCN, Gland, Switzerland.

Mehdi, F. S. and Saifullah, S. M. (1992). Mangrove fungi of Karachi, Pakistan. Journal of

Islamic Academy of Sciences, 5(1), 24-27.

220

Mehdi, F. S. and Saifullah, S. M. (2000). Species diversity and seasonal occurrence of fungi

on seedlings of Avicennia marina (Forsk.) Vierh. Pakistan Journal of Biological

Sciences, 3(2), 265-268.

Mendelssohn, I. A. and Morris, J. T. (2002). Eco-physiological controls on the productivity

of Spartina alterniflora Loisel. Concepts and controversies in tidal marsh ecology,

59-80.

Meseguer, I. and Rodriguez-Valera, F. (1985). Production and purification of halocin H4.

FEMS microbiology letters, 28(2), 177-182.

Metting, B. and Pyne, J. W. (1986). Biologically active compounds from microalgae.

Enzyme and Microbial Technology, 8(7), 386-394.

Meyer, B.N., Ferrigni, N.R., Putnam, J.E., Jacobsen, L.B., Nichols, D.J. and McLaughlin,

J.L. (1982). Brine shrimp: a convenient general bioassay for active plant

constituents. Planta medica, 45(05), 31-34.

Miles, H., Lesser, W. and Sears, P. (1992). The economic implications of bioengineered

mastitis control. Journal of dairy science, 75(2), 596-605.

Miller-Way, T. and Twilley, R. (1996). Theory and operation of continuous flow systems

for the study of benthic-pelagic coupling. Marine Ecology Progress Series, 140,

257–269.

Miranda, J., Balachandran, K. K., Ramesh, R. and Wafar, M. (2008). Nitrification in Kochi

backwaters. Estuarine, Coastal and Shelf Science, 78(2), 291-300.

Miyachi, S., Iwasaki, I. and Shiraiwa, Y. (2003). Historical perspective on microalgal and

cyanobacterial acclimation to low-and extremely high-CO2 conditions.

Photosynthesis research, 77(2-3), 139-153.

Miyazono, A., Odate, T. and Maita, Y. (1992). Seasonal fluctuations of cell density of

cyanobacteria and other picophytoplankton in Iwanai Bay, Hokkaido, Japan. Journal

of Oceanography, 48(3), 257-266.

221

Moll, R. (2011). Impact of mangroves and an agriculture-dominated hinterland on the

carbon and nutrient biogeochemistry in the Segara Anakan Lagoon, Java, Indonesia

(Doctoral dissertation). Leibniz-Zentrum für Marine Tropenökologie.

Mollendroff, J. W. (2008). Characterization of Bacteriocins produced by lactic acid

bacteria from fermented beverages and optimization of starter cultures (Master’s

Thesis). Stellenbosch University.

Molnar, N., Marchand, C., Deborde, J., Patrona, D.L. and Meziane, T. (2014). Seasonal

pattern of the biogeochemical properties of mangrove sediments receiving shrimp

farm effluents (New Caledonia). Journal of Aquatic Research and Development,

5(5), 1.

Morell, J. M., and Corredor, J. E. (1993). Sediment nitrogen trapping in a mangrove lagoon.

Estuarine, coastal and shelf science, 37(2), 203-212.

Morgulis, A., Coulouris, G., Raytselis, Y., Madden, T. L., Agarwala, R. and Schäffer, A. A.

(2008). Database indexing for production Mega BLAST searches. Bioinformatics,

24(16), 1757-1764.

Morton, T. and L. Steve. (2008). Modern Uses of Cultivated Alga. Ethnobotanical Leaflets.

Southern Illinois University Carbondale, 12-26.

Motta, A.S., and Brandelli, A. (2002). Characterization of an antibacterial peptide produced

by Brevibacterium linens. Journal of Applied Microbiology, 92(1), 63-70.

Mukhtar, I. and Hannan, A. (2012). Constrains on mangrove forests and conservation

projects in Pakistan. Journal of Coastal Conservation, 16(1), 51-62.

Müller, T. and Höper, H. (2004). Soil organic matter turnover as a function of the soil clay

content: consequences for model applications. Soil Biology and Biochemistry, 36(6),

877-888.

Mundt, S., Kreitlow, S., Nowotny, A. and Effmert, U. (2001). Biochemical and

pharmacological investigations of selected cyanobacteria. International Journal of

Hygiene and Environmental Health. 203(4): 327-334.

222

Mundt, S., Kreitlow, S. and Jansen, R.(2003). Oscillatoria redekei HUB 051. Journal of

Applied Phycology, 15(2-3), 263-267.

Mur, L.R., Skulberg, O.M., and Utkilen, H. (1999). Cyanobacteria in the environment. In:

Toxic cyanobacteria in water, Chorus, I., Bartram, J. E and Spon, F. N. (Eds.).

London, UK, 15-40.

Mushtaq, S. and Mustaquim, J. (2009). The Occurrence and Distribution of stalked

barnacles of the genus Octolasmis on the gills of mud or mangrove crab, genus

Scylla. Crustaceana, 82(1), 53-61.

Mustaquim, J., Imtiaz, R. and Sultana, R. (2001). Population Biology and larval morphology

of the edible crab (Scylla serrata) from Karachi backwaters. Pakistan Journal of

Marine Biology, 7, 299-327.

Mwashote, B. M. and Jumba, I. O. (2002). Quantitative aspects of inorganic nutrient fluxes

in the Gazi Bay (Kenya): implications for coastal ecosystems. Marine pollution

bulletin, 44(11), 1194-1205.

Naeem, M. A. H. R. O. S. H., Ilyas, M., Haider, S., Baig, S. and Saleem, M. (2012).

Isolation characterization and identification of lactic acid bacteria from fruit juices

and their efficacy against antibiotics. Pakistan Journal of Botany, 44, 323-328.

Naes, H., Aarnes, H., Utkilen, H. C., Nilsen, S., and Skulberg, O. M. (1985). Effect of

photon fluence rate and specific growth rate on geosmin production of the

cyanobacterium Oscillatoria brevis (Kütz.) Gom. Applied and Environmental

Microbiology, 49(6), 1538.

Nagarkar, S. (2002). Morphology and ecology of new records of cyanobacteria belonging to

the genus Oscillatoria from Hong Kong rocky shores. Botanica marina, 45(3), 274-

283.

Nagelkerken, I., Blaber, S.J.M., Bouillon, S., Green, P., Haywood, M., Kirton, L.G.,

Meynecke, J.-O., Pawlik, J., Penrose, H.M., Sasekumar, A. and Somerfield, P.J.

(2008). The habitat function of mangroves for terrestrial and marine fauna: A review.

Aquatic Botany, 89, 155–185.

223

Nasira, K. and Shahina, F. (2016). Marine nematode fauna from mangrove areas of Pakistan.

International Journal of Phycology and Phycochemistry (Pakistan), 8(2), 213-218.

Nayak, S. and Prasanna, R. (2007). Soil pH and its role in cyanobacterial abundance and

diversity in rice field soils. Applied Ecology and Environmental Research, 5(2), 103-

113.

Naz, F., Qureshi, N. A. and Saher, N. U. (2014). Temporal variations of mesozooplankton

abundance and biomass in the mangrove creek area along the Karachi coast,

Pakistan. Acta Oceanologica Sinica, 33(12), 222-230.

Naz, S. A. and Rasool, S. A. (2013). Isolation, production and characterization of

bacteriocins produced by strains from indigenous environments. Pakistan Journal of

Botany, 45, 261-267.

Nazim, K., Ahmed, M., Khan, M. U., Khan, N., Wahab, M. and Siddiqui, M. F. (2010). An

assessment of the use of Avicennia marina forsk vierh. to reclaim waterlogged and

saline agricultural land. Pakistan Journal of Botany, 42(4), 2423-2428.

Nazim, K. Ahmed, M. O., Shaukat, S. S., Khan, M. U., Rao, T. A., Ali, Q. M. and Sherwani,

S. K. (2012). Distribution and diversity of airborne microflora under mangrove forest

at Sandspit Area Karachi, Pakistan. Science, Technology and Development, 31(4),

305-311.

Nazim, K., Ahmed, M., Shaukat, S. S. and Khan, M. U. (2013). Seasonal variation of litter

accumulation and putrefaction with reference to decomposers in a mangrove forest in

Karachi, Pakistan. Turkish Journal of Botany, 37(4), 735-743.

Nazim, K., Ahmed, M., Shaukat, S. S., Khan, M. U. and Ali, Q. M. (2013). Age and growth

rate estimation of grey mangrove Avicennia marina (Forsk.) Vierh from Pakistan.

Pakistan Journal of Botany, 45(2), 535-542.

Nedwell, D. B. (1994). Dynamic nature of the turnover of organic carbon, nitrogen and

sulphur in the sediments of a Jamaican mangrove forest. Marine Ecology Progress

Series, 110, 223-231.

224

Nedwell, D. B., Blackburn, T. H. and Wiebe, W. J. (1994). Dynamic nature of the turnover

of organic carbon, nitrogen and sulfur in the sediments of a Jamaican mangrove

forest. Marine Ecology Progress Series, 110, 223–231.

Negri, R. M., Montoya, N. G., Carreto, J. I., Akselman, R., Inza, D., Steidinger, K. A.,

Landsberg, J. H., Tomas, C. R. and Vargo, G. A. (2004). Harmful Algae. Harmful

Algae 2002.

Neue, H.U. (1985). Organic matter dynamics in wetland soils. Wetland soils,

Characterization, classification and utilization. International rice research institute,

Los Banos, Laguna, Philippines, 109-122.

Nielsen, L P., Christensen, P. B., Revsbech, N. P., and Sorensen, J. (1990). Denitrification

and photosynthesis in stream sediment studied with micro sensor and whole-core

techniques. Limnology and Oceanography, 35, 1135-1144.

Nixon, S. W., Oviatt, C. A. and Hale, S. S. (1976). Nitrogen regeneration and the

metabolism of coastal marine bottom communities (269-283). University of Rhode

Island, Sea Grant Marine Advisory Service.

Noaman, N. H., Fattah, A., Khaleafa, M. and Zaky, S. H. (2004). Factors affecting

antimicrobial activity of Synechococcus leopoliensis. Microbiological Research,

159(4), 395-402.

Noffke, N., Knoll, A.H. and Grotzinger, J.P. (2002). Sedimentary controls on the formation

and preservation of microbial mats in siliciclastic deposits: a case study from the

Upper Neoproterozoic Nama Group, Namibia. Palaios, 17, 533–544.

Noffke, N. (2010). Geobiology: Microbial mats in sandy deposits from the Archean Era to

today. Springer Science and Business Media, 194.

Noor, N., Shaukat, S.S. and Naseem, S. (2015). Evaluation of Elemental Composition of

Avicennia marina and Associated Soil, Karachi Coast, Pakistan. Journal of Coastal

Research.

Nunes, B. S., Carvalho, F. D., Guilhermino, L. M. and Van Stappen, G. (2006). Use of the

genus Artemia in ecotoxicity testing. Environmental pollution, 144(2), 453-462.

225

Nunnery, J. K., Mevers, E. and Gerwick, W. H. (2010). Biologically active secondary

metabolites from marine cyanobacteria. Current opinion in biotechnology, 21(6),

787-793

Nuzhat A., Jamil N., Khan O.Y., Yasmeen S., Haq Z., Ahmed V. and Rahman A. (2000).

Comercially important products from marine bacteria: Marine Biotechnology.

Proceedings of national ONR symposium on Arabian Sea as a Resource of

Biological Diversity. University of Karachi, Centre of Excellence in Marine Biology,

104-114.

Odate, T., Yanada, M., Castillo, L. V. and Maita, Y. (1990). Distribution of cyanobacteria

and other picophytoplankton in the western North Pacific Ocean, summer 1989.

Journal of the Oceanographical Society of Japan, 46(4), 184-189.

Ogunbanwo, S. T., Sanni, A. I. and Onilude, A. A. (2003). Characterization of bacteriocin

produced by Lactobacillus plantarum F1 and Lactobacillus brevis OG1. African

Journal of Biotechnology, 2(8), 219-227.

Okogwu, I. O. and Alex, U.O. (2008). Cyanobacteria abundance and its relationship to water

quality in the Mid-Cross River floodplain, Nigeria. Revista de biología tropical,

57(1-2), 33-43.

Oliveira, S. S., Abrantes, J., Cardoso, M., Sordelli, D. and Bastos, M. C. F. (1998).

Staphylococcal strains involved in bovine mastitis are inhibited by Staphylococcus

aureus antimicrobial peptides. Letters in applied microbiology, 27(5), 287-291.

Olsson, M. O. and Falkengren-Grerup, U. (2000). Potential nitrification as an indicator of

preferential uptake of ammonium or nitrate by plants in an oak woodland

understorey. Annals of Botany, 85(3), 299-305.

Oseni, O. A. and Ekperigin, M. M. (2013). Isolation and Activity of Alpha Amylase from

Selected Bacteria Strains In the Forest Soil. Global Journal of Bio-Science and

Bioengineering, 2, 17-20.

Ovalle, A. R. C., Rezende, C. E., Lacerda, L. D. and Silva, C. A. R. (1990). Factors

affecting the hydrochemistry of a mangrove tidal creek, Sepetiba Bay, Brazil.

Estuarine, Coastal and Shelf Science 31, 639–650.

226

Özbay, H. (2011). Composition and abundance of phytoplankton in relation to physical and

chemical variables in The Kars River, Turkey. International Journal of Experimental

Botany, 80, 85-92.

Pajdak-Stós, A., Fiakowska, E. and Fyda, J. (2001). Phormidium autumnale (Cyanobacteria)

defense against three ciliate grazer species. Aquatic Microbial Ecology, 23(3), 237-

244.

Panagoula, B., Panayiota, M. and Iliopoulou-Georgudaki, J. (2002). Acute toxicity of TBT

and IRGAROL in Artemia salina. International Journal of Toxicology, 21, 231–233.

Pansu, M. and Gautheyrou J. (2007). Handbook of soil analysis, mineralogical, organic and

inorganic methods. (2ndEd.) SSBM, NY. USA.

Pattanaik, C., Reddy, C. S., Dhal, N. K. and Das, R. (2008). Utilization of mangrove forests

in Bhitarkanika wildlife sanctuary, Orissa. Indian Journal of Traditional Knowledge,

7(4), 598-603.

Pawar, S. T. and Puranik, P. R. (2008). Screening of terrestrial and freshwater halotolerant

cyanobacteria for antifungal activities. World Journal of Microbiology and

Biotechnology, 24(7), 1019-1025.

Pederson, M.F., Nielson, S.L. and Banta, G.T. (2004). Interactions between vegetation and

nutrient dynamics in coastal marine ecosystems: an introduction. In: Estuarine

nutrient cycling: the influence of primary producers, Nielsen,

S.L., Banta, G.T., Pederson, M.F. (Eds.). Kluwer Academic Publishers, 1-16.

Phang, S.M. and W.L. Chu. (1999). University of Malaya, Algae culture Collection, Cata-

logue of Strains. Institute of Post Graduate Studies and Research, University of

Malaya, Kuala Lumpur, Malaysia, 77.

Piccardi, R., Frosini, A., Tredici, M. R. and Margheri, M. C. (2000). Bioactivity in free-

living and symbiotic cyanobacteria of the genus Nostoc. Journal of applied

phycology, 12(3-5), 543-547.

Pierson, B., Oesterle, A. and Murphy, G. L. (1987). Pigments, light penetration, and

photosynthetic activity in the multi-layered microbial mats of Great Sippewissett Salt

Marsh, Massachusetts. FEMS Microbiology Ecology, 3(6), 365-376.

227

Pinckney, J. and Zingmark, R. G. (1993). Biomass and production of benthic microalgal

communities in estuarine habitats. Estuaries, 16(4), 887-897.

Pirzada, Z.A., Nasir, M. and Rasool, S.A. (2000). Bacteriocins of marine bacteria: Activity

spectrum and biochemical characterization. In: Proceedings of National ONR

Symposium On Arabian Sea as a Resource of Biological Diversity, 166-171.

Platas, G., Meseguer, I. And Amils, R. (2002). Purification and biological characterization

of halocin H1 from Haloferax mediterranei M2a. International Microbiology, 5, 15-

19.

Powell. J.E. (2006). Bacteriocins and Bacteriocin Producers in Kefir and Kefir grains

(Master’s Thesis). Department of food Science, Stellenbosch University.

Prabakaran, M. (2011). In vitro antimicrobial potentials of marine Oscillatoria species.

Asian Journal of Plant Science and Research, 1, 58-64.

Prabu, V. A., Rajkumar, M. and Perumal, P. (2008). Seasonal variations in physico-chemical

characteristics of Pichavaram mangroves, southeast coast of India. Journal of

Environmental Biology, 29(6), 945-950.

Prescott, L. M., Harley, J. P. and Klein, D. A. (1998). Microbiology with Microbes in

Motion. (4th ed) McGraw-Hill, U.S.A.

Puyana, M., Acosta, A., Bernal, -S. K., Velásquez, -R. T. and Ramos, F. (2015). Spatial

scale of cyanobacterial blooms in Old Providence Island, Colombian Caribbean.

Universitas Scientiarum, 20(1), 83-105.

Qasim, R., Barkati, S., Siddique, P. J. A. and Ilyas, M. (1986). Biochemical composition of

the mangrove, Avicennia marina, foliage. Pakistan Journal of Scientific and

Industrial Research (Pakistan).

Qureshi, M.T. (1990). Experimental plantation for Rehabilitation of mangrove forests in

Pakistan. First Report. UNDP/UNESCO Regional Projects for Research and its

application to the management of the Mangroves of Asia and the Pacific

(RAS/86/120). Sind Forest Department. Government of Sind, Karachi, Pakistan.

228

Qureshi, M. T. (1996). Significance of the Mangrove Ecosystem for Coastal People in

Pakistan. In: ISME, Mangrove ecosystems Proceedings number 4, Coastal

Ecosystems Unit, IUCN Pakistan, 85.

Qureshi, N.A. and Sultana, R. (1999). Temporal variations in the abundance distribution

and diversity of meiobenthos from the mangrove ecosystem dynamic on the Indus

delta. Sindh forest and wildlife department government of Sindh and world bank.

132-140.

Qureshi, N.A. and Sultana, R. (2001). Textural composition of mangrove sediment in the

Sandspit back water. Pakistan Journal of marine Biology, 7, 343-355.

Qureshi, N. A. and Saher, N. U. (2012). Burrow morphology of three species of fiddler crab

(Uca) along the coast of Pakistan. Belgian Journal of Zoology, 142(2), 114-126.

Qureshi, N. A., Farah, N. and Saher, N. U. (2015). Spatial and temporal variations in the

community structure of meiobenthos in the mangrove area near the Karachi coast,

Pakistan Intternational Journal of Fauna and Biological Studies, 2(2), 23-29.

Qureshi, N. A., Farah, N. and Saher, N. U. (2016). Variations in distribution and abundance

of meiobenthos communities in mangrove creek areas along the coast of Karachi,

Pakistan. Indian Journal of Geo Marine Sciences, 45(4) 546-555.

Qureshi, R. M., Sajjad, M. I., Mashiatullah, A., Waqar, F., Jan, S., Akram, M., Khan, S. H.

and Siddiqui, S. A. (1997). Isotopic investigations of pollution transport in shallow

marine environments off the Karachi Coast, Pakistan. In: Proceedings of the

International Symposium on Isotope Techniques in the Study of Past and Current

Environmental Changes in the Hydrosphere and the Atmosphere, 14-18, 353–365.

R Development Core Team. (2012). R, A Language and Environment for Statistical

Computing. R Foundation for Statistical Computing, Vienna, Austria.

http,//www.R-project.org/. Accessed, December 2015.

Rabalais, N. N. (2002). Nitrogen in aquatic ecosystems. AMBIO: A Journal of the Human

Environment, 31(2), 102-112.

Rajaram, G., Manivasagan, P., Gunasekaran, U., Ramesh, S., Ashokkumar, S., Thilagavathi,

B., and Saravanakumar, A. (2010). Isolation, identification and characterization of

229

bacteriocin from Lactobacillus lactis and its antimicrobial and cytotoxic properties.

African Journal of Pharmacy and Pharmacology, 4(12), 895-902.

Rajasekar, K.T., Peramal, P. and Santhanam, P. (2005). Phytoplankton diversity in the

Coleroon estuary, southeast coast of India. Journal of the Marine Biological

Association of the United Kingdom, 47, 127-132.

Rajesh,D., S. Karthikeyan, and G. Jayaraman. 2012. Isolation and partial characterization of

a new bacteriocin from Bacillus Pumilus Dr2 isolated from sea water. CIBTech

Journal of Microbiology, 1(2-3): 33-41.

Ram, R.J., VerBerkmoes, N.C., Thelen, M.P., Tyson, G.W., Baker, B.J., Blake, R.C., Shah,

M., Hettich, R.L. and Banfield, J.F. (2005). Community proteomics of a natural

microbial biofilm. Science, 308, 1915–1920.

Ramanathan, A.L. (1997). Sediment characteristics of the Pichavaram mangrove

environment, southeast coast of India. Indian Journal of Marine Sciences, 26, 319-

322.

Rao, C.S.V.R. (1994). Antimicrobial activity of cyanobacteria. International Journal of

Marine Science, 23, 55-56.

Rao, D.L.N. and Burns, R.G. (1990). The effect of surface growth of blue green-algae and

bryophytes on some microbiological, biochemical, and physical soil properties.

Biology and fertility of soils, 9(3), 239-244.

Rasch, M. and Knöchel, S. (1998). Variations in tolerance of Listeria monocytogenes to

nisin, pediocin PA‐1 and bavaricin A. Letters in Applied Microbiology, 27(5), 275-

278.

Rashid, M. and Abbas, S.H. (2011). Spread of Prosopis Juliflora on the coastal wild life

sanctuary, Sandspit/Hawkes bay, Karachi. Pakistan Journal of Weed Science

Research, 30(2), 17.

Rautio, M. and Vincent, W. F. (2006). Benthic and pelagic food resources for zooplankton

in shallow high‐latitude lakes and ponds. Freshwater Biology, 51(6), 1038-1052.

230

Rawat, I., Kumar, R. R., Mutanda, T. and Bux, F. (2011). Dual role of microalgae:

phycoremediation of domestic wastewater and biomass production for sustainable

biofuels production. Applied Energy, 88(10), 3411-3424.

Ray, R., Majumder, N., Das, S., Chowdhury, C. and Jana, T.K. (2014). Biogeochemical

cycle of nitrogen in a tropical mangrove ecosystem, east coast of India. Marine

Chemistry, 167, 33-43.

Reay, W. G., Gallagher, D. L. and Simmons, G. M. Jr. (1992). Groundwater discharge

and its impact on surface water quality in a Chesapeake Bay inlet. Water Resources

Bulletin , 28(6), 1121-1134.

Reddy, K. R. and DeLaune, R. D. (2008). Biogeochemistry of wetlands: science and

applications. Crc Press, 757p.

Redekar P. D. and Wagh, A. B. (2000). Relationship of fouling diatom number and

chlorophyll-a value from Zuari estuary, Goa (West coast of India). Seaweed

Research and Utilization., 22 (1,2), 173-181.

Rehman, Z., Khanum, F. and Kazmi, S. J. H. (2016). Evaluation of Land Cover Changes at

the Coast of Sindh through Successive Landsat Imageries. Journal of Earth Science

and Climatic Change, 7(1), 1-7.

Rejil, T. (2012). Microalgal vegetation in the selected Mangrove Ecosystems of Kerala

(Doctoral dissertation), Cochin University of Science and Technology.

Repka, S., Veen, A. and Vijverberg, J. (1999). Morphological adaptations in filtering

screens of Daphnia galeata to food quantity and food quality. Journal of Plankton

Research, 21(5), 971-989.

Rhoades, J.D. and Chanduvi, F. (1999). Soil salinity assessment, Methods and interpretation

of electrical conductivity measurements. Food and Agriculture Organization, 57.

Richert, L., Golubic, S., Le Guédès, R., Ratiskol, J., Payri, C. and Guezennec, J. (2005).

Characterization of exopolysaccharides produced by cyanobacteria isolated from

Polynesian microbial mats. Current microbiology, 51(6), 379-384.

231

Ricklefs, R. E., Schwarzbach, A. E. and Renner, S. S. (2006). Rate of lineage origin explains

the diversity anomaly in the world’s mangrove vegetation. The American Naturalist,

168(6), 805-810.

Rietz, D. N. and Haynes, R. J. (2003). Effects of irrigation-induced salinity and sodicity on

soil microbial activity. Soil Biology and Biochemistry, 35(6), 845-854.

Rigonato, J., Alvarenga, D. O., Andreote, F. D., Dias, A. C. F., Melo, I. S., Kent, A. and

Fiore, M. F. (2012). Cyanobacterial diversity in the phyllosphere of a mangrove

forest. FEMS microbiology ecology, 80(2), 312-322.

Rippka, R. (1988). Isolation and purification of cyanobacteria. In: Methods in Enzymology,

Packer, L. and Glazer, A. N. (Eds.). Academic Press, UK, 167: 3-27.

Rivera-Monroy, V. H., Day, J. W., Twilley, R. R., Vera-Herrera, F. and Coronado-Molina,

C. (1995). Flux of nitrogen and sediment in a fringe mangrove forest in Terminos

Lagoon, Mexico. Estuarine, Coastal and Shelf Science, 40(2), 139-160.

Rivera-Monroy, V.H., Twilley, R.R., Boustany, R.G., Day, W.J., Vera-Herrera, F., Ramirez,

M.C. (1995). Direct denitrification in mangrove sediments in Términos Lagoon,

Mexico. Marine Ecology Progress Series, 126, 97–109.

Rivera-Monroy, V.H. and Twilley, R.R. (1996). The relative role of denitrification and

immobilization in the fate of inorganic nitrogen in mangrove sediments (Terminos

Lagoon, Mexico). Limnology and Oceanography, 41, 284–296.

Rizvi, M. A. and Shameel, M. (2004). Studies on the bioactivity and elementology of marine

algae from the coast of Karachi, Pakistan. Phytotherapy Research, 18(11), 865-872.

Rizvi, S. H. N., Saleem, M. and Baquer, J. (1988). Steel mill effluents: influence on the

Bakran Creek environment. Marine science of the Arabian sea, 549-569.

Rizvi, S. H. N. (1997). Status of marine pollution in context of coastal zone management in

Pakistan. In: Coastal zone Management imperative for maritime developing nations.

Haq, B. U., Haq, S. A., Kullenberg, G. and Stel, J. H. (Eds.). Kluwer Academic

Publisher, 347- 370.

232

Rizzo, W. M. and Christian, R. R. (1996). Significance of subtidal sediments to

heterotrophically-mediated oxygen and nutrient dynamics in a temperate estuary.

Estuaries, 19(2), 475-487.

Robertson, A.I. and Alongi, D.M. (Eds.). (1992). Tropical mangrove ecosystems. 137-172.

Washington, DC, American Geophysical Union.

Robertson, A.I., Alongi, D.M. and Boto, D.G. (1992). Food Chains and carbon fluxes. In:

Robertson, A.I. and Alongi, D.M. (Eds.) Tropical Mangrove Ecosystems, Coastal

and Estuarine Series 41. American Geophysical Union, Washington, USA.

Roger, P. A., Jimenez, R. and Santiago, -A. S. (1991). Methods for studying blue-green

algae in ricefields: distributional ecology, sampling strategies, and estimation of

abundance. International Rice Research Institute, 150, 3-19.

Rönnbäck, P. (1999). The ecological basis for economic value of seafood production

supported by mangrove ecosystems. Ecological Economics, 29(2), 235-252.

Rueda‐Puente, E., Castellanos, T., Troyo‐Diéguez, E., Díaz de León‐Alvarez, J. L., &

Murillo‐Amador, B. (2003). Effects of a Nitrogen‐Fixing Indigenous Bacterium

(Klebsiella pneumoniae) on the Growth and Development of the Halophyte

Salicornia bigelovii as a New Crop for Saline Environments. Journal of agronomy

and crop science, 189(5), 323-332.

Russow, R., Stange, C. F. and Neue, H. U. (2009). Role of nitrite and nitric oxide in the

processes of nitrification and denitrification in soil: results from 15 N tracer

experiments. Soil Biology and Biochemistry, 41(4), 785-795.

Sablon, E., Contreras, B. and Vandamme, E. (2000). Antimicrobial peptides of lactic acid

bacteria: mode of action, genetics and biosynthesis. In New Products and New Areas

of Bioprocess Engineering, Springer Berlin Heidelberg, 21-60.

Saeed S., Rasool R.J., Ahmed S., Khanum T., Khan M.B., Abbasi A. and Ali S.A. (2006).

New insight in Staphylococcin research: Bacteriocin and/ or BLIS produced by

S.aureus AB188. World Journal of Microbiology and Biotechnology, 22(7), 713-

722.

233

Sahoo, K. and Dhal, N. K. (2009). Potential microbial diversity in mangrove ecosystems: a

review. Indian Journal of Marine Sciences, 38(2), 249.

Saifullah, S.M. and Nizamuddin, M. (1977). Studies of the marine algae from Pakistan,

Ulvales. Botanica Marina, 20(8), 521-536.

Saifullah, S. M. and Elahi, E. (1992). Pneumatophore density and size in mangroves of

Karachi, Pakistan. Pakistan Journal of Botany, 24, 05-10.

Saifullah, S. M. and Chaghtai, F. (1993). Marine benthic diatoms in mangrove habitat of

Sandspit, Karachi. In: Proceeding of National Seminar on Study and Management in

Coastal Zones in Pakistan, Kazmi, Q.B. and Tirmizi, N.M. (Eds.). BCC and T. Press,

Karachi, 239-247.

Saifullah, S. M., Shaukat, S. S. and Shams, S. (1994). Population structure and dispersion

pattern in mangroves of Karachi, Pakistan. Aquatic Botany, 47(3-4), 329-340.

Saifullah, S. M. and Taj, G. (1995). Marine algal epiphytes on pneumatophores of

mangroves of Karachi. The Arabian Sea Living Marine Resources and the

Environment, AIBS, Vangurad Books (PVT) Ltd., Lahore, 407-417.

Saifullah, S.M. (1997). Management of the Indus Delta mangroves. In: Coastal zone

Management Imperative for Maritime Developing Nations, Haq, B.U., Haq, S.M.,

Kullenberg, G. and Stel, J.H. (Eds.). Kluwer-Academic-Publ., Dordrecht-The-

Netherlands. 333-346.

Saifullah, S. M., and Rasool, F. (1998). Notes and news standing crop of macroalgal in

mangrove habitat of Sandspit area, Karachi. Pakistan Journal of Marine Sciences,

7(1), 61-64.

Saifullah, S. M. and Rasool, F. (2002). Mangroves of Miani Hor lagoon on the north

Arabian Sea coast of Pakistan. Pakistan Journal of Botany, 34(3), 303-310.

Saifullah, S. M., Nizamuddin, M. and Gul, S. (2005). A New Species of Vaucheria

Epiphytic on Mangroves. Botanica Marina, 46(6), 531-533.

Saifullah, S. M. and Ahmed, W. (2007). Epiphytic algal biomass on pneumatophores of

mangroves of Karachi, Indus Delta. Pakistan Journal of Botany, 39(6), 2097-2102.

234

Saifullah, S. M., Chaghtai, F. and Akhtar, S. (2007). Dispersal and establishment of

mangrove propagules in an exposed coastal habitat of Indus Delta. Pakistan Journal

of Botany, 39(2), 577.

Saimmai, A., Tani, A., Sobhon, V. and Maneerat, S. (2012). Mangrove sediment, a new

source of potential biosurfactant-producing bacteria. Annals of microbiology, 62(4),

1669-1679.

Sakhia, N., Prajapati, S., Shetty, V., Bhatt, S. and Bhadalkar, A. (2016). Study of Bacterial

Diversity of Mangroves Rhizosphere. Open Journal of Marine Science, 6(01), 23.

Sakthivel, K. and Kathiresan, K. (2012). Antimicrobial activities of marine cyanobacteria

isolated from mangrove environment of south east coast of India. Journal of Natural

Products, 5, 147-156.

Sakthivel, K. and Kathiresan, K. (2013). Cyanobacterial diversity from mangrove sediment

of south east coast of India. Asian Journal of Biodiversity, 4, 190-203.

Saleem, F., Ahmad, S., Yaqoob, Z. and Rasool, S.A. (2009). Comparative study of two

bacteriocins produced by representative indigenous soil bacteria. Pakistan Journal of

Pharmaceutical Sciences, 22(3), 252-258.

Salik, K. M., Jahangir, S., Hasson, -U, S. (2015). Climate change vulnerability and

adaptation options for the coastal communities of Pakistan. Ocean and Coastal

Management, 112, 61-73.

Sánchez, -O., A. C., Luna, -G., A., Campa -C., Á. I., Escamilla,-M., R., del Carmen Flores, -

M., M., and Mazón, -S., J. M. (2015). Isolation and characterization of potential

probiotic bacteria from pustulose ark (Anadara tuberculosa) suitable for shrimp

farming/Aislamiento y caracterización de bacterias de la almeja" pata de

mula"(Anadara tuberculosa) con potencial probiótico para el cultivo de camarón.

Latin American Journal of Aquatic Research, 43(1), 123.

Sánchez-Fortún, S., Sanz, F. and Barahona, M. V. (1996). Acute toxicity of several

organophosphorous insecticides and protection by cholinergic antagonists and 2-

PAM on Artemia salina larvae. Archives of environmental contamination and

toxicology, 31(3), 391-398.

235

Saravanakumar, A., Sesh Serebiah, J., Thivakaran, G.A. and Rajkumar, M. (2008). Benthic

macro faunal assemblage in the arid zone mangroves of gulf of Kachchh – Gujarat.

Journal of Ocean University of China, 6, 33-39.

Sardinha, M., Müller, T., Schmeisky, H. and Joergensen, R. G. (2003). Microbial

performance in soils along a salinity gradient under acidic conditions. Applied Soil

Ecology, 23(3), 237-244.

Sasekumar, A. (1974). Distribution of macrofauna on a Malayan mangrove shore. The

Journal of Animal Ecology, 51-69.

Satpathy, K. K., Mohanty, A. K., Sahu, G., Sarguru, S., Sarkar, S. K. and Natesan, U.

(2011). Spatio-temporal variation in physicochemical properties of coastal waters off

Kalpakkam, southeast coast of India, during summer, pre-monsoon and post-

monsoon period. Environmental monitoring and assessment, 180(1-4), 41-62.

Sattar, N and N. Ahmed. 1988. Convertogenetics Effect of Chemical Pollution on Marine

bacteria and their mutagen testing. In: Marine Sciences of Arabian sea. Thompson,

F.M. and Tirmizi, N.M. (Eds.). American Institute of Biological Sciences.

Washington D.C., 531-538.

Schaeffer, D.J. and Krylov, V.S. (2000) Anti-HIV activity of extracts and compounds from

algae and cyanobacteria. Ecotoxicology and Environmental Safety, 45, 208-227.

Schlegel, I., Doan, N. T., de Chazal, N. and Smith, G. D. (1998). Antibiotic activity of new

cyanobacterial isolates from Australia and Asia against green algae and

cyanobacteria. Journal of Applied Phycology, 10(5), 471-479.

Schmidt, E. L., and Belser, L. W. (1982). Nitrifying bacteria: Methods of soil analysis. Part

2. Chemical and microbiological properties. (2nd Ed.) ASA, SSSA, 1027-1042.

Scholz, B. and Liebezeit, G. (2012). Screening for biological activities and toxicological

effects of 63 phytoplankton species isolated from freshwater, marine and brackish

water habitats. Harmful Algae, 20, 58-70.

Schwartz, R.E., Hirsch, C.F. and Sesin, D.F. (1990). Pharmaceuticals from cultured algae.

Journal of Industrial Microbiology, 5, 113–124.

236

Scopes, R.K. (2013). Protein purification: principles and practice. USA: Springer Science

and Business Media.

Seckbach, J. (2007). Algae and cyanobacteria in extreme environments (Vol. 11). Springer

Science and Business Media

Sen, N. and Naskar, K. (2003). Algal flora of Sundarbans mangals. Daya Books.

Sengupta, A. and Chaudhuri, S. (1990). Halotolerant Rhizobium strains from mangrove

swamps of the Ganges River Delta. Indian Journal of Microbiology, 30, 483–484.

Shafique, S. (2004). Studies on the nutrient and energy flow in the mangrove ecosystem

(Doctoral dissertation). Centre of Excellence in Marine Biology, University of

Karachi, Pakistan.

Shafique, S., Siddiqui, P. J. A., Aziz, R. A., Burhan, Z. and Mansoor, S. N. (2010). Weight

loss and changes in organic, inorganic and chlorophyll contents in three species of

seaweeds during decomposition. Pakistan Journal of Botany, 42(4), 2599-2604.

Shafique, S., Siddiqui, P. J. A., Aziz, R. A., Burhan, Z., Mansoor, S. N. and Nafisa, S.

(2013). Variations in carbon and nitrogen contents during decomposition of three

macroalgae inhabiting Sandspit backwater, Karachi. Pakistan Journal of Botany,

45(3), 1115-1118.

Shafique, S., Siddiqui, P. J. A. and Farooqui, Z. (2015). Distribution and Zonation Patterns

of Cerithideopsilla cingulata (Gmelin 1791) (Gastropoda: Potamididae) in Mangrove

Stands at Sandspit Backwater, Karachi, Pakistan. Pakistan Journal Zoology, 47(6),

1517-1523.

Shah, V., Garg, N. and Madamwar, D. (2001). Record of the marine cyanobacteria from the

rocky shores of Bet-Dwarka and Okha, India. Acta Botanica Malacitana, 26, 188-

194.

Shameel, M. and Tanaka, J. (1992). A preliminary check-list of marine algae from the coast

and inshore waters of Pakistan. In: Cryptogamic flora of Pakistan, Nakaika, T. and

Malik, S. (Eds.). National Science Museum, Tokyo, 1-64.

237

Shameel, M. (2001). Diversity exhibited by marine benthic algae inhabiting the coast of

Balochistan, Pakistan. Pakistan Journal of Marine Sciences, 10(2): 87-103.

Shayesteh, F., Ahmad, A. and Usup, G. (2014). Bacteriocin Production by a Marine Strain

of Bacills sp. Sh10: Isolation, Screening and Optimization of Culture Condition.

Biotechnology, 13(6), 273-281.

Siddiqui, P. J. A., and Qasim, R. (1986). Changes in dry weight, organic and inorganic

content and calorific value in decomposing mangrove, Avicennia marina, foliage. In:

Marine Science of the Arabian Sea. Proceedings of the International Conference,

Karachi, Pakistan, 393-400.

Siddiqui, P. J. A. and Qasim, R. (1990). Litter production and physicochemical conditions in

mangrove swamps at Karachi back waters and Bakran creek. Journal of Islamic

Academic Sciences, 3, 15-21.

Siddiqui, P. J. A. and Qasim, R. (1994). Variation in chemical constituents of mangrove

foliage Avicennia marina (Forsk.) Vierh. (Avicenniaceae). Pakistan Journal of

Scientific and Industrial Research, 37, 137-143.

Siddiqui, P. J. A., Mansoor, S. N., Zaib-un-Nisa, H. S., Shafique, S. and Farooq, S. (2000).

Associated fauna and flora of macro-algal puffs inhabiting mangrove stands at

Sandspit backwaters, Karachi. Pakistan Journal of Marine Biology, 6(1), 43-53.

Siddiqui, P. J. A., Farooq, S., Shafique, S. and Farooqi, Z. (2008). Conservation and

management of biodiversity in Pakistan through the establishment of marine

protected areas. Ocean and Coastal Management, 51(5), 377-382.

Siddiqui, P. J. A., Farooqui, Z., Valeem, E. E., Rasheed, M. Shafique, S. (2009). Studies on

decomposition rates of Avicennia and Rhizophora leaves on tidal mudflats in active

Indus Deltaic area of Pakistan. International Journal of Phycology and

Phycochemistry, 5(1), 93-98.

Siddiqui, S.K. 1990. Biochemical and Genetics Studies on indigenous bacterial Isolates.

M.Sc. Thesis. University, Karachi, Pakistan, l4-32.

238

Silambarasan, G., Ramanathan, T. and Kathiresan, K. (2012). Diversity of marine

cyanobacteria from three mangrove environment in Tamil Nadu Coast, south east

coast of India. Current Research Journal of Biological Sciences, 4(3), 235-238.

Simmons Jr., G.M. (1995). Sediment-water column oxygen and nutrient fluxes in nearshore

environments of the lower Delmarva Peninsula, USA. Marine Ecology Progress

Series, 118, 215-227.

Singh, J. S. and Kashyap, A. K. (2007). Variations in soil N-mineralization and nitrification

in seasonally dry tropical forest and savanna ecosystems in Vindhyan region, India.

Tropical Ecology, 48(1), 27-36

Singh, R., Sivasubramani, K., Jayalakshmi, S., Satheesh K.S. and Selvi C. (2013). Isolation

and production of bacteriocin by marine Lactobacillus fermentum SBS001.

International Journal of Current Microbiology and Applied Sciences, 2(4), 67-73.

Sivonen, K. (1990). Effects of light, temperature, nitrate, orthophosphate and bacteria on the

growth of the hepatotoxin by Oscillatoria agardhii strains. Applied Environmental

Microbiology, 56, 2658-2666.

Šmarda, J. and Taubeneck, U. (1968). Situation of colicin receptors in surface layers of

bacterial cells. Microbiology, 52(2), 161-172.

Smith, T. J., Boto, K. G., Frusher, S. D. and Giddins, R. L. (1991). Keystone species and

mangrove forest dynamics: the influence of burrowing by crabs on soil nutrient

status and forest productivity. Estuarine, coastal and shelf science, 33(5), 419-432.

Snedaker, S. C. (1984). Mangroves: A summary of knowledge with emphasis on Pakistan.

Marine geology and oceanography of Arabian Sea and Coastal Pakistan, 255-262.

Sohail, B. and Solaha, R. (2005). Species Composition and Faunal Diversity at Three Sites

of Sindh Mangroves. Pakistan journal of Zoology, 37(1), 17-31.

Soltani, N., Khavari-Nejad, R. A., Yazdi, M. T., Shokravi, S. and Fernandez-Valiente, E.

(2005). Screening of soil cyanobacteria for antifungal and antibacterial activity.

Pharmaceutical Biology. 43(5): 455–459.

239

Stal, L.J., van Gemerden, H. and Krumbein, W.E. (1985). Structure and development of a

benthic marine microbial mat. FEMS Microbiology Ecology, 31, 111–125.

Stal, L.J. (2000). Cyanobacterial mats and stromatolites. In: The ecology of cyanobacteria,

Their diversity in time and space, Whitton, B.A. and Potts, M. (Eds.). Dordrecht,

Kluwer Academic Publishers, 61-120.

Stanier, R. Y., Kunisawa, R., Mandel, M. and Cohen-Bazire, G. (1971). Purification and

properties of unicellular blue-green algae (order Chroococcales). Bacteriological

Reviews, 35(2), 171.

Steinberg, C. E. and Hartmann, H. M. (1988). Planktonic bloom‐forming Cyanobacteria and

the eutrophication of lakes and rivers. Freshwater Biology, 20(2), 279-287.

Steppe, T. F., Olson, J. B., Paerl, H. W., Litaker, R. W. and Belnap, J. (1996). Consortial N2

fixation: a strategy for meeting nitrogen requirements of marine and terrestrial

cyanobacterial mats. FEMS Microbiology Ecology, 21(3), 149-156.

Stolz, J. F. (1983). Fine structure of the stratified microbial community at Laguna Figueroa,

Baja California, Mexico. I. Methods of in situ study of the laminated sediments.

Precambrian Research, 20(2), 479-492.

Stolz, J.F. (2003). Structure of marine biofilms: flat laminated mats and modern marine

stromatolites. In: Fossil and Recent Biofilms: A NIatural History of the Impact of

Life on the Planet, Krumbein, W.E., Paterson, D.M. and Zavarzin, G. (Eds.), Kluwer

Academic Publishers, Dordrecht, 65–76.

Strickland, J. D. H. and Parsons, T. K. (1972). A practical hand book of seawater analysis.

Bulletion of fisheries research board Canada, 310.

Sudha, S. S. (2009). Marine Environment: A Potential Source for L-Asparaginase Producing

Microorganisms. IUP Journal of Biotechnology, 3(4).

Sugumar, R., Ramanathan, G., Rajarathinam, K., Jeevarathinam, A., Abirami, D. and

Bhoothapandi, M. (2011). Diversity of saltpan marine cyanobacteria from Cape

Comorin coast of Tamilnadu. Journal of Phytology, 3(9).

240

Sullivan, O. L., Ross, R. P. and Hill, C. (2002). Potential of bacteriocin-producing lactic

acid bacteria for improvements in food safety and quality. Biochimie, 84(5), 593-

604.

Sultana, R. and Mustaquim, J. (1993). On the occurrence and seasonal abundance of

juvenile penaeid shrimps from the backwaters of Karachi coast. In: Proceedings

national seminar on study and management in coastal zones in Pakistan, Tirmizi,

N.M. and Kazmi, Q.B. (Eds.), 33-41.

Sultana, R. and Mustaquim, J. (2003). Some physical parameters of the Sandspit

backwaters, Karachi Coast. Pakistan Journal of Science and Industrial Research, 46,

333-343.

Sultana, R. and Mustaquim, J. (2006). Population Structure of the Juvenile Penaeid Shrimps

Occurring in the Sandspit Backwaters of Karachi Coast, Pakistan. Pakistan Journal

of Scientific and Industrial Research, 49(2), 106.

Sundback, K. and McGlathery, K. (2005). Interactions between benthic macroalgal and

microalgal mats. Interactions between macro and microorganisms in marine

sediments. American Geophysical Union, Washington.

SUPARCO. (2006). Space research in Pakistan. 9. National Report to the 36th COSPAR

Scientific assembly Beijing, China.

Swarnakumar, N. S., Thangaradjou, T., Sivakumar, K. and Kannan, L. (2007). Distribution

of total heterotrophic bacteria in the coastal waters of the Great Nicobar with special

reference to human pathogens. National Academy Science Letters, 30(5-6), 129-137.

Taj, R. J., Aref, M. A. and Schreiber, B. C. (2014). The influence of microbial mats on the

formation of sand volcanoes and mounds in the Red Sea coastal plain, south Jeddah,

Saudi Arabia. Sedimentary Geology, 311, 60-74.

Tam, N. F. Y. and Wong, Y. S. (1993). Retention of nutrients and heavy metals in mangrove

sediment receiving wastewater of different strengths. Environmental Technology,

14(8), 719-729.

241

Tam, N. F. Y. and Wong, Y. S. (1998). Variations of soil nutrient and organic matter content

in a subtropical mangrove ecosystem. Water, Air and Soil Pollution, 103(1-4), 245-

261.

Tam, N. F. Y., Wong, A. H. Y., Wong, M. H. and Wong, Y. S. (2009). Mass balance of

nitrogen in constructed mangrove wetlands receiving ammonium-rich wastewater:

effects of tidal regime and carbon supply. Ecological engineering, 35(4), 453-462.

Tan, L. T. (2007). Bioactive natural products from marine cyanobacteria for drug discovery.

Phytochemistry, 68(7), 954-979.

Tan, L. T. (2010). Filamentous tropical marine cyanobacteria: a rich source of natural

products for anticancer drug discovery. Journal of applied phycology, 22(5), 659-

676.

Tariq, M., Dawar, S. and Mehdi, F. S. (2006). Isolation of fungi from Avicennia marina.

Pakistan Journal of Botany, 38(3), 805.

Tariq, M., Dawar, S., Mehdi, F. S. and Zaki, M. J. (2007). Antagonistic activity of bacterial

inoculum multiplied on Rhizophora mucronata Lamk., in the control of root

infecting fungi on mash bean and okra. Pakistan Journal of Botany, 39(6): 2159-

2165.

Tariq, M. and Dawar, S. (2011). Formulation of Avicennia marina pellets and its application

in controlling root diseases in leguminous and non- leguminous plants. Pakistan

Journal of Botany, 43(2), 1411-1415.

Taton, A., Grubisic, S., Ertz, D., Hodgson, D.A., Piccardi, R., Biondi, N., Tredici, M.R.,

Mainini, M., Losi, D., Marinelli, F. and Wilmotte, A. (2006). Polyphasic study of

Antarctic cyanobacterial strains. Journal of Phycology, 42, 1257–1270.

Ten Brink, B., Minekus, M., Van der Vossen, J.M. and Leer, R.J. (1994). Antimicrobial

activity of lactobacilli: preliminary characterization and optimization of production

of acidocin B, a novel bacteriocin produced by Lactobacillus acidophilus M46. The

Journal of applied bacteriology, 77(2), 140-148.

Thajuddin, N. and Subramanian, G. (1992). Survey of cyanobacterial flora of the southern

east coast of India. Botanica marina, 35(4), 305-314.

242

Tiedje, J.M. (1988). Ecology of denitrification and dissimilatory nitrate reduction to

ammonium. In: Biology of anaerobic microorganisms, Zehnder, A.J.B. (Ed.). Wiley,

New York, 179–244.

Todorov, S. D., Vaz-Velho, M. and Gibbs, P. (2004). Comparison of two methods for

purification of plantaricin ST31, a bacteriocin produced by Lactobacillus plantarum

ST31. Brazilian Journal of Microbiology, 35(1-2), 157-160.

Toledo, G., Bashan, Y. and Soeldner, A. (1995). Cyanobacteria and black mangroves in

Northwestern Mexico: colonization, and diurnal and seasonal nitrogen fixation on

aerial roots. Canadian Journal of Microbiology, 41(11), 999-1011.

Tolhurst, T. J. and Chapman, M. G. (2007). Patterns in biogeo-chemical properties of

sediments and benthic animals among different habitats in mangrove forests. Austral

Ecology, 32(7), 775-788.

Tomlinson, P.B. (1986). The Botany of Mangroves. Cambridge University Press.

Tong, L., Nakashima, S., Shibasaka, M., Katsuhara, M., and Kasamo, K. (2002). A novel

histidine-rich CPx-ATPase from the filamentous cyanobacterium Oscillatoria brevis

related to multiple-heavy-metal cotolerance. Journal of bacteriology, 184(18), 5027-

5035.

Turkmen, G. and Kazanci, N. (2010). Applications of various biodiversity indices to benthic

macroinvertebrate assemblages in streams of a national park in Turkey. Review of

Hydrobiology, 3(2), 111-125.

Twilley, R. R. and Kemp, W. M. (1987). Estimates of sediment denitrification and its

influence on the fate of nitrogen in Chesapeake Bay. Chesapeake Bay Liaison Office,

US Environmental Protection Agency.

Untawale, A. G. (1998). An Anthology of Indian Mangroves: Management of mangroves for

energy needs. 52-56. ENVIS Publication.

USDA-NRCS, (1996). Soil Quality Resource Concerns, Compaction. USDA-NRCS Soil

Quality Inst., Ames, IA.

http://www.statlab.iastate.edu/survey/SQI/sqihome.shtml

243

Utkilen, H. A. and Jolme, G.N. (1992). Toxin Production by Microcystis aeruginosa as a

Function of Light in Continuous Cultures and Its Ecological Significance. Applied

Environmental Microbiology, 58, 1321-1325.

Van Cleemput, O. and Samater, A. H. (1995). Nitrite in soils: accumulation and role in the

formation of gaseous N compounds. Fertilizer Research, 45(1), 81-89.

van Schaik, W., Gahan, C. G. and Hill, C. (1999). Acid-adapted Listeria monocytogenes

displays enhanced tolerance against the lantibiotics nisin and lacticin 3147. Journal

of Food Protection, 62(5), 536-540.

Vargo, G.A., Heil, C.A., Ault, D.N., Neely, M.B., Murasko, S., Havens, J., Lester, K.M.,

Dixon, L.K., Merkt, R., Walsh, J. and Weisberg, R. (2004). Harmful algae 2002.

Florida Fish and Wildlife Conservation Commission, Florida Institute of

Oceanography and Intergovernmental Oceanographic Commission of UNESCO, 14-

16.

Venkatesan, V. and Ramamurthy V.D. (1971). Marine microbiological studies of mangrove

swamps of Killai backwaters. Journal of the Oceanographical Society of Japan,

27(2), 51-55.

Verschuere, L., Rombaut, G., Sorgeloos, P. and Verstraete, W. (2000). Probiotic bacteria as

biological control agents in aquaculture. Microbiology and molecular biology

reviews, 64(4), 655-671.

Victor, S., Golbuu, Y., Wolanski, E. and Richmond, R. H. (2004). Fine sediment trapping in

two mangrove-fringed estuaries exposed to contrasting land-use intensity, Palau,

Micronesia. Wetlands Ecology and Management, 12(4), 277-283.

Vidal, M. (1994). Phosphate dynamics tied to sediment disturbances in Alfacs Bay (NW

Mediterranean). Marine Ecology Progress Series, 110, 211-221.

Vijayakumar, S., Thajuddin, N. and Manoharan, C. (2007). Biodiversity of cyanobacteria in

industrial effluents. Acta Botanica Malacitana, 32, 27-34.

Vijayakumar, S. and Manoharan, C. (2012). Treatment of dye industry effluent using free

and immobilized cyanobacteria. Journal of Bioremediation and Biodegradation,

3(10), 165.

244

Visscher, P. T. and Stolz, J. F. (2005). Microbial mats as bioreactors: populations, processes,

and products. Palaeogeography, Palaeoclimatology, Palaeoecology, 219(1), 87-100.

Volk, R.B. and Furkert, F. H. (2006). Antialgal, antibacterial and antifungal activity of two

metabolites produced and excreted by cyanobacteria during growth. Microbiological

Research, 161, 180-186.

Waliullah, T.M., Yeasmin, M.A., Alam, M.A., Islam, M.W. and Hassan, P. (2016). Analysis

of Toxicity Assay of Crude Drug; Clerodendrum infortunatum L. Journal of Drug

Research and Development, 2(2). 2470-1009.

Walters, B.B., Rönnbäck, P., Kovacs, J.M., Crona, B., Hussain, S.A., Badola, R., Primavera,

J.H., Barbier, E. and Dahdouh, -G., F. (2008). Ethnobiology, socio-economics and

management of mangrove forests: A review. Aquatic Botany, 89(2), 220-236.

Weisburg, W.G., Barns, S.M., Pelletier, D.A., and Lane, D.J. (1991). 16S ribosomal DNA

amplification for phylogenetic study. Journal of bacteriology, 173(2), 697-703

Wheeler, P.A. and Kirchman, D.L. (1986). Utilization of inorganic and organic nitrogen by

bacteria in marine systems. Limnology and Oceanography, 31(5), 998‐1009.

Widdows, J., Brinsley, M. D., Bowley, N. and Barrett, C. (1998). A benthic annular flume

for in situ measurement of suspension feeding/bio deposition rates and erosion

potential of intertidal cohesive sediments. Estuarine, Coastal and Shelf Science,

46(1), 27-38.

Wilke, B.M. (2005). Chp.2 Determination of Chemical and Physical Soil Properties. In:

Manual for soil analysis-monitoring and assessing soil bioremediation, Margesin, R.

and Schinner, F. (Eds.). SSBM., 50.

Wilkie, M.L. and Fortuna, S. (2003). Status and trends in mangrove area extent worldwide.

Forest Resources Assessment Working Paper No. 63. Forest Resources Division.

FAO, Rome.

Wong, Y.S., Tam, N.F.Y., Lan, C.Y. (1997). Mangrove wetlands as wastewater treatment

facility, a field trial. Hydrobiologia, 352, 49–59.

245

Wooller, M., Smallwood, B., Jacobson, M., Fogel, M. (2003). Carbon and nitrogen stable

isotopic variation in Laguncularia racemosa (L.) (white mangrove) from Florida and

Belize, implications for trophic level studies. Hydrobiologia, 499, 13-23.

Woulds, C., Schwartz, M. C., Brand, T., Cowie, G. L., Law, G. and Mowbray, S. R. (2009).

Porewater nutrient concentrations and benthic nutrient fluxes across the Pakistan

margin OMZ. Deep Sea Research Part II: Topical Studies in Oceanography, 56(6),

333-346.

Wu, H., Zou, D. and Gao, K. (2008). Impacts of increased atmospheric CO2 concentrat ion

on photosynthesis and growth of micro-and macro-algae. Science in China Series C:

Life Sciences, 51(12), 1144-1150.

WWF. (2005). GIS Remote Sensing Based Assessment of Mangrove Resources of Selected

Project Sites of Indus Delta and Makran Coast. 55. Pakistan.

Yan, D., Wang, Q., Mao, L., Ma, T., Li, Y., Ouyang, C., Guo, M. and Cao, A. (2015).

Interaction between nitrification, denitrification and nitrous oxide production in

fumigated soils. Atmospheric Environment. 103, 82-86.

Yan, L.L., Han, N.N., Zhang, Y.Q., Yu, L.Y., Chen, J., Wei, Y.Z., Li, Q.P., Tao, L., Zheng,

G.H., Yang, S.E. and Jiang, C.X. (2010). Antimycin A18 produced by an endophytic

Streptomyces albidoflavus isolated from a mangrove plant. The Journal of

antibiotics, 63(5), 259-261.

Yasmeen, Z. A., Shafique, S., Zaib-Un-Nisa, B. and Siddique, P.J.A. (2016). Seasonal

abundance of six dominant filamentous cyanobacterial species in microbial mats

from mangrove backwaters in Sandspit, Pakistan. Pakistan Journal of Botany, 48(4),

1715-1722.

Yasmin, H. and Bano, A. (2011). Isolation and characterization of phosphate solubilizing

bacteria from rhizosphere soil of weeds of Khewra salt range and Attock. Pakistan

Journal of Botany, 43(3), 1663-1668.

Yasmin, H., Bano, A. and Samiullah. (2013). Screening of PGPR isolates from semi-arid

region and their implication to alleviate drought stress. Pakistan Journal of Botany,

45, 51-58.

246

Yi, H., Zhang, L., Tuo, Y., Han, X. and Du, M. (2010). A novel method for rapid detection

of class IIa bacteriocin-producing lactic acid bacteria. Food Control, 21(4), 426-430.

Zai, A.S., Ahmad, S. and Rasool, S.A. (2009). Bacteriocin production by indigenous marine

catfish associated Vibrio spp. Pakistan Journal of Pharmaceutical Sciences, 22(2),

162-167.

Zaib-un-Nisa, B., Mansoor S. N. and Siddiqui P. J. A. (2000). Species diversity of

cyanobacteria growing on pneumatophores and in the adjacent surface sediment in

mangrove swamp at Sandspit backwaters Karachi. Pakistan Journal of Marine

Biology, 6(1), 59-68.

Zaid A.P., Nasir M. and Rasool S.A. (2000). Bacteriocins of marine bacteria: activity

spectrum and biochemical characterization. In: Proceedings of national ONR

symposium on Arabian Sea as a Resource of Biological Diversity. University of

Karachi: Centre of Excellence in Marine Biology, 166-171.

Zaigham, N. A. (2004). Unauthorized squatter settlements are one of major sources for

polluting surface and subsurface waters in Karachi. In: Proceedings of the WSSD

workshop on human settlement and environment (Pakistan’s Response to its

Obligations under the WSSD Plan of Implementation). Islamabad, 14-15, 100-112.

Zehr, J.P., Waterbury, J.B., Turner, P.J., Montoya, J.P., Omoregie, E., Steward, G.F.,

Hansen, A. and Karl, D.M. (2001). Unicellular cyanobacteria fix N2 in the

subtropical North Pacific Ocean. Nature, 412(6847), 635-638.

Zhang, Z., Schwartz, S., Wagner, L. and Miller, W. (2000). A greedy algorithm for aligning

DNA sequences. Journal of Computational biology, 7(1-2), 203-214.

Zhongming, Z., Linong, L., Xiaona, Y., Wangqiang, Z., and Wei, L. (2009). Actinomycetes

for Marine Drug Discovery Isolated from Mangrove Soils and Plants in China.

Marine Drugs, 7(4), 495–496.

Zhou, S., Li, L., Wei, J. and Qin, Q. (2013). Genome sequence of Klebsiella pneumoniae

HSL4, a new strain isolated from mangrove sediment for biosynthesis of 1, 3-

propanediol. Genome announcements, 1(3), e00177-13.

247

APPENDIX

248

(I) Modified ASN-III Medium:

NaCl 35.0 g

MgSO4 x 7H2O 3.5 g

MgCl2 x 7H2O 2.0g

CaCl2 x 7H2O 0.5 g

KCL 0.5 g

Citric acid 3.0 mg

Ferric Ammonium Citrate 3.0 mg

EDTA (disodium salt) 0.5 mg

A-5 Trace Metals * 1.0 ml

NaNO3 0.75 g

K2HPO4. 3H2O 0.75 g

Na2CO3 0.02 g

Distilled Water 1000 ml

Agar (For solidified media) 2.3%

pH 7.4, filter and autoclave

*A-5 Trace Metals

H3BO3 2.86 g

MnCl2. 4H2O 1.81 g

ZnSO4. 7H2O 0.222 g

Na2 MoO4. 2H2O 0.039 g

CuSO4. 5H2O 0.079 g

Co(NO3)2. 6H2O 0.049 g

Distilled Water 1000 ml

249

(II) BG-11 Medium:

NaNO3 1.5 g

K2HPO4 0.04 g

MgSO4·7H2O 0.075 g

CaCl2·2H2O 0.036 g

Citric acid 0.006 g

Ferric Ammonium Citrate 0.006 g

EDTA (disodium salt) 0.001 g

Na2CO3 0.02 g

Trace metal mix A5 * 1.0 ml

Agar (for solidified media) 10.0 g

Distilled Water 1000 ml

pH 7.1, filter, autoclave

Trace metal mix-A5*

H3BO3 2.86 g

MnCl2·4H2O 1.81 g

ZnSO4·7H2O 0.222 g

NaMoO4·2H2O 0.39 g

CuSO4·5H2O 0.079 g

Co(NO3)2·6H2O 49.4 mg

Distilled Water 1000 ml

250

251

252

253

254

255

256

257