NAME________________________________________________________DATE___________________PERIOD__________

2.2 Evidence for Evolution Background

Scientists and crime solvers have something in common. They can both figure out what happened,even if no one was there to see it. They look for clues. The more clues that were left behind, the more likely they are to figure it out. If all of the clues point to the same conclusion, then they can form theories about what happened.

The earth is 4.54 billion years old. The first life on earth arose 3.5 billion years ago. This first life form was a single-celled microbe that lived in the oceans. The first land organisms appear in the fossil record about 430 million years ago. Scientists have been gathering evidence suggesting that evolution has been occurring since the first organism appeared, for the last several hundred years. They have found evidence in many different area of scientific research. Paleontology shows us that organisms have changed gradually over time in the fossil record. Biogeography shows us how new species arise near the location of very similar species. Closely related species share a common time and place. Developmental biology or Embryology, shows us that an organism builds on ancestral features as it develops from a single cell. Morphology or Comparative Anatomy shows us how organisms adapt ancestral features for new uses. Geneticsshows us that we can group related species by the similarity of their genes.

1. How are scientists like crime solvers?

2. List the five disciplines of science mentioned that have contributed evidence of evolution.

Evidence for Evolution: Fossils Part A: Paleontology - The Fossil Record

Scientists use the age of fossils as evidence for evolution. There are two ways of dating fossils: Relative dating and absolute dating. Relative dating uses a fossil’s location in rock layers to determine that fossil’s approximate age. Fossils found deeper in the ground are usually the oldest. Using the chart to the right, a paleontologist can therefore know that a fossil found in layer 1 at the dig site is older than a fossil found at layer 6, for example, by relative dating.

Absolute dating determines the fossil’s actual age by measuring amount of an element called carbon-14 in the fossil. There is a mathematical formula that will calculate the rate of decay of this element. By measuring the carbon-14 levels and plugging it into the math formula, the scientist can know an actual number of years old a fossil is.

1. List the two ways of finding the age of a fossil.

2. Which type of dating do you think is the most accurate? Why

3. In the image, which row of fossils is the oldest? ______

4. What type of dating did you use to answer question 3?

Part B: Examining Fossils

Use the information on the cards at the fossil station to find an example for each of the prompts. ** There may be more than one possible answer.

1) A fossil from 50-150mya 2) A fossil from 200-400mya

3) A fossil from over 500mya 4) How old is a dinosaur fossil?

5) A fossilized plant 6) A fossilized cast of an organism

7) A fossilized marine animal 8) A fossilized impression of an organism

9) A fossilized extinct organism 10) An organism fossilized in amber

11) A fossilized vertebrate (animal with a backbone)

12) A fossilized organism that lived on land.

13) How long has life been on earth?

14) First invertebrate life on earth (1st animal without a backbone).

15) The oldest fossils known to scientists (over 550 million years old)

16) A fossilized shelled organism.

17) A land animal. 18) A replica of a fossil

19) When did the first land animals appear? 20) How old is the earth?

21) A replica fossil of a human ancestor. 22) A fossil organism with gills.

23) A replica fossil of human’s closest living relative.

Evidence for Evolution: Genetic Comparisons

Mutations in the DNA sequence of species accumulate over time as the species evolves. If the DNA sequence for a certain gene is very similar in two species, one can assume that those two species had a recent common ancestor and are closely related a they’ve had less time for mutations to arise. For example all 312 bases in the cytochrome C gene are identical in humans and chimpanzees, human’s closest living relative.

Animal Section of DNA code for the cytochrome C gene

Number of differences in the DNA section in comparison to

humansHuman ATGCGGCTAGCTAGTTCGAAATCGAG n/a

Dog ATACGGCTAACTAGTTCGGAATCGAG 3Shark AGGGGCCTATCGAGTTCGACATTCTG 9

Rattlesnake ATGCGGTCAGCTAGCTCGAAAGCGAC 5Rhesus Monkey ATGCGGCTAGCTAGTTCGATATCGAG 1

1. Which organism is most closely related to humans? What is the evidence?

2. Which organism is least closely related to humans? What is the evidence?

3. Which animal shared a common ancestor with human’s furthest back in time? How do you know?

Evidence for Evolution: Embryology Evolution occurs slowly. In most cases it is not possible to observe evolution in progress.

However, evidence of evolution can be found by observing the early stages of development in

vertebrates (animals with backbones). All vertebrate embryos start out quite similar in appearance. This similarity has led scientists to infer (make an educated guess) that these organisms are related through a common ancestor. For example, fish, reptile, bird and a humans and all have gill slits and a tail with muscles to move it in early development. Later as the embryos grow and continue to develop, they become less and less similar. It is thought that organisms’ development as fetuses mimic their species’ evolutionary pathway.

The diagram below illustrates embryos in the first couple of weeks of development

1. Look again at the six embryos in their earliest stages. Describe the patterns you see. What physical similarities exist between each of the embryos?

2. Does the comparison of early stage and late stage embryonic development suggest an evolutionary relationship? Explain how these organisms all had the same ancestor at one point in time.

Evidence for Evolution: Homologous Structures

1. Color the bones of the human arm below as follows:

Humerus – red Ulna – yellow Phalanges – blueRadius – orange Carpal – green

2. Color the homologous bone in each of the other animals the same color as used in the human arm.

Homologous body structures share an ancestral origin. We know this because homologous structures have the same bones or tissues, in the same arrangement; however, they may have different forms and functions.

4. Describe the function of the limbs above for each of the organisms. (Hint: swim, fly, walk)Animal FunctionHumanWhale

CatBatBird

LizardFrog

5) Are the functions (what they are used for) of the limbs of each of the animals the same or different?

6) Compare: Describe how the bones are similar in each organism.

7) Contrast: Describe how the bones are different in each organism.

8) Based on the similarities and differences do you think the bones suggest that these organisms could have had a common ancestor at one point in time? Explain why or why not.

9) In fact, the species above do share a common ancestor from which they get their homologous limb structures. However, the limbs are not exactly the same. Describe what environmental pressures caused the whale and the birds limbs to evolve different functions from the same structures.

10) Do you think that ALL animals’ bones are homologous (come from a common ancestor)? Explain why or why not.

Analogous Body Structures: There are also examples of body structures in animals that are similar

in function but develop very different internal structures. These animals do not share a recent common ancestor.

Similar function does not mean that two species have evolved together. If the function is the same, but the structures are not similar, then there probably is no recent common ancestor.

1) In what ways are these limbs the same?

2) In what ways are these limbs different?

Vestigial structures are structures found in the body that no longer serve an important function. The human tail bone is an example! It suggests that humans evolved from a species that had a tail.Below are some vestigial structures found in humans. For each, hypothesize what its function may have been.

Evidence for Evolution: Biogeography

The biogeography of islands yields some of the best evidence for evolution. Consider the birds called finches that Darwin studied on the Galápagos Islands. All of the finches probably descended from one bird that arrived on the islands from South America. Until the first bird arrived, there had never been birds on the islands. The first bird was a seed eater. It evolved into many finch species. Each species was adapted for a different type of food that was found on each island. This is an example of adaptive radiation. This is the process by which a single species evolves into many new species to fill available niches.

1. What caused the evolution of the new traits seen in the island populations?

2. Choose two island birds from the diagram. Describe the differences in their environments that could explain how their populations evolved different types of beaks.